Title: Protein Kinase C-independent Activation of Protein Kinase D Is Involved in BMP-2-induced Activation of Stress Mitogen-activated Protein Kinases JNK and p38 and Osteoblastic Cell Differentiation
Abstract: An important role for JNK* and p38 has recently been discovered in the differentiating effect of bone morphogenetic protein 2 (BMP-2) on osteoblastic cells. In this study, we investigated the molecular mechanism by which BMP-2 activates JNK and p38 in MC3T3-E1 osteoblastic cells. Activation of JNK and p38 induced by BMP-2 was blocked by the protein kinase C/protein kinase D (PKC/PKD) inhibitor Go6976 but not by the related compound, Go6983, a selective inhibitor of conventional PKCs. Associated with this inhibitory effect of Go6976, BMP-2 induced a selective and a dose-dependent Ser916 phosphorylation/activation of PKD, which was also blocked by Go6976. In contrast to the recently described PKC-dependent molecular mechanism involved in activation of PKD by G protein-coupled receptor agonists, BMP-2 did not induce a phosphorylation of PKD on Ser744/748. To further document an implication of PKD in activation of JNK and p38 induced by BMP-2, we constructed MC3T3-E1 cells stably expressing PKD antisense oligonucleotide (AS-PKD). In AS-PKD clones having low PKD levels, activation of JNK and p38 by BMP-2, but not of Smad1/5, was markedly impaired compared with empty vector transfected (V-PKD) cells. Analysis of osteoblastic cell differentiation in AS-PKD compared with V-PKD cells showed that mRNA and protein expressions of alkaline phosphatase and osteocalcin induced by BMP-2 were markedly reduced in AS-PKD. In conclusion, results presented in this study indicate that BMP-2 can induce activation of PKD in osteoblastic cells by a PKC-independent mechanism and that this kinase is involved in activation of JNK and p38 induced by BMP-2. Thus, this pathway, in addition to Smads, appears to be essential for the effect of BMP-2 on osteoblastic cell differentiation. An important role for JNK* and p38 has recently been discovered in the differentiating effect of bone morphogenetic protein 2 (BMP-2) on osteoblastic cells. In this study, we investigated the molecular mechanism by which BMP-2 activates JNK and p38 in MC3T3-E1 osteoblastic cells. Activation of JNK and p38 induced by BMP-2 was blocked by the protein kinase C/protein kinase D (PKC/PKD) inhibitor Go6976 but not by the related compound, Go6983, a selective inhibitor of conventional PKCs. Associated with this inhibitory effect of Go6976, BMP-2 induced a selective and a dose-dependent Ser916 phosphorylation/activation of PKD, which was also blocked by Go6976. In contrast to the recently described PKC-dependent molecular mechanism involved in activation of PKD by G protein-coupled receptor agonists, BMP-2 did not induce a phosphorylation of PKD on Ser744/748. To further document an implication of PKD in activation of JNK and p38 induced by BMP-2, we constructed MC3T3-E1 cells stably expressing PKD antisense oligonucleotide (AS-PKD). In AS-PKD clones having low PKD levels, activation of JNK and p38 by BMP-2, but not of Smad1/5, was markedly impaired compared with empty vector transfected (V-PKD) cells. Analysis of osteoblastic cell differentiation in AS-PKD compared with V-PKD cells showed that mRNA and protein expressions of alkaline phosphatase and osteocalcin induced by BMP-2 were markedly reduced in AS-PKD. In conclusion, results presented in this study indicate that BMP-2 can induce activation of PKD in osteoblastic cells by a PKC-independent mechanism and that this kinase is involved in activation of JNK and p38 induced by BMP-2. Thus, this pathway, in addition to Smads, appears to be essential for the effect of BMP-2 on osteoblastic cell differentiation. BMPs 1The abbreviations used are: BMPs, bone morphogenetic proteins; ALP, alkaline phosphatase; α-MEM, α-modified essential medium; JNK, c-Jun-N-terminal kinase; DAG, diacylglycerol; GPCR, G protein-coupled receptor; MAPK, mitogen-activated protein kinase; MEK, MAPK kinase; Oc, osteocalcin; PH, Pleckstrin homology; PLC, phospholipase C; PKD, protein kinase D; PGF2α, prostaglandin F2α; PMA, phorbol 12-myristate 13-acetate; TGFβ, transforming growth factor β; PKC, protein kinase C. 1The abbreviations used are: BMPs, bone morphogenetic proteins; ALP, alkaline phosphatase; α-MEM, α-modified essential medium; JNK, c-Jun-N-terminal kinase; DAG, diacylglycerol; GPCR, G protein-coupled receptor; MAPK, mitogen-activated protein kinase; MEK, MAPK kinase; Oc, osteocalcin; PH, Pleckstrin homology; PLC, phospholipase C; PKD, protein kinase D; PGF2α, prostaglandin F2α; PMA, phorbol 12-myristate 13-acetate; TGFβ, transforming growth factor β; PKC, protein kinase C. are members of the TGF-β superfamily and exert a wide range of biological effects in different tissues. In particular, they contribute to the formation of bone and connective tissues (1.Schmitt J.M. Hwang K. Winn S.R. Hollinger J.O. J. Orthopaed. Res. 1999; 17: 269-278Crossref PubMed Scopus (270) Google Scholar) by inducing the differentiation of mesenchymal cells into bone-forming cells (2.Yamaguchi A. Semin. Cell Biol. 1995; 6: 165-173Crossref PubMed Scopus (140) Google Scholar). BMP-2 expression has been observed in a large variety of cells including osteoblasts (3.Iwasaki S. Tsuruoka N. Hattori A. Sato M. Tsujimoto M. Kohno M. J. Biol. Chem. 1995; 270: 5476-5482Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar). This factor is one of the most potent stimulators of osteoblastic cell differentiation, which is mainly characterized by expression of ALP, type I collagen, and Oc (4.Hughes F.J. Collyer J. Stanfield M. Goodman S.A. Endocrinology. 1995; 136: 2671-2677Crossref PubMed Scopus (200) Google Scholar, 5.Gazzerro E. Gangji V. Canalis E. J. Clin. Investig. 1998; 102: 2106-2114Crossref PubMed Scopus (275) Google Scholar, 6.Hay E. Hott M. Graulet A.M. Lomri A. Marie P.J. J. Cell. Biochem. 1999; 72: 81-93Crossref PubMed Scopus (83) Google Scholar). Members of the TGF-β superfamily exert their biological activities by binding to cell surface type I and II serine/threonine kinase receptors. The type II receptor phosphorylates type I receptor, which in turn phosphorylates and activates intracellular substrates such as proteins of the Smad family. Smad 1 (7.Kretzschmar M. Liu F. Hata A. Doody J. Massague J. Genes Dev. 1997; 11: 984-995Crossref PubMed Scopus (474) Google Scholar), and the closely related Smads 5 and 8, specifically mediate BMP-2 responses, such as for example, the osteoblastic differentiation of precursor cell lines (8.Yamamoto N. Akiyama S. Katagiri T. Namiki M. Kurokawa T. Suda T. Biochem. Biophys. Res. Commun. 1997; 238: 574-580Crossref PubMed Scopus (200) Google Scholar, 9.Nishimura R. Kato Y. Chen D. Harris S.E. Mundy G.R. Yoneda T. J. Biol. Chem. 1998; 273: 1872-1879Abstract Full Text Full Text PDF PubMed Scopus (270) Google Scholar). Upon phosphorylation, Smad 1/5/8 proteins interact with a common partner, Smad 4, and the complex Smad 1/5/8-Smad 4 translocates to the nucleus where it exerts transcriptional activity either through direct binding to DNA or via association with other DNA-binding proteins (10.Heldin C.H. Miyazono K. ten Dijke P. Nature. 1997; 390: 465-471Crossref PubMed Scopus (3301) Google Scholar). Among signal transducers recently reported to participate in TGF-β signaling, the MAPKs probably play a significant role in cooperating with Smads. MAPKs are a group of well described serine/threonine kinases implicated in the transmission of extracellular signals to intracellular targets (11.Garrington T.P. Johnson G.L. Curr. Opin. Cell Biol. 1999; 11: 211-218Crossref PubMed Scopus (1123) Google Scholar). Cooperative interaction between Smads and transcription factors activated by MAPKs has been recently described for TGF-β signaling. Several TGF-β-responsive elements containing AP1 binding sites are activated by c-Jun/c-Fos heterodimers (12.Zhang Y. Feng X.H. Derynck R. Nature. 1998; 394: 909-913Crossref PubMed Scopus (677) Google Scholar). It has also been reported that TGFβ and Smad 3 only weakly induce AP1-containing promoters in absence of c-Jun or c-Fos binding suggesting that Smads require active c-Jun/c-Fos dimers as DNA binding partners (13.Liberati N.T. Datto M.B. Frederick J.P. Shen X. Wong C. Rougier-Chapman E.M. Wang X.F. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 4844-4849Crossref PubMed Scopus (270) Google Scholar). Interestingly, Smads were found to preferentially interact with the phosphorylated form of c-Jun (13.Liberati N.T. Datto M.B. Frederick J.P. Shen X. Wong C. Rougier-Chapman E.M. Wang X.F. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 4844-4849Crossref PubMed Scopus (270) Google Scholar), which is generated by the activity of JNK. As for c-Jun/c-Fos, Smads can also cooperate with activated ATF2, which is generated upon phosphorylation by p38 MAPK (14.Sano Y. Harada J. Tashiro S. Gotoh-Mandeville R. Maekawa T. Ishii S. J. Biol. Chem. 1999; 274: 8949-8957Abstract Full Text Full Text PDF PubMed Scopus (312) Google Scholar). In relation with these recent observations, we recently found that JNK and p38 are activated by BMP-2 and documented their implication in the differentiating effect of this bone morphogenetic protein in MC3T3-E1 and primary calvaria-derived osteoblastic cells (15.Guicheux J. Lemonnier J. Suzuki A. Palmer G. Caverzasio J. J. Bone Miner. Res. 2003; 18: 2060-2068Crossref PubMed Scopus (262) Google Scholar). The molecular mechanism by which BMP-2 induces activation of JNK and p38 remains completely unknown. Recent studies indicated that BMP-2 can either activate the PI3 kinase Akt pathway in 2T3 cells (16.Ghosh-Choudhury N. Abboud S.L. Nishimura R. Celeste A. Mahimainathan L. Choudhury G.G. J. Biol. Chem. 2002; 277: 33361-33368Abstract Full Text Full Text PDF PubMed Scopus (257) Google Scholar) or PKC pathways in human neonatal calvaria cells (17.Hay E. Lemonnier J. Fromigue O. Marie P.J. J. Biol. Chem. 2001; 276: 29028-29036Abstract Full Text Full Text PDF PubMed Scopus (161) Google Scholar). The protein kinases C (PKCs) comprise a family of intracellular serine/threonine specific kinases, that are implicated in signal transduction of a wide range of biological responses, including changes in cell morphology, proliferation and differentiation (18.Hug H. Sarre T.F. Biochem. J. 1993; 291: 329-343Crossref PubMed Scopus (1215) Google Scholar, 19.Nishizuka Y. Science. 1992; 258: 607-614Crossref PubMed Scopus (4207) Google Scholar, 20.Toker A. Front Biosci. 1998; 3: D1134-D1147Crossref PubMed Google Scholar). The 13 members of the family can be grouped into three major classes of Ca2+-dependent classical PKCs (cPKCs), Ca2+-independent, novel PKCs (nPKCs), and Ca2+- and lipid-independent atypical PKCs (aPKC). The fourth PKC subgroup, which consists of PKCμ (21.Johannes F.J. Prestle J. Eis S. Oberhagemann P. Pfizenmaier K. J. Biol. Chem. 1994; 269: 6140-6148Abstract Full Text PDF PubMed Google Scholar), its mouse homologue protein kinase D1 (PKD) (22.Valverde A.M. Sinnett-Smith J. Van Lint J. Rozengurt E. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 8572-8576Crossref PubMed Scopus (356) Google Scholar), PKCν (23.Hayashi A. Seki N. Hattori A. Kozuma S. Saito T. Biochim. Biophys. Acta. 1999; 1450: 99-106Crossref PubMed Scopus (171) Google Scholar), and PKD2 (24.Sturany S. Van Lint J. Muller F. Wilda M. Hameister H. Hocker M. Brey A. Gern U. Vandenheede J. Gress T. Adler G. Seufferlein T. J. Biol. Chem. 2001; 276: 3310-3318Abstract Full Text Full Text PDF PubMed Scopus (156) Google Scholar), share common structures such as N-terminal cysteine fingers defining the structural basis for lipid-mediated activation. They differ from the three major groups of PKC isozymes by the presence of an acidic domain (25.Gschwendt M. Johannes F.J. Kittstein W. Marks F. J. Biol. Chem. 1997; 272: 20742-20746Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar), a PH domain and the lack of a typical pseudosubstrate site. PKD is ubiquitously expressed and involved in diverse cellular functions (26.Lint J.V. Rykx A. Vantus T. Vandenheede J.R. Int. J. Biochem. Cell Biol. 2002; 34: 577-581Crossref PubMed Scopus (44) Google Scholar, 27.Van Lint J. Rykx A. Maeda Y. Vantus T. Sturany S. Malhotra V. Vandenheede J.R. Seufferlein T. Trends Cell Biol. 2002; 12: 193-200Abstract Full Text Full Text PDF PubMed Scopus (201) Google Scholar, 28.Rykx A. De Kimpe L. Mikhalap S. Vantus T. Seufferlein T. Vandenheede J.R. Van Lint J. FEBS Lett. 2003; 546: 81-86Crossref PubMed Scopus (194) Google Scholar), such as constitutive transport processes in epithelial cells (29.Prestle J. Pfizenmaier K. Brenner J. Johannes F.J. J. Cell Biol. 1996; 134: 1401-1410Crossref PubMed Scopus (100) Google Scholar), G protein-mediated regulation of Golgi organization (30.Jamora C. Yamanouye N. Van Lint J. Laudenslager J. Vandenheede J.R. Faulkner D.J. Malhotra V. Cell. 1999; 98: 59-68Abstract Full Text Full Text PDF PubMed Scopus (240) Google Scholar) and protection from apoptosis (31.Johannes F.J. Horn J. Link G. Haas E. Siemienski K. Wajant H. Pfizenmaier K. Eur. J. Biochem. 1998; 257: 47-54Crossref PubMed Scopus (64) Google Scholar). Given the important role of the stress kinases JNK and p38 in BMP-2-induced osteoblastic cell differentiation (15.Guicheux J. Lemonnier J. Suzuki A. Palmer G. Caverzasio J. J. Bone Miner. Res. 2003; 18: 2060-2068Crossref PubMed Scopus (262) Google Scholar), we sought to investigate the molecular mechanism involved in the activation of these MAP kinases and studied the role of PKCs in mediating this signaling process. We found that activation of PKD by a PKC-independent mechanism is involved in activation of these stress MAP kinases by BMP-2 in MC3T3-E1 cells. Using antisense oligonucleotide technique, we also provide compelling evidences that this signaling pathway is required for osteoblastic cell differentiation. Reagents, Antibodies, and Plasmids—FCS, glutamine, antibiotics, and trypsin/EDTA were obtained from Invitrogen. α-MEM was purchased from Amimed (Bioconcept, Allschwill, Switzerland) and PMA from Sigma (Sigma Chemical Co.). GST-c-Jun and GST-c-ATF2 were obtained from Santa Cruz Biotechnology Inc (Santa Cruz, CA). Go6976 and Go6983 were obtained from Calbiochem-Novabiochem Corp. (San Diego, CA). [γ-32P]ATP was purchased from Amersham Biosciences. Polyclonal anti-JNK, anti-p38, anti-PKCμ/PKD (C terminus of mouse origin), and anti-p-c-Jun were obtained from Santa Cruz Biotechnology Inc (Santa Cruz, CA). Polyclonal anti-Smad 1/5 and anti-pPKCϵ were from Upstate Biotechnology (Lake Placid, NY). Polyclonal anti-pp38, anti-pPKD/PKCμ(Ser916), anti-pPKD/PKCμ(Ser744/748), pSmad 1/5, anti-pMEK4, anti-pMEK3,6, anti-pPan-PKC, anti-pPKCξ/λ, anti-PKCδ, and the monoclonal anti-pJNK were obtained from New England BioLabs (Cell Signaling Technology, MA). Cell Culture and Transfection—Mouse calvaria-derived MC3T3-E1 cells were cultured in α-MEM containing 10% fetal calf serum (v/v), 0.5% nonessential amino acids (v/v), 100 IU/ml penicillin, and 100 μg/ml streptomycin. In experiments aimed at testing the effect of BMP-2, cells were switched to 2% fetal calf serum 24 h before and during the study. When the influence of PKC inhibitors was investigated, agents were added 1 h prior to and during the experiments. For the construction of PKD antisense (AS-PKD) plasmid, an oligonucleotide of 70 bases, targeted against sequences adjacent to the ATG initiation codon of PKD (PKCμ) mRNA, was synthesized with BamHI and EcoRI sites in 5′ and 3′, respectively (MWG Biotech, Germany). The oligonucleotide sequence was 5′-GGGCT AGGCGGTCGCAGCAGCGGAGGGACGCTCATCCCGCCAGTGAGCCCCAAAGTTTGGCGGACGTGGG-3′. This oligonucleotide and its complementary strand were annealed and ligated into the mammalian expression vector pcDNA3.1 (Invitrogen) containing cytomegalovirus promoter and neomycin resistance gene. MC3T3-E1 cells were transfected with either the AS-PKD or empty vector using Superfect. Transfected cells were selected with G418 sulfate (Calbiochem-Novabiochem Corp., San Diego, CA) at 0.8, 0.4, 0.2 mg/ml during the first, second, and third week, respectively, following plasmids transfection. Selected cell lines were then cultured in the presence of 0.2 mg/ml G418 sulfate. Cell Lysis, Immunoprecipitation, and Immunoblotting—MC3T3-E1 cells treated with different agents were rapidly frozen in liquid nitrogen and stored at –80 °C until used for analysis. Cells were lysed in buffer A containing 50 mm Tris (pH 7.4), 150 mm NaCl, 1 mm phenylmethylsulfonyl fluoride, 10 μg/ml aprotinin, 10 μg/ml leupeptin, 2 mm Na3VO4, 0.01 μm calyculin A, 0.1 μm mycrocystin LR, 1% Nonidet P-40, 1% sodium deoxycholate, and 0.1% SDS for 10 min. Lysates were then cleared by centrifugation at 6000 × g for 30 min. and subsequently immunoprecipitated with 2–3 μg/ml antibodies for 18 h at 4 °C. Protein A-Sepharose beads 20–30 μl were then added in each tube during the last hour of incubation. Precipitates were washed three times with lysis buffer, suspended in SDS sample buffer and heated at 70 °C for 30 min and subjected to gel electrophoresis on 6–15% gels. Following SDS-PAGE electrophoresis, proteins were transferred to Immobilon P membranes and immunoblotted as previously described (32.Caverzasio J. Palmer G. Suzuki A. Bonjour J.P. J. Bone Miner. Res. 1997; 12: 1975-1983Crossref PubMed Scopus (50) Google Scholar). Detection was performed using peroxidase-coupled secondary, enhanced chemiluminescence reaction and visualization by autoradiography (Amersham Biosciences). Filters that were reprobed with different antibodies were stripped according to the manufacturer's protocol. In Vitro Kinase Assay—Immunoprecipitates were washed three times with a kinase reaction buffer containing 50 mm Tris pH 7.4, 25 mm β-glycerophosphate, 20 mm MgCl2, 1.0 mm dithiothreitol and incubated with 10 μm32P-ATP (50 μCi/ml) either alone for 30 min at 30 °C for PKD autophosphorylation or with appropriate GST-MAPK substrate during 60 min for MAPK assays. The reaction was stopped by addition of 2× reducing buffer, and the products were resolved by SDS-PAGE. The incorporation of [32P]phosphate was visualized by autoradiography. Biochemical Analysis of Markers of Bone Cell Differentiation—Cells were seeded in 24-well tissue culture plates for 7 days before BMP-2 exposure. ALP activity was assessed as previously reported (33.Suzuki A. Palmer G. Bonjour J.P. Caverzasio J. Bone. 1998; 23: 197-203Crossref PubMed Scopus (78) Google Scholar) using p-nitrophenyl phosphate as a chromogenic substrate. The release of Oc in the medium was measured by radioimmunoassay using a goat anti-mouse osteocalcin antibody and a donkey anti-goat secondary antibody (Biomedical Technologies, Inc., Stoughton, MA). Protein contents were determined using the Pierce Coomassie Plus assay reagent (Pierce). RNA Isolation and Northern Blotting Analysis—Total cellular RNA was extracted using the Tripure reagent (Roche Applied Science) according to the manufacturer's instruction. Equal amounts (10 μg) of RNA were electrophoretically resolved on an 1.5% agarose gel in phosphate buffer and transferred onto GeneScreen Plus nylon membrane (DuPont de Nemours, Brussels, Belgium) by overnight capillary transfer. Membranes were prehybridized at 68 °C for 2 h in Quickhyb (Stratagene) complemented with 5 μg/ml ssDNA before hybridization at 68 °C for 3 h with the desired cDNA probe labeled with 50 μCi of deoxy-[α-32P]CTP by random priming (Megaprime DNA labeling system, Amersham Biosciences). The filters were finally exposed for autoradiography at –80 °C. A 2.5-kb EcoRI restriction fragment corresponding to the rat ALP cDNA (34.Thiede M.A. Yoon K. Golub E.E. Noda M. Rodan G.A. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 319-323Crossref PubMed Scopus (107) Google Scholar) was providing by Dr. Rodan (Merck Sharp and Dohme Research Laboratories, Westpoint). The mouse osteocalcin cDNA probe was obtained by RT-PCR using specific primers as previously described (35.Ikegame M. Ishibashi O. Yoshizawa T. Shimomura J. Komori T. Ozawa H. Kawashima H. J. Bone. Miner. Res. 2001; 16: 24-32Crossref PubMed Scopus (98) Google Scholar). The RT-PCR product was then purified using a gel extraction kit (Qiagen II, Qiagen, Basel, Switzerland). The amount of cyclophilin transcript detected in the same conditions was assessed using a cDNA probe for human cyclophilin (36.Haendler B. Hofer-Warbinek R. Hofer E. EMBO J. 1987; 6: 947-950Crossref PubMed Scopus (238) Google Scholar). Statistical Analysis—All experiments were carried out independently at least three times. Results are expressed as the mean ± S.E. Comparative studies of means were performed using one-way analysis of variance followed by a post-hoc test (projected least significant difference Fisher) with a significance value of p < 0.05. We recently found that BMP-2 can induce a stimulation of JNK and p38 in MC3T3-E1 and primary calvaria-derived osteoblastic cells (15.Guicheux J. Lemonnier J. Suzuki A. Palmer G. Caverzasio J. J. Bone Miner. Res. 2003; 18: 2060-2068Crossref PubMed Scopus (262) Google Scholar). Expression of this newly described BMP-2-induced signaling pathway was found to be delayed compared with activation of Smads and the underlying molecular mechanism of activation remained to be investigated. Among functional signaling pathways recently described to mediate BMP-2 effects in osteoblastic cells, PKCs have been reported to be involved in BMP-2-induced apoptosis in human neonatal calvaria cells (17.Hay E. Lemonnier J. Fromigue O. Marie P.J. J. Biol. Chem. 2001; 276: 29028-29036Abstract Full Text Full Text PDF PubMed Scopus (161) Google Scholar). To study the possible implication of a PKC in BMP-2-induced activation of stress MAP kinases JNK and p38, we used two staurosporine-derived selective PKC inhibitors, Go6983 and Go6976, that have different PKC inhibitory specificities. The former inhibits the activity of PKCα, PKCβI, PKCβII, PKCδ, and pKCγ whereas the latter blunts PKCα and PKCβI as well as PKCμ/PKD activities (37.Gschwendt M. Dieterich S. Rennecke J. Kittstein W. Mueller H.J. Johannes F.J. FEBS Lett. 1996; 392: 77-80Crossref PubMed Scopus (557) Google Scholar). As shown in Fig. 1, Go6983 had no effect on stress MAP kinases activation induced by BMP-2 whereas Go6976 completely blunted this response. Since the main difference between the two compounds for inhibiting PKCs is PKCμ/PKD, this observation suggested that this kinase might be involved in BMP-2-induced activation of JNK and p38. To investigate whether PKD is involved in this signaling response, we first analyzed whether BMP-2 can activate PKD in MC3T3-E1 cells. Using a rabbit polyclonal antibody recognizing a C-terminal epitope, PKD appeared as a doubled protein band (∼110 and 115 kDa) on Western blots (Fig. 2). Whether these two bands correspond to different members of the PKD family or of two different sizes of one member is not clear at the moment. Of interest and as further discussed below, we found that BMP-2 mainly induced an increase in Ser916 phosphorylation of the higher molecular size of this doubled protein band and this effect was blunted by Go6976 but not by Go6983 and was still detectable in cells preincubated for 18 h with 1 μm PMA to down regulate DAG-sensitive PKCs (Fig. 2). Associated with this effect of BMP-2 on Ser916 PKD phosphorylation, which was previously reported to modify the conformation of the kinase and to influence the duration of its kinase activity (38.Vertommen D.R.M. Ni Y. Waelkens E. Merlevede W. Vandenheede J.R. Van Lint J. J. Biol. Chem. 2000; 275: 19567-19576Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar), we did not find any change in activation of either conventional PKCs or of PKCϵ and PKCλ (Fig. 2), two novel PKCs recently shown to preferentially activate PKD (39.Waldron R.T. Rey O. Iglesias T. Tugal T. Cantrell D. Rozengurt E. J. Biol. Chem. 2001; 276: 32606-32615Abstract Full Text Full Text PDF PubMed Scopus (143) Google Scholar). Thus, this series of observations indicate that BMP-2 can activate PKD in osteoblast-like cells but the implication of a PKC in this activation remains unclear. To further document that BMP-2 can activate PKD and that this kinase is involved in activation of JNK and p38, we analyzed the relationship between changes in PKD activity (in vitro kinase assay) and of JNK and p38 in cells treated with various doses of BMP-2 (Fig. 3A). We also studied the dose inhibitory effects of Go6976 on changes in PKD Ser916 phosphorylation and of JNK activity induced by BMP-2 (Fig. 3B). Both analysis revealed a close relationship between activation of PKD induced by BMP-2 and the stimulation of stress MAP kinases JNK and p38, further suggesting an implication of PKD in this signaling response. A time course analysis of PKD and JNK activation induced by BMP-2 was also performed and data are shown in Fig. 4. Clearly, changes in Ser916 phosphorylation of PKD induced by BMP-2 preceded by about 1 h the stimulation of c-Jun phosphorylation that correlates with activation of JNK in MC3T3-E1 cells (15.Guicheux J. Lemonnier J. Suzuki A. Palmer G. Caverzasio J. J. Bone Miner. Res. 2003; 18: 2060-2068Crossref PubMed Scopus (262) Google Scholar). In this series of experiments, we also analyzed whether BMP-2 induces a change in PKC-mediated PKD Ser744/748 phosphorylation as recently reported in response to GPCR agonists in fibroblasts and epithelial cells (39.Waldron R.T. Rey O. Iglesias T. Tugal T. Cantrell D. Rozengurt E. J. Biol. Chem. 2001; 276: 32606-32615Abstract Full Text Full Text PDF PubMed Scopus (143) Google Scholar, 40.Rey O. Young S.H. Cantrell D. Rozengurt E. J. Biol. Chem. 2001; 276: 32616-32626Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar). In contrast to the reproducible effect of PGF2α on PKD Ser744/748 phosphorylation 2J. Caverzasio and C. Ghayor, manuscript in preparation. that acts through GqPCRs in MC3T3-E1 cells (41.Hakeda Y. Hotta T. Kurihara N. Ikeda E. Maeda N. Yagyu Y. Kumegawa M. Endocrinology. 1987; 121: 1966-1974Crossref PubMed Scopus (99) Google Scholar), we never detected such effect in response to BMP-2 (Fig. 4B).Fig. 2Role of PKC in activation of PKD by BMP-2. Confluent MC3T3-E1 cells were preincubated with 10 μm of either Go6976 or Go6983 or their vehicle for 1 h or with 1 μm PMA for 18 h and then exposed to BMP-2 (100 ng/ml) for 3 h before lysis at 4 °C. Equal amounts of proteins were used for analysis of either changes in the phosphorylation of conventional PKCs (pPan-PKC), atypical PKCζ/λ, novel PKCϵ, pPKD (pSer916), or total PKD by Western blotting.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Fig. 3Dose effect of either BMP-2 or of the Go6976 PKC/PKD inhibitor on activation of PKD and JNK and p38.A, confluent MC3T3-E1 cells were incubated with different doses of BMP-2 for 3 h. Lysate proteins were then immunoprecipitated with either specific anti-PKD antibody or anti-phospho-JNK or anti-phospho-p38 antibodies for in vitro kinase analysis (IVK). Immune complexes were incubated with either [γ-32P]ATP alone for PKD activity analysis or [γ-32P]ATP and the appropriate MAPK substrate for JNK and p38 activity. B, confluent MC3T3-E1 cells were preincubated with different doses of Go6976 or vehicle for 1 h and then exposed to BMP-2 (100 ng/ml) for 3 h. Lysate proteins were then immunoprecipitated with specific anti-phospho-JNK antibody for in vitro kinase or directly investigated by Western blot analysis for the determination of changes in either the level of PKD or its phosphorylation on Ser916 (pSer916).View Large Image Figure ViewerDownload Hi-res image Download (PPT)Fig. 4Kinetic of changes in Ser916 PKD phosphorylation and activation of JNK as well as analysis of Ser744/748 phosphorylation induced by BMP-2. Confluent MC3T3-E1 cells were exposed to BMP-2 (100 ng/ml) for different time points and to PGF-2α (10–6m) for 1 h. Lysate proteins were then investigated by Western blot analysis for the determination of changes in the level of either Ser916 PKD or c-Jun phosphorylations (A) as well as changes in Ser744/748 PKD phosphorylation (B).View Large Image Figure ViewerDownload Hi-res image Download (PPT) To further document that PKD is implicated in BMP-2-induced activation of JNK and p38, we constructed MC3T3-E1 cell lines stably expressing a PKD antisense oligonucleotide. The sequence of this oligonucleotide is described under “Experimental Procedures” and was targeted against the first ATG start codon of mouse PKD1 mRNA transcript. Expression of PKD was monitored in several clones and two of them (AS1-PKD and AS2-PKD) having selectively lost expression of the upper PKD protein band (Fig. 5A) were selected for further analysis. Clearly, the absence of this PKD protein band, which corresponds to the band in which we detected a change in the phosphorylation of PKD on Ser916 in response to BMP-2, was associated with a nearly complete loss of JNK and p38 activation induced by BMP-2 compared with a normal response in empty vector stably transfected cells (Fig. 5B). As expected, associated with the absence of this PKD molecule, basal and stimulated PKD activity as well as increase in Ser916 PKD induced by BMP-2 were markedly decreased (Fig. 6A). Of interest, activation of Smad1/5 by BMP-2 was practically normal in these AS-PKD clones (Fig. 6A and similar results for AS2 not shown) indicating that this effect is not related to impairment in BMP-2 receptor expression and/or activity.Fig. 6Selective inhibition of PKD and of J
Publication Year: 2003
Publication Date: 2003-12-24
Language: en
Type: article
Indexed In: ['crossref', 'pubmed']
Access and Citation
Cited By Count: 130
AI Researcher Chatbot
Get quick answers to your questions about the article from our AI researcher chatbot