Publication Information

{'id': 'https://openalex.org/W2042129286', 'doi': 'https://doi.org/10.1074/jbc.m413452200', 'title': 'Pokeweed Antiviral Protein Inhibits Brome Mosaic Virus Replication in Plant Cells', 'display_name': 'Pokeweed Antiviral Protein Inhibits Brome Mosaic Virus Replication in Plant Cells', 'publication_year': 2005, 'publication_date': '2005-03-12', 'ids': {'openalex': 'https://openalex.org/W2042129286', 'doi': 'https://doi.org/10.1074/jbc.m413452200', 'mag': '2042129286', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/15764597'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m413452200', 'pdf_url': 'http://www.jbc.org/article/S0021925820617951/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S0021925820617951/pdf', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5083880051', 'display_name': 'Daniel Picard', 'orcid': 'https://orcid.org/0000-0003-3375-6202'}, 'institutions': [{'id': 'https://openalex.org/I192455969', 'display_name': 'York University', 'ror': 'https://ror.org/05fq50484', 'country_code': 'CA', 'type': 'education', 'lineage': ['https://openalex.org/I192455969']}], 'countries': ['CA'], 'is_corresponding': False, 'raw_author_name': 'Daniel Picard', 'raw_affiliation_strings': ['\xa0Department of Biology \xa0York University \xa0Toronto \xa0Ontario M3J 1P3 \xa0Canada'], 'affiliations': [{'raw_affiliation_string': '\xa0Department of Biology \xa0York University \xa0Toronto \xa0Ontario M3J 1P3 \xa0Canada', 'institution_ids': ['https://openalex.org/I192455969']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5054379040', 'display_name': 'C. Cheng Kao', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I91045830', 'display_name': 'Texas A&M University', 'ror': 'https://ror.org/01f5ytq51', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I91045830']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'C. Cheng Kao', 'raw_affiliation_strings': ['Department of Biochemistry and Biophysics, Texas A & M University, College Station, Texas 77843-2128.'], 'affiliations': [{'raw_affiliation_string': 'Department of Biochemistry and Biophysics, Texas A & M University, College Station, Texas 77843-2128.', 'institution_ids': ['https://openalex.org/I91045830']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5031852302', 'display_name': 'Katalin A. Hudak', 'orcid': 'https://orcid.org/0000-0001-5355-7839'}, 'institutions': [{'id': 'https://openalex.org/I192455969', 'display_name': 'York University', 'ror': 'https://ror.org/05fq50484', 'country_code': 'CA', 'type': 'education', 'lineage': ['https://openalex.org/I192455969']}], 'countries': ['CA'], 'is_corresponding': False, 'raw_author_name': 'Katalin A. Hudak', 'raw_affiliation_strings': ['\xa0Department of Biology \xa0York University \xa0Toronto \xa0Ontario M3J 1P3 \xa0Canada'], 'affiliations': [{'raw_affiliation_string': '\xa0Department of Biology \xa0York University \xa0Toronto \xa0Ontario M3J 1P3 \xa0Canada', 'institution_ids': ['https://openalex.org/I192455969']}]}], 'institution_assertions': [], 'countries_distinct_count': 2, 'institutions_distinct_count': 2, 'corresponding_author_ids': [], 'corresponding_institution_ids': [], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 1.23, 'has_fulltext': True, 'fulltext_origin': 'ngrams', 'cited_by_count': 50, 'citation_normalized_percentile': {'value': 0.882465, 'is_in_top_1_percent': False, 'is_in_top_10_percent': False}, 'cited_by_percentile_year': {'min': 93, 'max': 94}, 'biblio': {'volume': '280', 'issue': '20', 'first_page': '20069', 'last_page': '20075'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T12477', 'display_name': 'Toxin Mechanisms and Immunotoxins', 'score': 0.9999, 'subfield': {'id': 'https://openalex.org/subfields/2403', 'display_name': 'Immunology'}, 'field': {'id': 'https://openalex.org/fields/24', 'display_name': 'Immunology and Microbiology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, 'topics': [{'id': 'https://openalex.org/T12477', 'display_name': 'Toxin Mechanisms and Immunotoxins', 'score': 0.9999, 'subfield': {'id': 'https://openalex.org/subfields/2403', 'display_name': 'Immunology'}, 'field': {'id': 'https://openalex.org/fields/24', 'display_name': 'Immunology and Microbiology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T10494', 'display_name': 'Plant Virus Research Studies', 'score': 0.9993, 'subfield': {'id': 'https://openalex.org/subfields/1110', 'display_name': 'Plant Science'}, 'field': {'id': 'https://openalex.org/fields/11', 'display_name': 'Agricultural and Biological Sciences'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T12856', 'display_name': 'Transgenic Plants and Applications', 'score': 0.986, 'subfield': {'id': 'https://openalex.org/subfields/1305', 'display_name': 'Biotechnology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/brome-mosaic-virus', 'display_name': 'Brome mosaic virus', 'score': 0.9691354}, {'id': 'https://openalex.org/keywords/subgenomic-mrna', 'display_name': 'Subgenomic mRNA', 'score': 0.86634636}, {'id': 'https://openalex.org/keywords/ribosome-inactivating-protein', 'display_name': 'Ribosome-inactivating protein', 'score': 0.46348932}, {'id': 'https://openalex.org/keywords/mosaic-virus', 'display_name': 'Mosaic virus', 'score': 0.4507768}], 'concepts': [{'id': 'https://openalex.org/C2779535198', 'wikidata': 'https://www.wikidata.org/wiki/Q4163153', 'display_name': 'Brome mosaic virus', 'level': 5, 'score': 0.9691354}, {'id': 'https://openalex.org/C189819185', 'wikidata': 'https://www.wikidata.org/wiki/Q384283', 'display_name': 'Subgenomic mRNA', 'level': 4, 'score': 0.86634636}, {'id': 'https://openalex.org/C67705224', 'wikidata': 'https://www.wikidata.org/wiki/Q11053', 'display_name': 'RNA', 'level': 3, 'score': 0.7125548}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.6863589}, {'id': 'https://openalex.org/C159047783', 'wikidata': 'https://www.wikidata.org/wiki/Q7215', 'display_name': 'Virology', 'level': 1, 'score': 0.54629076}, {'id': 'https://openalex.org/C2780128948', 'wikidata': 'https://www.wikidata.org/wiki/Q24788543', 'display_name': 'Ribosome-inactivating protein', 'level': 5, 'score': 0.46348932}, {'id': 'https://openalex.org/C88478588', 'wikidata': 'https://www.wikidata.org/wiki/Q42244', 'display_name': 'Ribosome', 'level': 4, 'score': 0.45950246}, {'id': 'https://openalex.org/C140704245', 'wikidata': 'https://www.wikidata.org/wiki/Q3933202', 'display_name': 'Viral replication', 'level': 3, 'score': 0.45209154}, {'id': 'https://openalex.org/C2780951447', 'wikidata': 'https://www.wikidata.org/wiki/Q1948859', 'display_name': 'Mosaic virus', 'level': 4, 'score': 0.4507768}, {'id': 'https://openalex.org/C3675279', 'wikidata': 'https://www.wikidata.org/wiki/Q211935', 'display_name': 'Protein biosynthesis', 'level': 2, 'score': 0.4480628}, {'id': 'https://openalex.org/C41258723', 'wikidata': 'https://www.wikidata.org/wiki/Q2919111', 'display_name': 'RNA-dependent RNA polymerase', 'level': 4, 'score': 0.4440755}, {'id': 'https://openalex.org/C2522874641', 'wikidata': 'https://www.wikidata.org/wiki/Q808', 'display_name': 'Virus', 'level': 2, 'score': 0.40897852}, {'id': 'https://openalex.org/C153911025', 'wikidata': 'https://www.wikidata.org/wiki/Q7202', 'display_name': 'Molecular biology', 'level': 1, 'score': 0.36247408}, {'id': 'https://openalex.org/C109110057', 'wikidata': 'https://www.wikidata.org/wiki/Q1495434', 'display_name': 'Plant virus', 'level': 3, 'score': 0.35835767}, {'id': 'https://openalex.org/C55493867', 'wikidata': 'https://www.wikidata.org/wiki/Q7094', 'display_name': 'Biochemistry', 'level': 1, 'score': 0.18919379}, {'id': 'https://openalex.org/C104317684', 'wikidata': 'https://www.wikidata.org/wiki/Q7187', 'display_name': 'Gene', 'level': 2, 'score': 0.12989366}], 'mesh': [{'descriptor_ui': 'D017795', 'descriptor_name': 'Bromovirus', 'qualifier_ui': 'Q000187', 'qualifier_name': 'drug effects', 'is_major_topic': True}, {'descriptor_ui': 'D017795', 'descriptor_name': 'Bromovirus', 'qualifier_ui': 'Q000502', 'qualifier_name': 'physiology', 'is_major_topic': True}, {'descriptor_ui': 'D009699', 'descriptor_name': 'N-Glycosyl Hydrolases', 'qualifier_ui': 'Q000494', 'qualifier_name': 'pharmacology', 'is_major_topic': True}, {'descriptor_ui': 'D010940', 'descriptor_name': 'Plant Proteins', 'qualifier_ui': 'Q000494', 'qualifier_name': 'pharmacology', 'is_major_topic': True}, {'descriptor_ui': 'D014779', 'descriptor_name': 'Virus Replication', 'qualifier_ui': 'Q000187', 'qualifier_name': 'drug effects', 'is_major_topic': True}, {'descriptor_ui': 'D001483', 'descriptor_name': 'Base Sequence', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D017795', 'descriptor_name': 'Bromovirus', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D004926', 'descriptor_name': 'Escherichia coli', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D004926', 'descriptor_name': 'Escherichia coli', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D004926', 'descriptor_name': 'Escherichia coli', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D001467', 'descriptor_name': 'Hordeum', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D001467', 'descriptor_name': 'Hordeum', 'qualifier_ui': 'Q000187', 'qualifier_name': 'drug effects', 'is_major_topic': False}, {'descriptor_ui': 'D001467', 'descriptor_name': 'Hordeum', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D001467', 'descriptor_name': 'Hordeum', 'qualifier_ui': 'Q000821', 'qualifier_name': 'virology', 'is_major_topic': False}, {'descriptor_ui': 'D009154', 'descriptor_name': 'Mutation', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D009699', 'descriptor_name': 'N-Glycosyl Hydrolases', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D009699', 'descriptor_name': 'N-Glycosyl Hydrolases', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D029603', 'descriptor_name': 'Phytolacca', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D029603', 'descriptor_name': 'Phytolacca', 'qualifier_ui': 'Q000737', 'qualifier_name': 'chemistry', 'is_major_topic': False}, {'descriptor_ui': 'D029603', 'descriptor_name': 'Phytolacca', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D010940', 'descriptor_name': 'Plant Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D010940', 'descriptor_name': 'Plant Proteins', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D011523', 'descriptor_name': 'Protoplasts', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011523', 'descriptor_name': 'Protoplasts', 'qualifier_ui': 'Q000187', 'qualifier_name': 'drug effects', 'is_major_topic': False}, {'descriptor_ui': 'D011523', 'descriptor_name': 'Protoplasts', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D011523', 'descriptor_name': 'Protoplasts', 'qualifier_ui': 'Q000821', 'qualifier_name': 'virology', 'is_major_topic': False}, {'descriptor_ui': 'D012367', 'descriptor_name': 'RNA, Viral', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D012367', 'descriptor_name': 'RNA, Viral', 'qualifier_ui': 'Q000737', 'qualifier_name': 'chemistry', 'is_major_topic': False}, {'descriptor_ui': 'D012367', 'descriptor_name': 'RNA, Viral', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D012367', 'descriptor_name': 'RNA, Viral', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D011994', 'descriptor_name': 'Recombinant Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011994', 'descriptor_name': 'Recombinant Proteins', 'qualifier_ui': 'Q000494', 'qualifier_name': 'pharmacology', 'is_major_topic': False}, {'descriptor_ui': 'D011994', 'descriptor_name': 'Recombinant Proteins', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D054789', 'descriptor_name': 'Ribosome Inactivating Proteins, Type 1', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D012270', 'descriptor_name': 'Ribosomes', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D012270', 'descriptor_name': 'Ribosomes', 'qualifier_ui': 'Q000821', 'qualifier_name': 'virology', 'is_major_topic': False}, {'descriptor_ui': 'D012270', 'descriptor_name': 'Ribosomes', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D012270', 'descriptor_name': 'Ribosomes', 'qualifier_ui': 'Q000187', 'qualifier_name': 'drug effects', 'is_major_topic': False}, {'descriptor_ui': 'D014779', 'descriptor_name': 'Virus Replication', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}], 'locations_count': 2, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m413452200', 'pdf_url': 'http://www.jbc.org/article/S0021925820617951/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/15764597', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m413452200', 'pdf_url': 'http://www.jbc.org/article/S0021925820617951/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [{'display_name': 'Life on land', 'id': 'https://metadata.un.org/sdg/15', 'score': 0.51}], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 48, 'referenced_works': ['https://openalex.org/W124584053', 'https://openalex.org/W150824067', 'https://openalex.org/W1519055488', 'https://openalex.org/W1533831149', 'https://openalex.org/W1569531441', 'https://openalex.org/W179979008', 'https://openalex.org/W1917399449', 'https://openalex.org/W1964689773', 'https://openalex.org/W1976754433', 'https://openalex.org/W1977863283', 'https://openalex.org/W1978471475', 'https://openalex.org/W1981176722', 'https://openalex.org/W1984349537', 'https://openalex.org/W1985067074', 'https://openalex.org/W1987558980', 'https://openalex.org/W1988473696', 'https://openalex.org/W1991928942', 'https://openalex.org/W1997099356', 'https://openalex.org/W1997714902', 'https://openalex.org/W1998144653', 'https://openalex.org/W2006140229', 'https://openalex.org/W2014067427', 'https://openalex.org/W2017461061', 'https://openalex.org/W2025930859', 'https://openalex.org/W2027148086', 'https://openalex.org/W2029816142', 'https://openalex.org/W2039290476', 'https://openalex.org/W2049315807', 'https://openalex.org/W2049421697', 'https://openalex.org/W2065061097', 'https://openalex.org/W2072839681', 'https://openalex.org/W2076101600', 'https://openalex.org/W2081579862', 'https://openalex.org/W2085825896', 'https://openalex.org/W2089822958', 'https://openalex.org/W2092527458', 'https://openalex.org/W2092867032', 'https://openalex.org/W2095433332', 'https://openalex.org/W2097432692', 'https://openalex.org/W2097602179', 'https://openalex.org/W2111252388', 'https://openalex.org/W2125714200', 'https://openalex.org/W2127242992', 'https://openalex.org/W2129468535', 'https://openalex.org/W2131566401', 'https://openalex.org/W2134466391', 'https://openalex.org/W2139636517', 'https://openalex.org/W2146042887'], 'related_works': ['https://openalex.org/W2740730431', 'https://openalex.org/W2160262431', 'https://openalex.org/W2159496638', 'https://openalex.org/W2158054780', 'https://openalex.org/W2139636517', 'https://openalex.org/W2127355386', 'https://openalex.org/W2116063232', 'https://openalex.org/W1991928942', 'https://openalex.org/W1977863283', 'https://openalex.org/W1859606218'], 'abstract_inverted_index': {'Pokeweed': [0, 192, 384], 'antiviral': [1, 150, 193, 342, 385, 394, 423, 539, 782, 1049], 'protein': [2, 7, 50, 194, 199, 242, 386, 410, 635, 648, 692, 768, 1126, 1190, 1222, 1226, 1442, 1637, 3144, 3297, 4077], '(PAP)': [3, 195, 387], 'is': [4, 196, 406, 638, 725, 775, 1052, 1074, 1120, 1183, 1216, 1228, 1337, 2603, 3090, 3099, 3280, 4034, 4499, 4676], 'a': [5, 61, 108, 125, 197, 253, 300, 317, 407, 537, 581, 730, 771, 1033, 1053, 1059, 1078, 1124, 1142, 1188, 1220, 1224, 1231, 1403, 1504, 1519, 1641, 1657, 1706, 1727, 1795, 1937, 2171, 2330, 2340, 2350, 2420, 2551, 2943, 2975, 3011, 3094, 3286, 3329, 3334, 3462, 3554, 3583, 3609, 3684, 3710, 3796, 3823, 3869, 3899, 3915, 4035, 4215, 4298, 4422, 4548, 4622], 'ribosome-inactivating': [6, 198, 409, 576, 868, 4076], 'isolated': [8, 72, 200, 264, 1740, 1906, 1979, 2437, 2839, 3472, 4014, 4135], 'from': [9, 73, 174, 201, 265, 366, 584, 877, 978, 1230, 1401, 1550, 1558, 1741, 1779, 1907, 1954, 2438, 2586, 2596, 2622, 2638, 2831, 2840, 3119, 3190, 4015, 4113, 4136, 4401], 'the': [10, 17, 80, 101, 129, 135, 140, 149, 175, 187, 202, 209, 272, 293, 321, 327, 332, 341, 367, 379, 412, 448, 546, 585, 592, 631, 642, 647, 779, 878, 985, 1037, 1084, 1195, 1285, 1322, 1354, 1381, 1407, 1424, 1436, 1441, 1458, 1468, 1645, 1648, 1683, 1687, 1746, 1848, 1851, 1955, 1961, 2058, 2182, 2187, 2198, 2247, 2275, 2284, 2319, 2343, 2382, 2395, 2402, 2413, 2501, 2593, 2597, 2623, 2628, 2645, 2651, 2667, 2682, 2748, 2955, 3021, 3028, 3046, 3068, 3073, 3103, 3109, 3120, 3128, 3143, 3213, 3292, 3391, 3398, 3409, 3426, 3438, 3474, 3597, 3600, 3698, 3701, 3811, 3814, 3861, 3906, 4008, 4025, 4029, 4039, 4055, 4074, 4141, 4160, 4174, 4208, 4244, 4270, 4301, 4327, 4394, 4479, 4489, 4513, 4551, 4578, 4589, 4638, 4646], 'pokeweed': [11, 203, 393, 413, 4114], 'plant': [12, 21, 204, 213, 414, 452], '(Phytolacca': [13, 205], 'americana)': [14, 206], 'that': [15, 29, 66, 124, 155, 207, 221, 258, 316, 347, 866, 971, 1011, 1026, 1191, 1227, 1315, 1690, 2602, 3098, 3290, 4159, 4198, 4275, 4306, 4318, 4349, 4363, 4409, 4575], 'inhibits': [16, 208, 1029, 4207, 4326], 'proliferation': [18, 210], 'of': [19, 34, 82, 88, 97, 103, 152, 158, 178, 189, 211, 226, 274, 280, 289, 295, 344, 350, 370, 381, 411, 450, 549, 591, 634, 646, 738, 773, 781, 787, 790, 800, 827, 840, 872, 1040, 1062, 1194, 1198, 1284, 1290, 1298, 1326, 1345, 1356, 1389, 1396, 1411, 1440, 1448, 1496, 1545, 1585, 1599, 1607, 1647, 1721, 1732, 1737, 1798, 1838, 1850, 1895, 1940, 1981, 2007, 2026, 2038, 2041, 2045, 2060, 2127, 2176, 2184, 2193, 2200, 2209, 2218, 2228, 2239, 2249, 2277, 2286, 2294, 2304, 2321, 2324, 2332, 2345, 2352, 2362, 2366, 2374, 2384, 2387, 2404, 2415, 2424, 2432, 2503, 2506, 2514, 2543, 2572, 2592, 2599, 2644, 2650, 2657, 2666, 2684, 2712, 2718, 2736, 2763, 2901, 2967, 2972, 2978, 3001, 3023, 3040, 3059, 3076, 3079, 3108, 3127, 3132, 3142, 3186, 3201, 3215, 3252, 3270, 3295, 3339, 3393, 3411, 3429, 3433, 3440, 3465, 3478, 3591, 3692, 3725, 3727, 3746, 3759, 3765, 3805, 3836, 3849, 3863, 3871, 3930, 4041, 4052, 4054, 4108, 4124, 4163, 4184, 4210, 4272, 4287, 4303, 4310, 4313, 4321, 4329, 4342, 4345, 4353, 4374, 4396, 4414, 4449, 4459, 4478, 4510, 4539, 4553, 4568, 4591, 4640, 4648], 'several': [20, 212, 451], 'and': [22, 31, 69, 165, 182, 214, 223, 261, 357, 374, 453, 461, 637, 665, 699, 736, 976, 1013, 1025, 1070, 1076, 1103, 1122, 1141, 1186, 1218, 1223, 1292, 1296, 1317, 1324, 1350, 1367, 1387, 1423, 1453, 1461, 1475, 1485, 1493, 1513, 1531, 1547, 1594, 1624, 1644, 1719, 1734, 1775, 1810, 1863, 1900, 1960, 1975, 2028, 2043, 2102, 2115, 2122, 2164, 2186, 2214, 2231, 2267, 2307, 2326, 2369, 2399, 2427, 2451, 2471, 2477, 2495, 2511, 2524, 2536, 2564, 2705, 2742, 2760, 2806, 2814, 2898, 2962, 2974, 2990, 3013, 3038, 3053, 3082, 3114, 3122, 3205, 3232, 3244, 3326, 3333, 3342, 3447, 3490, 3508, 3525, 3540, 3553, 3630, 3647, 3662, 3729, 3754, 3781, 3844, 3882, 3886, 3937, 3943, 3996, 4018, 4146, 4181, 4206, 4255, 4269, 4366, 4412, 4436, 4456, 4597, 4659], 'animal': [23, 215, 454], 'viruses.': [24, 216], 'We': [25, 217], 'have': [26, 218, 864, 1009, 3193, 4195, 4603], 'shown': [27, 219, 1010, 1373, 4045], 'previously': [28, 220, 1818, 4197], 'PAP': [30, 35, 68, 93, 156, 222, 227, 260, 285, 348, 442, 550, 578, 795, 972, 1012, 1015, 1044, 1316, 1319, 1336, 1349, 1398, 1497, 1510, 1546, 1548, 1608, 1610, 1774, 1776, 1899, 1901, 1915, 1951, 1991, 2016, 2213, 2215, 2250, 2279, 2325, 2338, 2416, 2719, 2721, 3081, 3083, 3089, 3134, 3188, 3204, 3271, 3412, 3489, 3491, 3501, 3511, 3728, 3730, 3766, 3768, 3791, 3894, 3936, 3938, 3995, 3997, 4111, 4134, 4164, 4200, 4236, 4325, 4357, 4404, 4420, 4460, 4467, 4482, 4484, 4498, 4511, 4583, 4585, 4602, 4634], 'nontoxic': [32, 70, 224, 262, 1014, 1318, 1351, 3344, 4142, 4343], 'mutants': [33, 71, 225, 263, 1016, 1320, 1352, 1447, 1549, 1611, 1777, 1992, 2722, 3208, 3233, 3731, 3769, 3940, 3998, 4143, 4344, 4434, 4485, 4586], 'can': [36, 228], 'directly': [37, 229, 3595, 3696, 3809], 'depurinate': [38, 230, 1017, 3947, 4006, 4150], 'brome': [39, 231, 397, 1018], 'mosaic': [40, 232, 398, 427, 829, 1019], 'virus': [41, 233, 428, 458, 701, 739, 830, 1020, 1057], '(BMV)': [42, 234, 1021], 'RNA': [43, 119, 160, 163, 167, 180, 235, 311, 352, 355, 359, 372, 595, 874, 1056, 1073, 1139, 1148, 1200, 1365, 1378, 1581, 1600, 1634, 1870, 2083, 2426, 2435, 2497, 2519, 2545, 2583, 2619, 2661, 2895, 3007, 3024, 3480, 3534, 3656, 3775, 3876, 4186, 4391, 4398, 4416, 4451, 4471, 4496, 4542, 4570, 4627, 4651, 4662, 4674], 'in': [44, 47, 85, 117, 236, 239, 277, 309, 650, 690, 766, 802, 832, 982, 1023, 1032, 1087, 1137, 1309, 1329, 1359, 1384, 1391, 1444, 1612, 1682, 1717, 1791, 1857, 1922, 1966, 1972, 2003, 2098, 2118, 2124, 2197, 2236, 2342, 2348, 2363, 2371, 2453, 2538, 2550, 2605, 2607, 2627, 2677, 2702, 2709, 2826, 2905, 2942, 2964, 2986, 3072, 3085, 3129, 3209, 3226, 3274, 3337, 3414, 3443, 3454, 3473, 3482, 3570, 3672, 3756, 3846, 3951, 4000, 4046, 4060, 4079, 4166, 4178, 4188, 4204, 4214, 4242, 4300, 4332, 4462, 4473, 4550, 4595, 4598, 4610], 'vitro,': [45, 237], 'resulting': [46, 238], 'reduced': [48, 100, 240, 292, 1353], 'viral': [49, 179, 190, 241, 371, 382, 987, 1041, 1138, 1364, 1908, 4397, 4480], 'translation.': [51, 243, 1347], 'Here': [52, 244], 'we': [53, 122, 245, 314, 1304, 4631], 'expand': [54, 246, 1305], 'on': [55, 112, 247, 304, 1306, 1503, 2283, 2786, 2992, 4024, 4606], 'these': [56, 248, 2439, 3259, 4211, 4330], 'initial': [57, 249, 419, 544, 1308], 'studies': [58, 250, 1311], 'and,': [59, 251, 3407], 'using': [60, 252, 1726, 1835, 2052, 3015], 'barley': [62, 98, 254, 290, 1330, 1742, 1787, 1839, 2842, 3483, 3733, 4016, 4061, 4080, 4151, 4267, 4333, 4611], 'protoplast': [63, 255, 3415, 3533, 3548, 3655, 3774, 3875, 4490, 4506, 4541], 'system,': [64, 256], 'demonstrate': [65, 257], 'recombinant': [67, 259], 'E.': [74, 266, 909, 1392, 1551, 1780, 3086, 3139, 3169, 3191, 3210, 3934, 4001, 4137, 4167], 'coli': [75, 267, 1781, 3192, 3211, 4002, 4168], 'are': [76, 172, 268, 364, 870, 3343, 4289, 4664], 'able': [77, 269, 4004, 4369, 4503], 'to': [78, 95, 132, 139, 270, 287, 324, 331, 446, 640, 798, 1047, 1133, 1147, 1312, 1340, 1374, 1419, 1430, 1745, 1794, 1847, 1936, 1977, 2057, 2093, 2246, 2281, 2318, 2381, 2559, 2659, 2669, 2769, 2873, 3067, 3101, 3240, 3248, 3276, 3345, 3380, 3390, 3460, 3527, 3576, 3649, 3677, 3860, 4005, 4027, 4073, 4258, 4370, 4488, 4501, 4504, 4512, 4574, 4588, 4666], 'reduce': [79, 271, 447], 'accumulation': [81, 102, 273, 294, 1355, 3439, 3481, 4328, 4354, 4373, 4417, 4472, 4571, 4608], 'BMV': [83, 90, 105, 130, 159, 275, 282, 297, 322, 351, 1051, 1327, 1357, 1382, 1896, 1983, 2008, 2023, 2031, 2048, 2082, 2177, 2194, 2229, 2291, 2305, 2346, 2367, 2405, 2573, 2582, 2600, 2609, 2618, 2696, 2821, 2836, 3441, 3479, 3494, 3519, 3545, 3557, 3567, 3592, 3616, 3641, 3667, 3669, 3693, 3737, 3747, 3786, 3800, 3806, 3837, 3889, 3903, 4185, 4202, 4240, 4284, 4304, 4322, 4390, 4415, 4470, 4554, 4569, 4592, 4607, 4643, 4657], 'RNAs': [84, 276, 1022, 1042, 1066, 1286, 1295, 1328, 1358, 1371, 1897, 1903, 1956, 1963, 1969, 1984, 2049, 2178, 2195, 2230, 2306, 2347, 2697, 3442, 3495, 3520, 3558, 3568, 3593, 3617, 3642, 3670, 3694, 3748, 3807, 3838, 4203, 4213, 4241, 4245, 4262, 4285, 4305, 4323, 4331, 4555, 4579, 4644], 'vivo.': [86, 278], 'Pretreatment': [87, 279, 4192], 'only': [89, 281, 4049], 'RNA3': [91, 283, 1215, 2009, 2601], 'with': [92, 107, 284, 299, 794, 837, 984, 1058, 1131, 1145, 1457, 1518, 1533, 1543, 1590, 1604, 1696, 1786, 1898, 1912, 1990, 1999, 2014, 2030, 2047, 2206, 2212, 2225, 2301, 2359, 2492, 2526, 2532, 2566, 2695, 2733, 2801, 2960, 3010, 3234, 3246, 3285, 3384, 3488, 3500, 3622, 3732, 3736, 3743, 3752, 3833, 3842, 4012, 4065, 4110, 4132, 4193, 4248, 4308, 4324, 4339, 4355, 4421, 4559, 4582, 4601], 'prior': [94, 286, 2204, 2245, 2317, 2380, 3486, 3575, 3676, 3859, 4319, 4476, 4587], 'transfection': [96, 288, 4590], 'protoplasts': [99, 291, 834, 1980, 2046, 2097, 2222, 2282, 2298, 2356, 2411, 2678, 3444, 3484, 3524, 3579, 3646, 3680, 3734, 3740, 3830], 'all': [104, 296, 575, 1193, 1462, 2608, 3469], 'RNAs,': [106, 298, 2292, 4481], 'more': [109, 301], 'severe': [110, 302, 4351], 'effect': [111, 303, 2276], 'subgenomic': [113, 166, 305, 358, 1232, 1299], 'RNA4': [114, 306, 1233], 'levels.': [115, 307, 4121, 4155], 'Using': [116, 308], 'vitro': [118, 310, 983, 1024, 1310, 2004, 2364, 3130, 4205, 4596], 'synthesis': [120, 312, 636, 1379, 2285, 2676, 3025, 3060, 3214, 3225, 4675], 'assays,': [121, 313, 3416], 'show': [123, 315, 1313], 'depurinated': [126, 318, 1370], 'template': [127, 136, 319, 328, 1582, 2894, 3070], 'causes': [128, 320], 'replicase': [131, 323, 1383, 2827, 2837, 2902, 3030], 'stall': [133, 325], 'at': [134, 326, 1083, 1421, 1432, 1473, 1628, 1804, 1946, 2112, 2161, 2264, 2394, 2444, 2480, 2726, 2747, 2756, 2776, 2949, 3045, 3242, 3408], 'nucleotide': [137, 329], 'adjacent': [138, 330], 'missing': [141, 333, 4030], 'base.': [142, 334], 'These': [143, 169, 335, 361, 4156, 4315, 4406], 'results': [144, 336, 863, 4316, 4407], 'provide': [145, 337], 'new': [146, 184, 338, 376], 'insight': [147, 339], 'into': [148, 340, 1467, 1487, 2687, 3004, 3523, 3578, 3645, 3679, 4266], 'mechanism': [151, 343], 'PAP,': [153, 345, 392, 1449, 3623, 4250, 4346, 4560], 'namely': [154, 346, 1450], 'depurination': [157, 349, 629, 735, 1028, 1039, 1342, 1811, 4053, 4069, 4117, 4125, 4171, 4411], 'impedes': [161, 353], 'both': [162, 354, 974, 1363, 4364, 4418], 'replication': [164, 356, 1289, 1323, 1366, 4273, 4288, 4639, 4663], 'transcription.': [168, 360, 1368], 'novel': [170, 362], 'activities': [171, 363, 3420], 'distinct': [173, 365], 'PAP-induced': [176, 368], 'reduction': [177, 369, 786], 'translation': [181, 373, 693, 801, 841, 1031, 4209, 4658], 'represent': [183, 375], 'targets': [185, 377], 'for': [186, 378, 644, 1631, 1801, 1860, 1869, 1943, 1997, 2021, 2109, 2158, 2242, 2259, 2311, 2329, 2377, 2401, 2448, 2484, 2580, 2615, 2699, 2723, 2779, 2952, 3063, 3529, 3542, 3565, 3586, 3604, 3612, 3651, 3664, 3687, 3705, 3713, 3770, 3783, 3799, 3818, 3826, 3852, 3868, 3884, 3902, 3910, 3918, 4037, 4129, 4379, 4442, 4556, 4617, 4625], 'inhibition': [188, 380, 737, 799, 826, 839, 1333, 4352, 4413], 'infection.': [191, 383], '1The': [388], 'abbreviations': [389], 'used': [390, 1639, 1655, 1976, 2418, 2825, 3413, 3561, 3581, 3682, 3794, 3897], 'are:': [391], 'protein;': [395], 'BMV,': [396, 4038, 4375], 'virus;': [399], 'PEG,': [400, 2185], 'polyethylene': [401], 'glycol;': [402], 'MES,': [403, 2465], '4-morpholineethanesulfonic': [404], 'acid.': [405], '29-kDa': [408], 'Phytolacca': [415], 'americana.': [416], 'Since': [417], 'its': [418, 543, 1048, 3206], 'description': [420], 'as': [421, 536, 553, 770, 778, 1640, 1656, 1686, 1817, 1865, 1995, 2019, 2088, 2233, 2309, 2419, 2844, 3035, 3055, 3093, 3562, 3582, 3608, 3683, 3709, 3795, 3822, 3898, 3914, 4173, 4431, 4446, 4621], 'an': [422, 554, 1128, 1553, 1866, 2260, 2589, 2641, 3263, 3281, 4347, 4447, 4544], 'agent': [424], 'against': [425], 'tobacco': [426, 828, 833, 3952, 4180], '(1Duggar': [429], 'B.M.': [430, 913], 'Armstrong': [431], 'J.K.': [432], 'Ann.': [433, 811], 'Mo.': [434], 'Bot.': [435], 'Gard.': [436], '1925;': [437], '12:': [438], '359-366Crossref': [439], 'Google': [440, 482, 511, 530, 572, 610, 626, 663, 685, 721, 761, 822, 859, 906, 930, 945, 968, 1007, 1101, 1117, 1163, 1180, 1213, 1247, 1268, 1281, 1576, 1674, 1772, 1833, 1892, 2078, 2865, 2891, 3166, 3181, 3323, 3373, 3970, 3989, 4104, 4231, 4534], 'Scholar),': [441], 'has': [443, 1192, 3112, 3135, 4428], 'been': [444, 3136, 3196], 'demonstrated': [445, 4196], 'propagation': [449, 702], 'viruses,': [455], 'including': [456], 'potato': [457], 'X,': [459], 'HIV,': [460], 'influenza': [462], '(2Tumer': [463, 1753], 'N.E.': [464, 667, 935, 999, 1754, 1825, 1877, 3309, 3359, 3960, 3979, 4223], 'Hwang': [465, 1755, 3300, 3350], 'D.J.': [466, 1756, 3301, 3351], 'Bonness': [467, 1757], 'M.': [468, 653, 752, 1758, 4680], 'Proc.': [469, 709, 1255, 1759, 3310, 3360], 'Natl.': [470, 710, 1256, 1760, 3311, 3361], 'Acad.': [471, 711, 814, 1257, 1761, 3312, 3362], 'Sci.': [472, 712, 815, 1258, 1762, 3313, 3363], 'U.': [473, 713, 1259, 1763, 3314, 3364], 'S.': [474, 615, 714, 742, 1260, 1764, 2853, 2878, 2880, 3315, 3365, 4089], 'A.': [475, 715, 744, 881, 889, 1261, 1765, 3316, 3366], '1997;': [476, 853, 1766, 4528], '94:': [477, 1767], '3866-3871Crossref': [478, 1768], 'PubMed': [479, 508, 527, 569, 609, 758, 819, 856, 903, 927, 942, 965, 1004, 1098, 1114, 1160, 1177, 1210, 1244, 1265, 1278, 1573, 1671, 1769, 1830, 1889, 2077, 2862, 3163, 3178, 3320, 3370, 3967, 3986, 4101, 4228, 4531, 4688], 'Scopus': [480, 509, 528, 570, 719, 759, 820, 857, 904, 928, 943, 966, 1005, 1099, 1115, 1161, 1178, 1211, 1245, 1266, 1279, 1574, 1672, 1770, 1831, 1890, 2863, 3164, 3179, 3321, 3371, 3968, 3987, 4102, 4229, 4532], '(130)': [481, 1771], 'Scholar,': [483, 512, 611, 907, 931, 1164, 1248, 1269, 3167, 3971], '3Zarling': [484], 'J.M.': [485, 561, 750, 911], 'Moran': [486], 'P.A.': [487], 'Haffar': [488], 'O.': [489, 677, 3303, 3353, 3956], 'Sias': [490], 'J.': [491, 521, 600, 754, 892, 916, 1172, 1568, 1666, 1878, 2072, 2851, 3977, 4095, 4097, 4683], 'Richman': [492], 'D.D.': [493], 'Spina': [494], 'C.A.': [495], 'Myers': [496], 'D.E.': [497], 'Kuebelbeck': [498], 'V.': [499, 4087], 'Ledbetter': [500], 'J.A.': [501, 514, 1169], 'Uckun': [502, 956, 3155, 3306, 3356], 'F.M.': [503, 957, 3156, 3307, 3357], 'Nature.': [504, 1240], '1990;': [505, 1262], '347:': [506], '92-95Crossref': [507], '(195)': [510], '4Tomlinson': [513], 'Walker': [515], 'V.M.': [516], 'Flewtett': [517], 'T.H.': [518], 'Barclay': [519], 'G.R.': [520], 'Gen.': [522], 'Virol.': [523, 1173, 1569, 1667, 2073, 4684], '1974;': [524], '22:': [525], '225-232Crossref': [526], '(88)': [529], 'Scholar).': [531, 573, 627, 686, 722, 762, 823, 860, 946, 1118, 1181, 1214, 1282, 1577, 1675, 1773, 1893, 2079, 2866, 2892, 3182, 3324, 3374, 3990, 4105, 4232, 4535], 'It': [532], 'therefore': [533, 1287], 'holds': [534], 'promise': [535], 'broad-spectrum': [538], 'agent.': [540], 'Years': [541], 'after': [542, 4495, 4543, 4645, 4655], 'discovery,': [545], 'enzymatic': [547], 'activity': [548, 3131, 3294], 'was': [551, 796, 1399, 1417, 1428, 1556, 1588, 1602, 1638, 1654, 1680, 1694, 1715, 1724, 1808, 1812, 1855, 1952, 2012, 2050, 2190, 2357, 2436, 2490, 2498, 2520, 2584, 2620, 2636, 2662, 2679, 2767, 2774, 2791, 2816, 2838, 3008, 3033, 3451, 3458, 3512, 3535, 3657, 3776, 3877, 4022, 4277, 4337, 4399, 4515, 4572], 'characterized': [552], 'N-glycosylase': [555], '(5Endo': [556], 'Y.': [557, 597, 813, 3299, 3349], 'Tsurugi': [558, 598], 'K.': [559, 599, 669, 843, 1107, 1153, 1563, 1661, 3171, 4093, 4518], 'Lambert': [560], 'Biochem.': [562, 852, 958, 3174, 4527], 'Biophys.': [563, 959], 'Res.': [564, 622, 938, 960, 1206], 'Commun.': [565, 961], '1988;': [566, 623, 1207], '150:': [567], '1032-1036Crossref': [568], '(177)': [571], 'Like': [574], 'proteins,': [577], 'efficiently': [579, 4371], 'removes': [580, 973], 'conserved': [582, 1079, 2604, 2646], 'adenine': [583], 'sarcin/ricin': [586, 2647, 4056], 'loop': [587, 2648, 4057], 'within': [588], 'domain': [589, 1130, 1144], 'VI': [590], 'large': [593], 'ribosomal': [594], '(6Endo': [596], 'Biol.': [601, 893, 917, 1879, 3963], 'Chem.': [602, 894, 918, 1880], '1987;': [603], '262:': [604], '8128-8130Abstract': [605], 'Full': [606, 898, 900, 922, 924, 1884, 1886], 'Text': [607, 899, 901, 923, 925, 1885, 1887], 'PDF': [608, 902, 926, 1888], '7Stirpe': [612], 'F.': [613, 891, 951, 1151, 3146], 'Bailey': [614], 'Miller': [616], 'S.P.': [617], 'Bodley': [618], 'J.W.': [619], 'Nucleic': [620, 936, 1204], 'Acids': [621, 937, 1205], '16:': [624, 1208, 3161], '405-412Crossref': [625], 'This': [628, 723, 4067, 4335], 'slows': [630], 'elongation': [632], 'step': [633], 'considered': [639], 'be': [641, 4071, 4502, 4667], 'reason': [643], 'cytotoxicity': [645], '(reviewed': [649, 1086], 'Refs.': [651, 1088], '8Wang': [652], 'Hudak': [654, 668, 991, 3957], 'K.A.': [655, 995, 1821, 3958, 3973, 4219], 'Genet.': [656, 1093], 'Eng.': [657], '(N.': [658], 'Y.).': [659], '2003;': [660], '25:': [661], '143-161PubMed': [662], 'Scholar': [664, 1102], '9Tumer': [666], 'Di': [670], 'R.': [671, 1250, 2884], 'Coetzer': [672, 1874, 3304, 3354], 'C.': [673, 885, 1252, 1875, 3305, 3355], 'Wang': [674, 996, 1822, 4220], 'P.': [675, 933, 997, 1090, 1171, 1203, 1254, 1823, 2065, 2069, 2071, 4221], 'Zoubenko': [676, 3302, 3352], 'Curr.': [678, 1091], 'Top.': [679], 'Microbiol.': [680], 'Immunol.': [681], '1999;': [682, 939, 962, 1157, 3160, 3175], '240:': [683], '139-158PubMed': [684], 'The': [687, 763, 1332, 1413, 1446, 1490, 1676, 1713, 1968, 2487, 2517, 2578, 2613, 2631, 2772, 2999, 3057, 3229, 3375, 3517, 3639, 4382, 4566], 'accompanying': [688, 764], 'decline': [689, 765, 1344, 2341, 4299, 4549], 'cellular': [691, 767, 1346], 'may': [694, 1045, 4070], 'cause': [695, 780], 'local': [696], 'cell': [697], 'death': [698], 'limit': [700], '(10Ready': [703], 'M.P.': [704], 'Brown': [705], 'D.T.': [706], 'Robertus': [707], 'J.D.': [708, 808, 955, 3981], '1986;': [716], '84:': [717], '5053-5056Crossref': [718], '(118)': [720], 'model': [724, 1054], 'supported': [726], 'by': [727, 1043, 1335, 1361, 1380, 1482, 1500, 1515, 1528, 1705, 1749, 1814, 1957, 2035, 2407, 2500, 2522, 2664, 2681, 2754, 2783, 2818, 2846, 3138, 3485, 3514, 3537, 3636, 3659, 3778, 3879, 3933, 4191, 4252, 4279, 4292, 4433], 'observations': [728], 'showing': [729], 'positive': [731, 1064, 1293, 1658, 1677, 2188, 2287, 2610, 3543, 3584, 3665, 3685, 3784, 3797, 3885, 3900, 4641, 4672], 'correlation': [732], 'between': [733], 'ribosome': [734, 1341], 'infection': [740, 789], '(11Taylor': [741], 'Massiah': [743], 'Lomonossoff': [745], 'G.': [746, 849, 2855, 2882, 4524], 'Roberts': [747], 'L.M.': [748], 'Lord': [749], 'Hartley': [751], 'Plant': [753, 1109, 3961, 4096], '1994;': [755, 4098], '5:': [756], '827-835Crossref': [757], '(106)': [760], 'translation,': [769], 'result': [772], 'depurination,': [774], 'often': [776], 'cited': [777], 'activity.': [783, 1050], 'For': [784], 'example,': [785], 'poliovirus': [788], 'HeLa': [791], 'cells': [792, 804], 'incubated': [793, 981, 1603, 1635, 1681, 1785, 1911, 2013, 2108, 2157, 2232, 2258, 2370, 2708, 2775, 3499, 3569, 3621, 3671, 3755, 3789, 3845, 3867, 3892, 4011, 4131, 4247, 4581], 'attributed': [797], 'virus-infected': [803], '(12Ussery': [805], 'M.A.': [806], 'Irvin': [807, 954], 'Hardesty': [809], 'B.': [810, 4082], 'N.': [812, 847, 4522], '1977;': [816], '284:': [817], '431-440Crossref': [818], '(68)': [821], 'In': [824, 989, 1301, 2672, 4139], 'addition,': [825, 990], 'multiplication': [831], 'correlated': [835, 4307], 'well': [836, 4668], 'PAP-mediated': [838], '(13Watanabe': [842, 4517], 'Kawasaki': [844, 4519], 'T.': [845, 1166, 4520], 'Sako': [846, 4521], 'Funatsu': [848, 4523], 'Biosci.': [850, 3172, 4525], 'Biotech.': [851, 4526], '61:': [854, 4529], '994-997Crossref': [855, 4530], '(19)': [858, 4533], 'More': [861], 'recent': [862], 'revealed': [865, 4432], 'many': [867], 'proteins': [869, 1525, 3251, 3260, 3377, 3404, 3470, 4009, 4176], 'capable': [871], 'depurinating': [873], 'substrates': [875], 'apart': [876], 'rRNA': [879, 1807, 2634, 3607, 3708, 3821, 3913, 4026, 4116, 4380, 4410, 4445, 4620], '(14Bolognesi': [880], 'Polito': [882], 'L.': [883, 887, 1565, 1663], 'Lubelli': [884], 'Barbieri': [886], 'Parente': [888], 'Stirpe': [890], '2002;': [895, 1881], '277:': [896, 1882], '13709-13716Abstract': [897], '(56)': [905, 3322, 3372, 3969], '15Nicolas': [908], 'Beggs': [910], 'Haltiwanger': [912], 'Taraschi': [914], 'T.F.': [915], '1998;': [919, 2888], '273:': [920], '17216-17220Abstract': [921], '(57)': [929], '16Wang': [932], 'Tumer': [934, 998, 1750, 1824, 1876, 3308, 3358, 3959, 3978, 4222], '27:': [940], '1900-1905Crossref': [941], '(59)': [944], 'Rajamohan': [947], 'et': [948, 992, 1560, 1751, 2062, 2848, 2875], 'al.': [949, 993, 1561, 1752, 2063, 2849, 2876], '(17Rajamohan': [950], 'Venkatachalam': [952], 'T.K.': [953], '260:': [963], '453-458Crossref': [964], '(84)': [967], 'Scholar)': [969, 1008, 1834], 'showed': [970, 3425], 'adenines': [975], 'guanines': [977], 'HIV-1': [979], 'when': [980, 3949, 4577], 'genomic': [986], 'RNA.': [988, 1000, 1300, 1826, 2887, 3614, 3828, 4224], '(18Hudak': [994, 1820, 4218], '2000;': [1001, 1111, 1174, 1827, 3964, 4225], '6:': [1002, 1828, 4099, 4226], '369-380Crossref': [1003, 1829, 4227], '(92)': [1006, 1832, 4230], 'this': [1027, 1302, 3296, 3455, 4042, 4293], 'their': [1030, 3216, 3224, 3381], 'cell-free': [1034, 4216], 'system.': [1035], 'Therefore,': [1036], 'direct': [1038], 'contribute': [1046], 'positive-strand': [1055, 2581], 'genome': [1060], 'composed': [1061], 'three': [1063], 'sense': [1065], 'designated': [1067], 'RNA1,': [1068], 'RNA2,': [1069], 'RNA3.': [1071], 'Each': [1072], '5′-capped': [1075], 'contains': [1077], '200-nucleotide': [1080], 'tRNA-like': [1081, 2594], 'structure': [1082, 2595], '3′-end': [1085, 2598], '19Ahlquist': [1089], 'Opin.': [1092], 'Dev.': [1094], '1992;': [1095], '2:': [1096], '71-76Crossref': [1097], '(139)': [1100], '20Kao': [1104], 'C.C.': [1105, 1155, 1567, 1665, 2857, 2886, 4682], 'Sivakumaran': [1106, 1152], 'Mol.': [1108, 3962], 'Pathol.': [1110], '1:': [1112], '91-97Crossref': [1113], '(83)': [1116], 'RNA1': [1119, 2368, 2406], 'monocistronic': [1121, 1185], 'encodes': [1123, 1187, 1219], '1a': [1125], 'containing': [1127, 1509, 2588, 2640, 2715, 3762], 'N-terminal': [1129, 3264], 'similarity': [1132, 1146], 'm7G': [1134], 'methyltransferases': [1135], 'involved': [1136], 'capping': [1140], 'C-terminal': [1143, 3395], 'helicases': [1149], '(21Kong': [1150], 'Kao': [1154, 1566, 1664, 2856, 2885, 4681], 'Virology.': [1156, 1274, 2858, 3982], '259:': [1158], '200-210Crossref': [1159], '(64)': [1162], '22Ahola': [1165], 'den': [1167], 'Boon': [1168], 'Ahlquist': [1170, 1253, 2070], '74:': [1175], '8803-8811Crossref': [1176], '(87)': [1179], 'RNA2': [1182], 'also': [1184, 1988, 3261, 4127, 4440, 4615], '2a': [1189], 'motifs': [1196], 'expected': [1197, 3382, 3459], 'RNA-dependent': [1199], 'polymerases': [1201], '(23Argos': [1202], '9909-9916Crossref': [1209], '(298)': [1212], 'dicistronic': [1217], 'movement': [1221], 'coat': [1225], 'translated': [1229], '(24Miller': [1234], 'W.A.': [1235], 'Dreher': [1236], 'T.W.': [1237], 'Hall': [1238], 'T.C.': [1239], '1985;': [1241], '313:': [1242], '68-72Crossref': [1243], '(218)': [1246], '25Allison': [1249], 'Thompson': [1251], '87:': [1263], '1820-1824Crossref': [1264], '(154)': [1267], '26Schmitz': [1270], 'I.': [1271, 3154], 'Rao': [1272], 'A.L.N.': [1273], '1996;': [1275, 2859], '226:': [1276, 2860], '281-293Crossref': [1277], '(79)': [1280, 2864], 'Synthesis': [1283, 3078], 'involves': [1288], 'negative': [1291, 1642, 2172, 2289, 2421, 2568, 2616, 3563, 3887, 4649, 4660], 'strand': [1294, 2290, 2569, 2611, 2617, 3544, 3666, 3785, 3888, 4642, 4650, 4661, 4673], 'transcription': [1297, 1325], 'report,': [1303], 'our': [1307], 'evidence': [1314], 'inhibit': [1321, 4372, 4389], 'protoplasts.': [1331, 4334, 4612], 'caused': [1334, 2339, 4350], 'not': [1338, 3194, 3436, 3452, 3946, 4063, 4149, 4290, 4388, 4677], 'due': [1339, 3389, 4072], 'or': [1343, 1609, 1919, 2251, 2314, 2574, 2720, 3198, 3505, 3626, 3767, 3856, 3953, 4483, 4562, 4584], 'Rather,': [1348], 'protoplasts,': [1360, 2349, 2433, 4268], 'inhibiting': [1362], 'Furthermore,': [1369], 'were': [1372, 1455, 1465, 1480, 1498, 1511, 1526, 1703, 1739, 1784, 1910, 1964, 1970, 1987, 2033, 2091, 2107, 2156, 2179, 2223, 2257, 2299, 2392, 2417, 2442, 2475, 2548, 2707, 2730, 2745, 2752, 2812, 2829, 2869, 2903, 2958, 2984, 3043, 3051, 3061, 3238, 3272, 3471, 3498, 3521, 3560, 3580, 3620, 3634, 3643, 3681, 3741, 3793, 3831, 3866, 3896, 4003, 4010, 4058, 4126, 4246, 4263, 4368, 4439, 4486, 4580, 4614], 'prevent': [1375], 'efficient': [1376], 'elongative': [1377], 'vitro.': [1385], 'Cloning': [1386], 'Expression': [1388, 3158, 3200], 'PAPs': [1390, 1688, 2253, 3633], 'coli—The': [1393], 'mature': [1394, 3104, 3187, 3250, 3994, 4133, 4161], 'form': [1395, 1410, 1439, 3107], 'wild-type': [1397, 1492, 1914, 2000, 2015, 3133, 3230, 3277, 4199, 4249, 4356], 'amplified': [1400, 1456], 'pNT188,': [1402], 'yeast': [1404, 2652, 3346, 3954], 'vector': [1405, 1470], 'expressing': [1406], 'complete': [1408], 'unprocessed': [1409], 'PAP.': [1412, 2001, 2207, 2388, 3278, 3864, 4066, 4260, 4314], '5′': [1414], 'primer': [1415, 1426, 1815, 1861, 4019], '(CATGGATCCGTGAATACAATC)': [1416], 'designed': [1418, 1429, 3239], 'begin': [1420, 3241], 'Val23,': [1422], '3′': [1425], '(CCAAGCTTGTTAAGTTGTCTGACAGCTCCC)': [1427], 'stop': [1431], 'Thr284,': [1433], 'thereby': [1434], 'amplifying': [1435], 'mature,': [1437], 'processed': [1438, 3100, 3218], 'present': [1443, 4078], 'eukaryotes.': [1445], 'PAPx,': [1451, 3423, 3624, 3941, 4144], 'PAPn,': [1452, 3625, 3942, 4145, 4561], 'PAPc,': [1454], 'same': [1459, 1684, 2624, 3029, 3074, 3475, 3601, 3702, 3815, 3907], 'primers,': [1460], 'PCR': [1463], 'products': [1464, 2957, 3050], 'cloned': [1466], 'expression': [1469], 'pET30a': [1471], '(Novagen)': [1472], 'NdeI': [1474], 'HindIII': [1476], 'sites.': [1477], 'All': [1478], 'constructs': [1479, 3231], 'confirmed': [1481], 'DNA': [1483], 'sequencing': [1484], 'transformed': [1486], 'BL21': [1488], 'cells.': [1489, 2440, 3228], 'overexpressed': [1491], 'mutant': [1494, 2252, 3184, 3268, 3284, 4385], 'forms': [1495, 3141, 3185, 3269, 4162], 'purified': [1499, 1778, 1913, 3376, 3399, 4112], 'affinity': [1501], 'chromatography': [1502], 'Ni2+-nitrilotriacetic': [1505], 'acid': [1506, 2510, 2766, 2805, 3236], 'column.': [1507], 'Fractions': [1508], 'pooled': [1512], 'concentrated': [1514], 'filtration': [1516], 'centrifugation': [1517, 2523, 2755], '10-kDa': [1520], 'cut-off': [1521], 'filter': [1522], '(Amicon).': [1523], 'Purified': [1524], 'separated': [1527, 1704, 2549, 2991], '12%': [1529, 2993], 'SDS-PAGE': [1530], 'stained': [1532], 'Coomassie': [1534], 'Blue.': [1535], 'RNase': [1536], 'Activity': [1537, 4461], 'Assay—To': [1538], 'determine': [1539, 3992, 4234, 4465], 'whether': [1540, 2337, 3993, 4235, 4466, 4633], 'ribonucleases': [1541], 'co-purified': [1542], 'preparations': [1544], 'coli,': [1552], 'endoribonuclease': [1554, 1646, 1679], 'assay': [1555], 'adapted': [1557], 'Bhardwaj': [1559], '(27Bhardwaj': [1562, 1660], 'Guarino': [1564, 1662], '2004;': [1570, 1668, 4685], '78:': [1571, 1669, 4686], '12218-12224Crossref': [1572, 1670], '(148)': [1575, 1673], 'A': [1578, 1841, 3547], 'chemically': [1579], 'synthesized': [1580, 3006, 3092], '(Dharmacon,': [1583], 'Inc.)': [1584], '10': [1586, 1928, 1933, 2485, 2734, 2784, 2970], 'nucleotides': [1587], '5′-end-labeled': [1589], 'T4': [1591], 'polynucleotide': [1592], 'kinase': [1593], '[α-32P]ATP.': [1595], 'Approximately': [1596], '100': [1597, 1613, 1799, 1920, 1941, 2761, 3506], 'ng': [1598, 1606, 1837, 3590, 3691, 3804, 4341], 'substrate': [1601], '50': [1605, 1616, 2460, 4340], 'mm': [1614, 1617, 1622, 1626, 1692, 1698, 1926, 1929, 1934, 2131, 2134, 2137, 2140, 2461, 2464, 2469, 2909, 2915, 2918, 2921], 'KCl,': [1615, 1927], 'Tris-HCl,': [1618, 1930], 'pH': [1619, 1931, 2466, 2912], '7.5,': [1620], '4': [1621, 1691, 2094, 2219, 2295, 2917], 'MgCl2,': [1623, 2919], '1': [1625, 2125, 2133, 2136, 2142, 2237, 2507, 2710, 2724, 3757, 3763, 3847], 'dithiothreitol': [1627], '30': [1629, 1632, 1802, 1805, 1944, 1947, 2243, 2312, 2378, 2700, 2950, 3854, 4493], '°C': [1630, 2163, 2266, 2778, 2951], 'min.': [1633, 2486], 'without': [1636, 2181, 2203, 2412, 3550, 3556, 3790, 3893, 4403, 4475], 'control,': [1643, 2173], 'SARS': [1649], 'coronavirus,': [1650], 'Nsp15': [1651], '(50': [1652, 1782, 1789, 1993, 2017, 3628], 'ng),': [1653, 3507, 3629], 'control': [1659, 1678, 1868, 2189, 3069, 3585, 3611, 3686, 3712, 3798, 3825, 3901, 3917, 4624], 'buffer': [1685, 1793, 1924, 2455, 2907, 2989, 3571, 3673], 'except': [1689], 'MgCl2': [1693], 'replaced': [1695], '5': [1697], 'MnCl2.': [1699], 'Following': [1700, 1949, 2947], 'incubation,': [1701, 1950, 3510, 3632], 'samples': [1702, 2084, 3602, 3703, 3816, 3908, 4402], '7.5': [1707], 'm': [1708, 2100, 2120, 2457, 2508, 2528, 2555, 2980, 2996], 'urea,': [1709], '18%': [1710], 'acrylamide': [1711], 'gel.': [1712, 3598, 3699, 3812], 'gel': [1714], 'wrapped': [1716], 'plastic': [1718], 'quantification': [1720], 'radiolabeled': [1722, 2567, 2685], 'bands': [1723], 'performed': [1725, 2870, 4023], 'PhosphorImager': [1728, 3012], '(Amersham': [1729, 2562], 'Biosciences).': [1730], 'Isolation': [1731, 2423], 'Ribosomes': [1733, 3932], 'Primer': [1735], 'Extension': [1736], 'rRNA—Ribosomes': [1738], 'leaves': [1743, 2040, 2843], 'according': [1744, 2056, 2872, 3379], 'method': [1747, 2059], 'described': [1748, 1819, 1996, 2020, 2089, 2234, 2845, 3036], 'ng)': [1783, 1921, 1994, 2018], 'ribosomes': [1788, 3948, 4013, 4062, 4109, 4130, 4152], 'μg)': [1790, 1905, 1986, 2011, 3497, 3619], 'RIP': [1792, 1923], 'final': [1796, 1938, 2945, 2976], 'volume': [1797, 1939], 'μl': [1800, 1942, 2762, 2900, 3042], 'min': [1803, 1945, 2111, 2244, 2313, 2379, 2450, 2701, 2781, 2785, 3855, 4494], '°C.': [1806, 1948, 2728], 'extracted,': [1809], 'assessed': [1813], 'extension': [1816, 1862, 4020], '500': [1836, 2923], 'rRNA.': [1840, 2577, 2655], 'second': [1842], 'primer,': [1843], 'which': [1844, 3111, 3220, 3424], 'anneals': [1845], 'close': [1846], '5′-end': [1849], '28': [1852, 2632, 3605, 3706, 3819, 3911, 4443, 4618], 'S': [1853, 2576, 2633, 2654, 3606, 3707, 3820, 3912, 4444, 4619], 'rRNA,': [1854], 'included': [1856, 3262, 3453], 'each': [1858, 2770, 4427], 'sample': [1859, 2547, 3549, 3555], 'served': [1864], 'internal': [1867], 'loading': [1871, 2988, 3610, 3711, 3824, 3916, 4452, 4623], '(28Parikh': [1872], 'B.A.': [1873], '41428-41437Abstract': [1883], '(46)': [1891], 'Treatment': [1894], 'Mutants—BMV': [1902], '(1': [1904, 1985, 2010, 2085, 2390], 'particles': [1909], '(5,': [1916, 3502], '10,': [1917, 3503], '50,': [1918, 3504], '(60': [1925], '7.4,': [1932], 'MgCl2)': [1935], 'removed': [1953, 2393, 2746, 3044, 3513, 3635], 'phenol/chloroform': [1958, 2961, 3515, 3637, 4253], 'extraction,': [1959], 'treated': [1962, 1989, 3518, 3640, 3750, 3840, 4064, 4558], 'precipitated': [1965, 2499, 2518, 2963, 3052], 'ethanol.': [1967, 2516, 2810], 'resuspended': [1971, 2123, 2452, 2537, 2985], 'diethyl-pyrocarbonate-treated': [1973, 2539], 'water': [1974], 'transfect': [1978], 'barley.': [1982], 'incubation': [1998, 2128, 2240, 2328, 2375, 2431, 2703, 2713, 2948, 3487, 3726, 3760, 3850, 4107, 4320, 4491, 4546], 'An': [2002], 'generated': [2005, 2034], 'transcript': [2006, 2365], 'total': [2022, 2331, 2434, 2496, 2544, 2660, 3613, 3714, 3827, 3870, 3919, 4450, 4540, 4626], 'RNAs.': [2024, 2612, 3546, 3668, 3738, 3787, 3890, 4593], 'Generation': [2025], 'Protoplasts': [2027, 2106, 2155, 2211, 2256, 2441, 2689, 2729, 2751, 3788, 3865, 3891, 4190], 'Inoculation': [2029], 'RNAs—Protoplasts': [2032], 'enzyme': [2036], 'digestion': [2037], '7-day-old': [2039], 'barley,': [2042], 'inoculation': [2044, 3577, 3678], 'done': [2051], 'PEG': [2053, 2104, 2201, 3551], '1500': [2054], 'essentially': [2055, 2871], 'Kroner': [2061], '(29Kroner': [2064], 'Richards': [2066], 'D.': [2067, 4091], 'Traynor': [2068], '1989;': [2074], '63:': [2075, 3176], '5302-5309Crossref': [2076], 'Briefly,': [2080, 2893], 'PAP-treated': [2081, 4212], 'μg': [2086, 2175, 2192, 2227, 2303, 2323, 2361, 2386, 2717, 2971, 3745, 3764, 3835], 'prepared': [2087, 3197], 'above)': [2090], 'added': [2092, 2768, 4487], '×': [2095, 2220, 2296, 2354, 2446, 2482, 2691, 2758], '105': [2096, 2221, 2297, 2692], '0.55': [2099, 2119], 'mannitol': [2101, 2121], '8%': [2103], '1500.': [2105], '20': [2110, 2463, 2468, 2780, 3041], 'room': [2113], 'temperature': [2114], 'then': [2116, 2478, 2706, 2731, 2807, 4264], 'washed': [2117, 2525, 2530, 2800], 'ml': [2126, 2238, 2373, 2711, 3758, 3848], 'medium': [2129, 2241, 2376, 2704, 2714, 3761, 3851, 4492], '(10': [2130], 'CaCl2,': [2132], 'KNO3,': [2135], 'MgSO4,': [2138], '0.2': [2139, 2504], 'KH2PO4,': [2141], 'μm': [2143, 2146, 2924, 2927, 2930], 'KI,': [2144], '0.1': [2145], 'CuSO4,': [2147], '10%': [2148], 'mannitol,': [2149], '2%': [2150], 'sucrose,': [2151], '0.01%': [2152], 'gentamycin': [2153], 'sulfate).': [2154], '18': [2159, 2262, 2333, 3530, 3652, 3771, 3872], 'h': [2160, 2263, 2316, 2725, 3858], '27': [2162, 2265], 'constant': [2165, 2268], 'low': [2166, 2269], 'light': [2167, 2270], '(165': [2168, 2271], 'μmol/m2/s).': [2169, 2272], 'As': [2170, 4044], '0.5': [2174, 2191, 2226, 2302, 3744, 3834], 'inoculated': [2180, 2196, 2224, 3522, 3644, 3735, 3742, 3832, 4265], 'addition': [2183, 2248, 2280, 2320, 2383, 2414, 2502, 3275, 3862], 'presence': [2199, 2403], 'but': [2202, 2626, 4671], 'treatment': [2205, 4237, 4309, 4477], 'Incubation': [2208], 'Inoculated': [2210, 2410], 'Mutants—': [2216], 'Aliquots': [2217, 2389], 'above': [2235, 4153], '(1.0': [2254, 3496, 3618], 'μg).': [2255], 'additional': [2261], 'To': [2273, 2335, 3019, 3256, 3991, 4233], 'compare': [2274], 'delayed': [2278], 'versus': [2288], 'aliquots': [2293, 2744, 3039], 'transfected': [2300, 2358, 2694], 'incubated,': [2308], 'described,': [2310], '3': [2315, 2449, 2527, 3857], '1.0': [2322, 2716], 'subsequent': [2327], 'h.': [2334, 3531, 3653, 3772, 3873], 'test': [2336], 'stability': [2344], 'pool': [2351], '2.4': [2353], '106': [2355], '6.0': [2360, 2385], '6': [2372, 2965], 'ml)': [2391], 'indicated': [2396, 3047], 'time': [2397], 'points': [2398], 'analyzed': [2400, 3054, 3071, 3536, 3658, 3777, 3878], 'Northern': [2408, 2428, 3538, 3660, 3779, 3880, 4280, 4536], 'blot.': [2409], 'control.': [2422], 'Protoplast': [2425], 'Blot': [2429], 'Analysis—Following': [2430], 'pelleted': [2443, 2521, 2753], '300': [2445, 3589, 3690, 3803], 'g': [2447, 2483], 'guanidinium': [2454, 2458], '(4': [2456], 'isothiocyanate,': [2459], 'β-mercaptoethanol,': [2462], '7.0,': [2467], 'EDTA),': [2470], 'phenol/chloroform/isoamyl': [2472, 2493], 'alcohol.': [2473], 'Cells': [2474], 'vortexed': [2476], 'centrifuged': [2479], '1,000': [2481, 2757], 'aqueous': [2488], 'layer': [2489], 're-extracted': [2491], 'alcohol,': [2494], 'volumes': [2505, 2513, 2966], 'acetic': [2509], '0.7': [2512], '100%': [2515, 2764, 2968], 'NaOAc,': [2529], 'again': [2531], '70%': [2533], 'ethanol,': [2534, 2969], 'air-dried,': [2535, 2813], 'water.': [2540], 'Equal': [2541], 'amounts': [2542], 'per': [2546], '4.5%': [2552], 'acrylamide,': [2553, 2994], '7': [2554, 2899, 2995], 'urea': [2556, 2997], 'gel,': [2557], 'transferred': [2558], 'nylon': [2560], 'membrane': [2561], 'Biosciences),': [2563, 2741, 2938], 'probed': [2565, 3541, 3603, 3663, 3704, 3782, 3817, 3883, 3909, 4441, 4616], 'partial': [2570], 'transcripts': [2571], '25': [2575, 2653, 2727], 'probe': [2579, 2614, 2635], 'transcribed': [2585, 2621, 2637], 'pB3HE1': [2587], '∼200-nucleotide': [2590], 'fragment': [2591, 2643], 'sequence': [2606], 'plasmid': [2625], 'reverse': [2629], 'direction.': [2630], 'pKH002,': [2639], '∼80-nucleotide': [2642], 'region': [2649], 'Hybridization': [2656], 'probes': [2658], 'visualized': [2663], 'exposure': [2665], 'blot': [2668, 3539, 3661, 3780, 3881, 4281, 4537], 'x-ray': [2670], 'film.': [2671], 'Vivo': [2673], '[35S]Methionine': [2674, 2737], 'Incorporation—Protein': [2675], 'assayed': [2680], 'incorporation': [2683, 3065], 'methionine': [2686], 'protein.': [2688], '(2': [2690], 'cells/ml)': [2693], 'recovered': [2698], 'pulsed': [2732], 'μCi': [2735], '(1000': [2738], 'Ci/mmol;': [2739, 2936], 'Amersham': [2740, 2937, 3016], '100-μl': [2743], 'times': [2749], 'indicated.': [2750], 'g,': [2759], 'trichloroacetic': [2765, 2804], 'aliquot.': [2771], 'preparation': [2773], '70': [2777], 'followed': [2782, 4251], 'ice.': [2787], 'Trichloroacetic': [2788], 'acid-insoluble': [2789], 'material': [2790], 'filtered': [2792], 'through': [2793], '25-mm': [2794], 'glass': [2795], 'microfiber': [2796], 'filters': [2797], '(Whatman': [2798], 'GFC),': [2799], 'ice-cold': [2802, 2808], '5%': [2803], '95%': [2809], 'Filters': [2811], 'radioactivity': [2815], 'quantified': [2817, 3014], 'scintillation': [2819], 'counting.': [2820], 'Replicase': [2822, 2867], 'Assays—RNA': [2823], 'templates': [2824], 'assays': [2828, 2868], 'purchased': [2830], 'Dharmacon': [2832], 'Inc.': [2833], '(Boulder,': [2834], 'CO).': [2835], 'infected': [2841], 'Sun': [2847], '(30Sun': [2850], 'Adkins': [2852, 2874], 'Faurote': [2854, 2881], '1-12Crossref': [2861], '(31Adkins': [2877], 'Stawicki': [2879], 'Siegel': [2883], '4:': [2889], '455-470PubMed': [2890], '(0.5': [2896], 'pmol)': [2897], 'combined': [2904], 'reaction': [2906, 2956, 3031], '(20': [2908], 'sodium': [2910], 'glutamate,': [2911], '8.2,': [2913], '12': [2914], 'dithiothreitol,': [2916], '2': [2920, 3446], 'MnCl2,': [2922], 'GTP,': [2925], '200': [2926, 2929], 'ATP,': [2928], 'UTP,': [2931], '242': [2932], 'nm': [2933], '[α-32P]CTP': [2934], '(400': [2935], '0.5%': [2939], 'Triton': [2940], 'X-100)': [2941], '40-μl': [2944], 'volume.': [2946], '60': [2953], 'min,': [2954], 'extracted': [2959], 'glycogen,': [2973], 'concentration': [2977], '0.4': [2979], 'ammonium': [2981], 'acetate.': [2982], 'Samples': [2983, 4438, 4613], 'formamide': [2987], 'gels.': [2998], 'amount': [3000, 4271, 4348, 4395, 4552], 'label': [3002], 'incorporated': [3003], 'newly': [3005], 'determined': [3009], 'Biosciences': [3017], 'software.': [3018], 'measure': [3020], 'rate': [3022], 'over': [3026, 4119], 'time,': [3027], 'mixture': [3032], 'assembled': [3034], 'above,': [3037], 'times.': [3048], 'Reaction': [3049], 'above.': [3056], 'percentages': [3058], 'normalized': [3062], 'CMP': [3064], 'relative': [3066], 'set': [3075], 'reactions.': [3077], 'Mature': [3080], 'Mutants': [3084], 'coli—In': [3087], 'pokeweed,': [3088], 'first': [3091], '313-amino': [3095], 'acid-long': [3096], 'precursor': [3097], 'produce': [3102, 3249], '(262-amino': [3105], 'acid)': [3106], 'protein,': [3110], '22': [3113], '29': [3115], 'amino': [3116, 3235, 3254], 'acids': [3117], 'cleaved': [3118], 'N': [3121], 'C': [3123], 'termini,': [3124], 'respectively.': [3125], 'Analysis': [3126, 4458], 'facilitated': [3137], 'coli-expressed': [3140, 3935], '(32Rajamohan': [3145], 'Engstrom': [3147], 'C.R.': [3148], 'Denton': [3149], 'T.J.': [3150], 'Engen': [3151], 'L.A.': [3152], 'Kourinov': [3153], 'Protein': [3157], 'Purif.': [3159], '359-368Crossref': [3162], '(36)': [3165], '33Honjo': [3168], 'Watanabe': [3170], 'Biotechnol.': [3173], '1291-1294Crossref': [3177], '(10)': [3180], 'However,': [3183, 4106], 'derived': [3189], 'yet': [3195], 'analyzed.': [3199], 'enzymatically': [3202], 'active': [3203, 3282, 4383, 4424], 'respective': [3207], 'required': [3212], 'fully': [3217], 'forms,': [3219], 'would': [3221], 'accurately': [3222], 'mimic': [3223], 'eukaryotic': [3227], 'substitutions': [3237], 'Val23': [3243], 'end': [3245], 'Thr284': [3247], '262': [3253], 'acids.': [3255], 'facilitate': [3257], 'purification,': [3258], 'His6': [3265], 'tag.': [3266], 'Three': [3267, 4653], 'expressed': [3273, 3950, 3999, 4165, 4177], 'PAPx': [3279, 4386], 'site': [3283, 4384], 'point': [3287, 3330], 'mutation': [3288, 3331], 'E176V': [3289], 'inactivates': [3291], 'glycosylase': [3293], '(34Hur': [3298, 3348], '1995;': [3317, 3367], '92:': [3318, 3368], '8448-8452Crossref': [3319, 3369], 'PAPn': [3325, 3450, 4365, 4435], 'PAPc': [3327, 3385, 3627, 3944, 4147, 4367, 4563], 'contain': [3328, 3461], 'G75D': [3332], 'termination': [3335], 'codon': [3336], 'place': [3338], 'Trp259,': [3340], 'respectively,': [3341], 'growth': [3347], 'migrated': [3378], 'masses,': [3383], 'moving': [3386], 'slightly': [3387], 'faster': [3388], 'absence': [3392], '26': [3394], 'residues.': [3396], 'Importantly,': [3397], 'enzymes': [3400], 'lacked': [3401], 'detectable': [3402, 4678], 'contaminating': [3403, 3466], '(Fig.': [3405, 3421, 4358, 4453, 4564, 4628], '1A)': [3406], 'concentrations': [3410, 4312], 'had': [3417], 'minimal': [3418, 4050], 'ribonuclease': [3419], '1B).': [3422], 'highest': [3427], 'level': [3428, 3464, 4302], 'contamination': [3430], '(7%': [3431], 'degradation': [3432], 'template),': [3434], 'did': [3435, 4148, 4387], 'affect': [3437, 4239, 4469, 4637], '(Figs.': [3445], '3).': [3448], 'Although': [3449], 'analysis,': [3456], 'it': [3457], 'similar': [3463, 4170, 4573], 'nucleases,': [3467], 'since': [3468, 4393], 'manner.Fig.': [3476], '2Inhibition': [3477], 'mutants.': [3492], 'A,': [3493, 3739], 'following': [3509, 3631], 'extraction.': [3516, 3638], 'allowed': [3526, 3648], 'replicate': [3528, 3650], 'Total': [3532, 3654, 3773, 3874], '(–PEG)': [3552], '(–BMV)': [3559], 'controls': [3564], 'inoculation.': [3566], 'alone': [3572, 3674], '(0': [3573], 'PAP)': [3574, 3753, 3843], 'replication.': [3587, 3688, 3801, 3904, 4652], 'Std,': [3588, 3689, 3802], 'loaded': [3594, 3695, 3808], 'onto': [3596, 3697, 3810], 'B,': [3599, 3813], 'C,': [3615, 3829], '(–PAP)': [3675, 3792, 3895], 'D,': [3700, 3905], 'RNA.View': [3715, 3920], 'Large': [3716, 3921], 'Image': [3717, 3922], 'Figure': [3718, 3923], 'ViewerDownload': [3719, 3924], 'Hi-res': [3720, 3925], 'image': [3721, 3926], 'Download': [3722, 3927], '(PPT)Fig.': [3723], '3Effect': [3724], '(not': [3749, 3839], 'initially': [3751, 3841], 'either': [3853], '(PPT)': [3928], 'Depurination': [3929], 'Barley': [3931, 4033, 4189, 4463], 'Mutants—The': [3939], 'do': [3945], '(35Zoubenko': [3955], '44:': [3965], '219-229Crossref': [3966], '36Hudak': [3972], 'Hammell': [3974], 'A.B.': [3975], 'Yasenchak': [3976], 'Dinman': [3980], '2001;': [3983], '279:': [3984], '292-301Crossref': [3985], '(20)': [3988], 'ribosomes,': [4007], 'leaves,': [4017], 'analysis': [4021, 4282, 4336, 4538], 'detect': [4028], 'purine': [4031], 'residue.': [4032], 'host': [4036], 'focus': [4040], 'study.': [4043], 'Fig.': [4047, 4295, 4360], '1C,': [4048], 'levels': [4051, 4123, 4609], 'evident': [4059], 'background': [4068, 4120, 4154], 'endogenous': [4075], '(37Chaudhry': [4081], 'Muller': [4083], 'U.F.': [4084], 'Cameron': [4085], 'Mills': [4086], 'Gough': [4088], 'Simpson': [4090], 'Skriver': [4092], 'Mundy': [4094], '815-824Crossref': [4100], '(127)': [4103], 'increased': [4115], '12-fold': [4118], 'Efficient': [4122], 'observed': [4128], 'coli.': [4138], 'contrast,': [4140], 'data': [4157], 'illustrate': [4158], 'exhibit': [4169], 'properties': [4172], 'corresponding': [4175], 'transgenic': [4179], 'yeast.': [4182], 'Inhibition': [4183], 'Accumulation': [4187], 'PAP—We': [4194], 'depurinates': [4201], 'system': [4217], 'could': [4238, 4468, 4635], 'vivo,': [4243, 4474], 'extraction': [4254], 'ethanol': [4256], 'precipitation': [4257], 'remove': [4259], 'Treated': [4261], 'product': [4274], 'accumulated': [4276], 'monitored': [4278], '(mutant': [4283], 'incapable': [4286], 'detected': [4291], 'assay).': [4294], '2A': [4296], 'illustrates': [4297], 'increasing': [4311], 'indicate': [4317, 4408], 'repeated': [4338], '2A).': [4359], '2C': [4361], 'shows': [4362, 4547], 'despite': [4376], 'being': [4377], 'inactive': [4378], 'depurination.': [4381], 'accumulation,': [4392], 'indistinguishable': [4400], 'treatment.': [4405], 'require': [4419], 'functional': [4423], 'site;': [4425], 'however,': [4426], 'different': [4429], 'requirements': [4430], 'PAPc.': [4437], 'indicator': [4448], '2,': [4454], 'B': [4455], 'D).': [4457], 'Protoplasts—To': [4464], 'transfection.': [4497], 'known': [4500, 4665], 'traverse': [4505], 'membranes;': [4507], 'thus,': [4508], 'access': [4509], 'cytosol': [4514], 'anticipated': [4516], '18-h': [4545], 'those': [4557], '3A).': [4565], 'pattern': [4567], 'seen': [4576], 'Thus,': [4594], 'vivo': [4599], 'treatments': [4600], 'comparable': [4604], 'effects': [4605], '3B).': [4629], 'Next,': [4630], 'examined': [4632], 'selectively': [4636], 'initiation': [4647], 'hours': [4654], 'transfection,': [4656], 'under': [4669], 'way,': [4670], '(38Hema': [4679], '1169-1180Crossref': [4687], 'Sco': [4689]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W2042129286', 'counts_by_year': [{'year': 2023, 'cited_by_count': 2}, {'year': 2022, 'cited_by_count': 2}, {'year': 2021, 'cited_by_count': 3}, {'year': 2020, 'cited_by_count': 4}, {'year': 2019, 'cited_by_count': 1}, {'year': 2018, 'cited_by_count': 4}, {'year': 2017, 'cited_by_count': 1}, {'year': 2016, 'cited_by_count': 6}, {'year': 2015, 'cited_by_count': 2}, {'year': 2014, 'cited_by_count': 3}, {'year': 2013, 'cited_by_count': 1}, {'year': 2012, 'cited_by_count': 3}], 'updated_date': '2025-01-12T14:47:04.475828', 'created_date': '2016-06-24'}