Title: Membrane Association of the Cycling Peroxisome Import Receptor Pex5p
Abstract: Peroxisomal proteins carrying a peroxisome targeting signal type 1 (PTS1) are recognized in the cytosol by the cycling import receptor Pex5p. The receptor-cargo complex docks at the peroxisomal membrane where it associates with multimeric protein complexes, referred to as the docking and RING finger complexes. Here we have identified regions within the Saccharomyces cerevisiae Pex5p sequence that interconnect the receptor-cargo complex with the docking complex. Site-directed mutagenesis of the conserved tryptophan residue within a reverse WXXXF motif abolished two-hybrid binding with the N-terminal half of Pex14p. In combination with an additional mutation introduced into the Pex13p-binding site, we generated a Pex5p mutant defective in a stable association not only with the docking complex but also with the RING finger peroxins at the membrane. Surprisingly, PTS1 proteins are still imported into peroxisomes in these mutant cells. Because these mutations had no significant effect on the membrane binding properties of Pex5p, we examined yeast and human Pex5p for intrinsic lipid binding activity. In vitro analyses demonstrated that both proteins have the potential to insert spontaneously into phospholipid membranes. Altogether, these data strongly suggest that a translocation-competent state of the PTS1 receptor enters the membrane via protein-lipid interactions before it tightly associates with other peroxins. Peroxisomal proteins carrying a peroxisome targeting signal type 1 (PTS1) are recognized in the cytosol by the cycling import receptor Pex5p. The receptor-cargo complex docks at the peroxisomal membrane where it associates with multimeric protein complexes, referred to as the docking and RING finger complexes. Here we have identified regions within the Saccharomyces cerevisiae Pex5p sequence that interconnect the receptor-cargo complex with the docking complex. Site-directed mutagenesis of the conserved tryptophan residue within a reverse WXXXF motif abolished two-hybrid binding with the N-terminal half of Pex14p. In combination with an additional mutation introduced into the Pex13p-binding site, we generated a Pex5p mutant defective in a stable association not only with the docking complex but also with the RING finger peroxins at the membrane. Surprisingly, PTS1 proteins are still imported into peroxisomes in these mutant cells. Because these mutations had no significant effect on the membrane binding properties of Pex5p, we examined yeast and human Pex5p for intrinsic lipid binding activity. In vitro analyses demonstrated that both proteins have the potential to insert spontaneously into phospholipid membranes. Altogether, these data strongly suggest that a translocation-competent state of the PTS1 receptor enters the membrane via protein-lipid interactions before it tightly associates with other peroxins. Peroxisomes post-translationally import folded and oligomeric proteins of very different sizes from the cytosol across the single membrane into their matrix (1Lazarow P.B. Curr. Opin. Cell Biol. 2003; 15: 489-497Crossref PubMed Scopus (111) Google Scholar, 2Eckert J.H. Erdmann R. Rev. Physiol. Biochem. Pharmacol. 2003; 147: 75-121Crossref PubMed Scopus (82) Google Scholar, 3Sparkes I.A. Baker A. Mol. Membr. Biol. 2002; 19: 171-185Crossref PubMed Scopus (34) Google Scholar, 4van der Klei I. Veenhuis M. Curr. Opin. Cell Biol. 2002; 14: 500-505Crossref PubMed Scopus (24) Google Scholar). This is in contrast to most other translocation systems that transport unfolded polypeptide chains (5Schnell D.J. Hebert D.N. Cell. 2003; 112: 491-505Abstract Full Text Full Text PDF PubMed Scopus (191) Google Scholar). Although the identities of many proteins, collectively called peroxins, that are required for this process are known, the mechanism of protein translocation across the peroxisomal membrane is poorly understood. Current evidence favors a cycling receptor model for matrix protein import (6Dammai V. Subramani S. Cell. 2001; 105: 187-196Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar, 7Dodt G. Gould S.J. J. Cell Biol. 1996; 135: 1763-1774Crossref PubMed Scopus (265) Google Scholar, 8Nair D.M. Purdue P.E. Lazarow P.B. J. Cell Biol. 2004; 167: 599-604Crossref PubMed Scopus (101) Google Scholar). Two soluble import receptors, Pex5p and Pex7p, bind their cognate peroxisomal targeting signals (PTS) 3The abbreviations used are: PTS, peroxisomal targeting signal; DOPC, 1,2-dioleoyl-sn-glycero-3-phosphocholine; DOPE, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine; PMSF, phenylmethylsulfonyl fluoride; MES, 4-morpholineethanesulfonic acid; aa, amino acid; ProtA, Protein A. in the cytosol and then shuttle to peroxisomes, where the PTS proteins are imported. After releasing their cargo, the receptors recycle to the cytosol for additional rounds of import. Most of the peroxisomal matrix proteins possess one of two evolutionarily conserved PTS, the C-terminal PTS1 or the N-terminal PTS2, which are specifically recognized by Pex5p and Pex7p, respectively (2Eckert J.H. Erdmann R. Rev. Physiol. Biochem. Pharmacol. 2003; 147: 75-121Crossref PubMed Scopus (82) Google Scholar, 3Sparkes I.A. Baker A. Mol. Membr. Biol. 2002; 19: 171-185Crossref PubMed Scopus (34) Google Scholar). A few matrix proteins are known that contain a completely different targeting signal that is also recognized by Pex5p (9Gunkel K. van Dijk R. Veenhuis M. van der Klei I.J. Mol. Biol. Cell. 2004; 15: 1347-1355Crossref PubMed Scopus (62) Google Scholar, 10Klein A.T. van Den Berg M. Bottger G. Tabak H.F. Distel B. J. Biol. Chem. 2002; 277: 25011-25019Abstract Full Text Full Text PDF PubMed Scopus (106) Google Scholar, 11Kragler F. Langeder A. Raupachova J. Binder M. Hartig A. J. Cell Biol. 1993; 120: 665-673Crossref PubMed Scopus (124) Google Scholar, 12Parkes J.A. Langer S. Hartig A. Baker A. Mol. Membr. Biol. 2003; 20: 61-69Crossref PubMed Scopus (10) Google Scholar). This import receptor was shown to consist of two functionally distinct domains. Although binding of the PTS1 proteins is mediated by six tetratricopeptide repeats within its C-terminal half (13Gatto G.J. Geisbrecht B.V. Gould S.J. Berg J.M. Nat. Struct. Biol. 2000; 7: 1091-1095Crossref PubMed Scopus (300) Google Scholar), essential transport steps of the receptor cycle seem to be performed by its N-terminal half (9Gunkel K. van Dijk R. Veenhuis M. van der Klei I.J. Mol. Biol. Cell. 2004; 15: 1347-1355Crossref PubMed Scopus (62) Google Scholar, 14Schäfer A. Kerssen D. Veenhuis M. Kunau W.H. Schliebs W. Mol. Cell. Biol. 2004; 24: 8895-8906Crossref PubMed Scopus (86) Google Scholar). Numerous reports demonstrate that mammalian and yeast Pex5p tightly associate with peroxisomal membranes (15Gouveia A.M. Reguenga C. Oliveira M.E. Sa-Miranda C. Azevedo J.E. J. Biol. Chem. 2000; 275: 32444-32451Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar, 16Wiemer E.A.C. Nuttley W.M. Bertolaet B.L. Li X. Francke U. Wheelock M.J. Anne U.K. Johnson K.R. Subramani S. J. Cell Biol. 1995; 130: 51-65Crossref PubMed Scopus (164) Google Scholar, 17Fransen M. Brees C. Baumgart E. Vanhooren J.C.T. Baes M. Mannaerts G.P. van Veldhoven P.P. J. Biol. Chem. 1995; 270: 7731-7736Abstract Full Text Full Text PDF PubMed Scopus (163) Google Scholar, 18McCollum D. Monosov E. Subramani S. J. Cell Biol. 1993; 121: 761-774Crossref PubMed Scopus (208) Google Scholar, 19Terlecky S.R. Nuttley W.M. McCollum D. Sock E. Subramani S. EMBO J. 1995; 14: 3627-3634Crossref PubMed Scopus (155) Google Scholar, 20Kikuchi M. Hatano N. Yokota S. Shimozawa N. Imanaka T. Taniguchi H. J. Biol. Chem. 2004; 279: 421-428Abstract Full Text Full Text PDF PubMed Scopus (227) Google Scholar). Membrane peroxins that bind directly to both receptors, Pex5p and Pex7p, are Pex13p (21Barnett P. Bottger G. Klein A.T.J. Tabak H.F. Distel B. EMBO J. 2000; 19: 6382-6391Crossref PubMed Scopus (80) Google Scholar, 22Stein K. Schell-Steven A. Erdmann R. Rottensteiner H. Mol. Cell. Biol. 2002; 22: 6056-6069Crossref PubMed Scopus (96) Google Scholar, 23Elgersma Y. Kwast L. Klein A. Voorn-Brouwer T. van den Berg M. Metzig B. America T. Tabak H.F. Distel B. J. Cell Biol. 1996; 135: 97-109Crossref PubMed Scopus (185) Google Scholar, 24Erdmann R. Blobel G. J. Cell Biol. 1996; 135: 111-121Crossref PubMed Scopus (185) Google Scholar) and Pex14p (25Fransen M. Terlecky S.R. Subramani S. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 8087-8092Crossref PubMed Scopus (136) Google Scholar, 26Girzalsky W. Rehling P. Stein K. Kipper J. Blank L. Kunau W.-H. Erdmann R. J. Cell Biol. 1999; 144: 1151-1162Crossref PubMed Scopus (149) Google Scholar, 27Huhse B. Rehling P. Albertini M. Blank L. Meller K. Kunau W.H. J. Cell Biol. 1998; 140: 49-60Crossref PubMed Scopus (126) Google Scholar). These two proteins together with Pex17p have been established as members of a membrane-bound docking subcomplex (28Hazra P.P. Suriapranata I. Snyder W.B. Subramani S. Traffic. 2002; 3: 560-574Crossref PubMed Scopus (102) Google Scholar, 29Agne B. Meindl N.M. Niederhoff K. Einwachter H. Rehling P. Sickmann A. Meyer H.E. Girzalsky W. Kunau W.H. Mol. Cell. 2003; 11: 635-646Abstract Full Text Full Text PDF PubMed Scopus (197) Google Scholar). An even larger complex, termed the importomer, which in addition to the docking subcomplex contains Pex8p and the three RING finger peroxins, Pex2p, Pex10p, and Pex12p, has been shown to exist in the peroxisomal membrane (29Agne B. Meindl N.M. Niederhoff K. Einwachter H. Rehling P. Sickmann A. Meyer H.E. Girzalsky W. Kunau W.H. Mol. Cell. 2003; 11: 635-646Abstract Full Text Full Text PDF PubMed Scopus (197) Google Scholar). The ATP-dependent dislocation of the PTS1 receptor from the peroxisomal membrane into the cytosol is mediated by the AAA peroxins Pex1p and Pex6p (30Platta H.W. Grunau S. Rosenkranz K. Girzalsky W. Erdmann R. Nat. Cell Biol. 2005; 7: 817-822Crossref PubMed Scopus (187) Google Scholar). The interaction of Pex5p and Pex14p, which seems to be the initial binding partner of the receptors at the peroxisomal membrane, has been studied intensively (31Choe J. Moyersoen J. Roach C. Carter T.L. Fan E. Michels P.A. Hol W.G. Biochemistry. 2003; 42: 10915-10922Crossref PubMed Scopus (35) Google Scholar, 32Schliebs W. Saidowsky J. Agianian B. Dodt G. Herberg F.W. Kunau W.H. J. Biol. Chem. 1999; 274: 5666-5673Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar, 33Otera H. Setoguchi K. Hamasaki M. Kumashiro T. Shimizu N. Fujiki Y. Mol. Cell. Biol. 2002; 22: 1639-1655Crossref PubMed Scopus (175) Google Scholar, 34Nito K. Hayashi M. Nishimura M. Plant Cell Physiol. 2002; 43: 355-366Crossref PubMed Scopus (84) Google Scholar). It was found that the N terminus (amino acid residues 1–78) of human Pex14p directly interacts with Pex5p with a binding affinity in the nanomolar range (32Schliebs W. Saidowsky J. Agianian B. Dodt G. Herberg F.W. Kunau W.H. J. Biol. Chem. 1999; 274: 5666-5673Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar). Moreover, the seven conserved WXXXF motifs within the N-terminal half of human Pex5p form individual high affinity sites for Pex14p (35Saidowsky J. Dodt G. Kirchberg K. Wegner A. Nastainczyk W. Kunau W.H. Schliebs W. J. Biol. Chem. 2001; 276: 34524-34529Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar). These motifs are present in variable number and spacing in all known Pex5 proteins. Recently it was shown that the PTS1 and the PTS2 receptors not only associate with the outer surface of the membrane (cycling receptor model) but actually traverse the membrane. This has led to the extended shuttle receptor model (6Dammai V. Subramani S. Cell. 2001; 105: 187-196Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar). Despite these accumulating data about the translocation machinery, a translocation channel has not yet been identified. In this study, we investigated the interaction of Saccharomyces cerevisiae Pex5p (ScPex5p) at the peroxisomal membrane in greater detail. The identification of a novel Pex14p-binding site in the Pex5p sequence enabled us to generate a mutant Pex5p that has lost the ability to associate stably with the docking and the RING finger complex. Most unexpectedly, this Pex5p variant associated together with cargo protein with the peroxisomal membrane and was still able to mediate matrix protein import. From these findings we speculated that protein-lipid interaction rather than protein-protein interactions could anchor the receptor-cargo complex at the membrane. In a first step to verify this assumption, we show in vitro that Pex5p has the ability to spontaneously insert into phospholipid monolayers and bilayers. Yeast Strains, Media, and Growth Conditions—Yeast strains used in this study are derivatives of S. cerevisiae UTL-7A if not stated otherwise (Table 1). Strains expressing proteins fused to tobacco etch virus (tobacco etch virus-protease cleavage site)-protein A instead of wild-type Pex5p were generated by genomic integration into the PEX5 locus. This was achieved by transforming haploid yeast cells with the PCR products according to Knop et al. (36Knop M. Siegers K. Pereira G. Zachariae W. Winsor B. Nasmyth K. Schiebel E. Yeast. 1999; 15: 963-972Crossref PubMed Scopus (815) Google Scholar). The yeast strain pex3Δpex19Δ was generated according to Güldener et al. (37Güldener U. Heck S. Fiedler T. Beinhauer J. Hegemann J.H. Nucleic Acids Res. 1996; 24: 2519-2524Crossref PubMed Scopus (1362) Google Scholar) using primer pairs Ku365/Ku700 (Table 2) for PEX19 deletion and Ku575/Ku862 for PEX3 deletion. The construction of the pex13Δ pex14Δ pex5Δ strain required the disruption of PEX5 with the removable loxP-kanMX4-loxP marker using the oligonucleotides Ku301 and Ku976b. The deletion of PEX13 was generated using the primer pair Ku274/RE534, whereas PEX14 was deleted with the oligonucleotides RE536 and RE537. Complete and minimal media used for yeast culturing have been described previously (38Erdmann R. Veenhuis M. Mertens D. Kunau W.-H. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 2432-2436Crossref Scopus (263) Google Scholar).TABLE 1S. cerevisiae strains usedStrainDescriptionRef.UTL-7A (wild-type)MATα, ura 3-52, trp1, leu2-3/1138Erdmann R. Veenhuis M. Mertens D. Kunau W.-H. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 2432-2436Crossref Scopus (263) Google ScholarWild-type Pex5p-ProtAUTL-7A, PEX5-TEV-ProteinA-kanMX6-Tpex514Schäfer A. Kerssen D. Veenhuis M. Kunau W.H. Schliebs W. Mol. Cell. Biol. 2004; 24: 8895-8906Crossref PubMed Scopus (86) Google Scholarpex5ΔMATα, ura 3-52, trp1, leu2-3/112, pex5::LEU214Schäfer A. Kerssen D. Veenhuis M. Kunau W.H. Schliebs W. Mol. Cell. Biol. 2004; 24: 8895-8906Crossref PubMed Scopus (86) Google Scholarpex5Δpex1ΔMATα, ura 3-52, trp1, leu2-3/112, pex1::loxP, pex5::loxPkan30Platta H.W. Grunau S. Rosenkranz K. Girzalsky W. Erdmann R. Nat. Cell Biol. 2005; 7: 817-822Crossref PubMed Scopus (187) Google Scholarpex3Δpex19ΔMATα, ura 3-52, trp1, leu2-3/112, pex3::loxPkan, pex19::loxPThis studypex5Δpex13Δpex14ΔMATα, ura 3-52, trp1, leu2-3/112, pex5::loxP, pex13::loxP, pex14:loxPkanThis studyPCY2Matα, Dga14, Dgal180, URA::GAL1-lacZ, lys2-801amber, his3-D200, trp1-D63, leu2 ade2-101ochre39Chevray P.M. Nathans D. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 5789-5793Crossref PubMed Scopus (480) Google Scholar Open table in a new tab TABLE 2Oligonucleotides usedDesignationSequence (5′ to 3′)KU 274TATCTATAAATATCAAGGGGATTCTATACTATAACAATACCTGCGCGTACGCTGCAGGTCGACKU 301TATACATCAATAAACAATATATCATAACACATGGACGTACGTACGCTGCAGGTCGACKU 365AAGAATTACAAATTGTGGGAACCGAAGTATTGACGGAAAGAAGAAATKU 575CGTAAAAGCAGAAGCACGAAACAAGGAGGCAAACCACTAAAAGGCGTACGCTGCAGGTCGACKU 862CATGTTACCTATTGCACACTTACTGTATTAAAGATTACGCATAGGCCACTAGTGGATCTGKU 700TACTTTTTTTTTTTTTTTTTTACTGTTATCATAAATATATATACCTTAATAGGCCACTAGTGGATCTGKU 855TATATCTCATGCTTCACACAGGAATTTCAAGGTAGTAKU 856TCCTGTGAAGCATGAGATATATCGTTCACTCCKU 857CAACCCGCTACAGATCAGTTTGAAAAGCTGKU 858CTGATCTGAGCGGGTTGTTGTTCTTGCTCATTKU 875TCAGTGTCACCATGGACGTAGGAAGTTGCTCAKU 876CAGAGATCTTCATTCCTTCTCAACAGTTTCTGGKU 888AGAGATCTTCAAAACGAAAATTCTCCTTTAAATCKU 976bTGATGCGAGAACATAAAATTGCGGAGAACCATATCAATAGGCCACTAGTGGATCTGKU 1457AAGAAGTGGCGGATAGCATACACAAGGACGKU 1458TATCCGCCACTTCTTGGAAATCAGATTGAKU 1436CTATACCAAGCATACAATCAACKU 1433TTGGAAATCAGATTGATACTGATCTCCATATACTCCTTCCTGAATTCCCGGGGTCGACCKU 1434GATGTGCGGCCGCGTCCTTGTGTATGCTATCCCACACTTCTTGGAAATCAGATTGATAGTGAKU 1520CGAAAGCTTATGAAGCTACTGTCTTCTATCGKU 1521AATGCGGCCGCTCATAACTTTGCTTTTCGTTTATTCTCATTTTCCAAGGCGTAGATCTGAATTCCCGGGGKU 1584ACTCGGCATGCAACAGATCTATATTACCCTGTTATCRE 534CTAGTGTGTACGCGTTTCATCATCAACATGCTCAATTTTCTTCCGATAGGCCACTAGTGGATCTGRE 536TTTGAAAACTCAAGTAAAACAGAGAAGTTGTAAGGTGAATAAGGACAGCTGAAGCTTCGTACGCTRE 537CTATGGGATGGAGTCTTCGACCTGTCCATTTTGCCAGTCAGGGACATAGGCCACTAGTGGATCTG Open table in a new tab DNA Manipulations—All expression plasmids used in this study code for yeast proteins if no other organism is noted. All plasmids named pDK or pWK contain modified copies of the ScPEX5 gene, which were expressed in a PEX5 deletion strain from the low copy vector pRS416 (Stratagene). The constructs are under control of the PEX5 promotor region and an ADC1 termination region (14Schäfer A. Kerssen D. Veenhuis M. Kunau W.H. Schliebs W. Mol. Cell. Biol. 2004; 24: 8895-8906Crossref PubMed Scopus (86) Google Scholar). The corresponding coding DNA regions were amplified by PCR using genomic DNA of the wild-type strain as a template. The oligonucleotides used in this study are listed in Table 2 and were obtained from Eurogentec (Belgium). The PEX5 full-length fragment was amplified by using the primers Ku875 and Ku888. The amplification product was cloned using primer-generated endonuclease recognition sites into SalI/BglII-digested pWK-PEX5-(aa 1–313) (14Schäfer A. Kerssen D. Veenhuis M. Kunau W.H. Schliebs W. Mol. Cell. Biol. 2004; 24: 8895-8906Crossref PubMed Scopus (86) Google Scholar) and into SalI/BglII-digested pPC86 (39Chevray P.M. Nathans D. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 5789-5793Crossref PubMed Scopus (480) Google Scholar) resulting in pWK-PEX5 and pPC86-PEX5. The PEX5-(aa 1–313) fragment was obtained by SalI/BglII digestion from the vector pWK-PEX5-(aa 1–313) (14Schäfer A. Kerssen D. Veenhuis M. Kunau W.H. Schliebs W. Mol. Cell. Biol. 2004; 24: 8895-8906Crossref PubMed Scopus (86) Google Scholar) and ligated into a SalI/BglII-digested two-hybrid vector pPC86 resulting in pPC86-PEX5-(aa 1–313). The same procedure was used to obtain the PEX5-(aa 313–612) fragment from the vector pDK-PEX5-(aa 313–612) (14Schäfer A. Kerssen D. Veenhuis M. Kunau W.H. Schliebs W. Mol. Cell. Biol. 2004; 24: 8895-8906Crossref PubMed Scopus (86) Google Scholar) resulting in pPC86-PEX5-(aa 313–612). The PEX5-(aa 1–245) fragment was amplified using the primer pair Ku875/Ku876. The amplification product was digested with SalI and BglII and ligated into a SalI/BglII-digested pPC86 vector resulting in pPC86-PEX5-(aa 1–245). The PEX5 fragment encoding amino acids 246–267 was amplified by two PCRs. In a first step a fragment corresponding to amino acids 246–258 fused to the GAL-4-activating domain was amplified using the two-hybrid vector pPC86 as template and the primer pair Ku1436/Ku1433 in which the latter one codes for the PEX5 fragment. The PCR product serves as template for the final fragment coding for amino acids 246–267, which was amplified by the primer pair Ku1436/Ku1434 in which the latter one codes for the PEX5 fragment (aa 252–267) and contains a NotI restriction site. The amplification product was ligated after MluI/NotI restriction into an MluI/NotI-digested pPC86 vector resulting in pPC86-PEX5-(aa 246–267). Point mutations in PEX5 were introduced using overlap extension PCR (40Higuchi R. Krummel B. Saiki R.K. Nucleic Acids Res. 1988; 16: 7351-7367Crossref PubMed Scopus (2102) Google Scholar). All base pair changes were verified by sequencing. For the mutation Pex5p(W120A), PCR products were amplified by primer pairs Ku875/Ku856 and Ku855/Ku888 using genomic DNA of wild-type strain as template. Ku856 and Ku855 contain a substituted base pair triplet coding for alanine at amino acid position 120. The exterior primers Ku875 and Ku888 together with both PCR products were used for the overlap extension PCR. The amplification product was digested with SalI and BglII and ligated into SalI/BglII-digested pPC86 resulting in pPC86-PEX5(W120A). To introduce the double mutation W120A/W204A into the PEX5 sequence, the PCR product PEX5(W120A) was used as a template. Overlapping PCR was carried out as described above using primers Ku857 and Ku858 for the substitution W204A and the exterior primers Ku875 and Ku888. The PCR product was digested with SalI and BglII and ligated into SalI/BglII digested pPC86 resulting in pPC86-PEX5(W120A;W204A). To introduce the single mutation Pex5p(Trp-204) the same cloning procedure was carried out as described above but using genomic DNA of wild-type strain as template resulting in pPC86-PEX5(W204A). Additionally, the PCR fragment was ligated into SalI/BglII-digested pWK-PEX5-(aa 1–313) resulting in pDK-PEX5(W204A). To obtain Pex5p(W261A), PCR products were amplified by primer pairs Ku875/Ku1458 and Ku888/Ku1457 using genomic DNA of wild-type strain as template. Ku1458 and Ku1457 contain a substituted base pair triplet coding for alanine at amino acid position 261. The exterior primers Ku875 and Ku888 together with both PCR products were used for the overlap extension PCR. The amplification product was digested with SalI and BglII and ligated into SalI/BglII-digested pWK-PEX5-(aa 1–313) (14Schäfer A. Kerssen D. Veenhuis M. Kunau W.H. Schliebs W. Mol. Cell. Biol. 2004; 24: 8895-8906Crossref PubMed Scopus (86) Google Scholar) and into SalI/BglII-digested pPC86 (39Chevray P.M. Nathans D. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 5789-5793Crossref PubMed Scopus (480) Google Scholar), resulting in pDK-PEX5(W261A) and pPC86-PEX5(W261A). To introduce the double mutation W120A/W204A into the PEX5 sequence, PEX5(W204A) was used as a template. Overlapping PCR was carried out as described above using primers Ku1558 and Ku1457 for the substitution W204A and the exterior primers Ku875 and Ku888. The amplification product was digested with SalI and BglII and ligated into SalI/BglII digested pPC86 and pWK-PEX5-(aa 1–313) resulting in pPC86-PEX5(W204A;W261A) and pDK-PEX5(W204A;W261A). The PTS1 peptide represents the 12 C-terminal amino acids 659–670 from the carnitine-acetyltransferase 2. The fragment was amplified by the primer pair Ku1520/Ku1521 using the two-hybrid vector pPC97 as template. The primer Ku1520 contains a HindIII restriction site and binds on the Gal-4 binding domain of the vector. The primer Ku1521 contains a NotI restriction site and encodes for the PTS1 sequence. The amplification product was ligated after HindIII/NotI restriction into HindIII/NotI-digested pPC97 vector resulting in pPC97-PTS1. The vectors pPC97-PEX14-(aa 1–58) and pPC97-PEX14-(aa 235–341) were kindly provided by K. Niederhoff (Bochum, Germany) (41Niederhoff K. Meindl-Beinker N.M. Kerssen D. Perband U. Schafer A. Schliebs W. Kunau W.-H. J. Biol. Chem. 2005; 280: 35571-35578Abstract Full Text Full Text PDF PubMed Scopus (36) Google Scholar). Plasmid pPC97-PEX14 was described by Albertini et al. (42Albertini M. Rehling P. Erdmann R. Girzalsky W. Kiel J.A.K.W. Veenhuis M. Kunau W.-H. Cell. 1997; 89: 83-92Abstract Full Text Full Text PDF PubMed Scopus (268) Google Scholar). The vector pPC97-PEX8 was described by Rehling and co-workers (40Higuchi R. Krummel B. Saiki R.K. Nucleic Acids Res. 1988; 16: 7351-7367Crossref PubMed Scopus (2102) Google Scholar, 43Rehling P. Skaletz-Rorowski A. Girzalsky W. Voorn-Brouwer T. Franse M.M. Distel B. Veenhuis M. Kunau W.H. Erdmann R. J. Biol. Chem. 2000; 275: 3593-3602Abstract Full Text Full Text PDF PubMed Scopus (71) Google Scholar). The vector pPC97-PEX13 harbors a PEX13 fragment that encodes the Src homology 3 domain ranging from amino acid positions 286 to 386 (24Erdmann R. Blobel G. J. Cell Biol. 1996; 135: 111-121Crossref PubMed Scopus (185) Google Scholar). To create yeast expression plasmids coding for Pex5p(W261A)-ProtA, Pex5p(W204A)-ProtA, and Pex5p(W204;261A)-ProtA, a PCR product containing a PEX5-ProtA fragment (14Schäfer A. Kerssen D. Veenhuis M. Kunau W.H. Schliebs W. Mol. Cell. Biol. 2004; 24: 8895-8906Crossref PubMed Scopus (86) Google Scholar) was obtained with the primer pair Ku875 and Ku1584 (containing a SpHI restriction site) by using genomic DNA isolated from strain UTL-Pex5p-ProtA as a template. The amplification product was cloned after NheI/SpHI restriction into NheI/SpHI-digested pWK-Pex5p(W261A), pWK-Pex5p(W204A), and pWK-Pex5p(W204;261A), resulting in pDK-Pex5p(W261A)ProtA, pDK-Pex5p(W204A)ProtA and pDK-Pex5p(W204;261A)ProtA. For bacterial expression of yeast Pex5p, the vector pET9d-His-ScPex5p was kindly provided by K. Niederhoff (Bochum, Germany). For expression of human Pex5p, the vector pET9d-His-HsPex5Lp was used (32Schliebs W. Saidowsky J. Agianian B. Dodt G. Herberg F.W. Kunau W.H. J. Biol. Chem. 1999; 274: 5666-5673Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar). Two-hybrid Assay—For two-hybrid assays based on the method of Fields and Song (44Fields S. Song O.K. Nature. 1989; 340: 245-246Crossref PubMed Scopus (4863) Google Scholar), open reading frames of selected PEX genes were fused to the DNA-binding domain or transcription-activating domain of GAL4 in the vectors pPC86 and pPC97 (39Chevray P.M. Nathans D. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 5789-5793Crossref PubMed Scopus (480) Google Scholar). Cotransformation of two-hybrid vectors into yeast strain PCY2 (Clontech) was performed according to the protocols of the manufacturer. Transformed yeast cells were plated on SD synthetic medium without tryptophan and leucine. β-Galactosidase filter tests were performed as described previously (45Rehling P. Marzioch M. Niesen F. Wittke E. Veenhuis M. Kunau W.-H. EMBO J. 1996; 15: 2901-2913Crossref PubMed Scopus (141) Google Scholar). Western Blotting and Densitometry—Western blots were incubated with polyclonal rabbit antibodies raised against human Pex5p and the S. cerevisiae proteins thiolase, Fox1p, Pex5p, Pex10p, Pex12p, Pex13p, Pex14p, Pex17p, Pex3p, catalase A, porin, fructose-1,6-bisphosphatase (all raised in our laboratory), aconitase (a kind gift of R. Lill, University of Marburg, Germany), Mdh3p (a kind gift of L. McAlister-Henn, University of California), and Sec72p (a kind gift of E. Hartmann, University of Lübeck, Germany). Horseradish peroxidase coupled with anti-rabbit IgG in combination with the ECL system (Amersham Biosciences) was used to detect immunoreactive complexes. For semi-quantitative analyses of Western blot signals the band density on film was measured with a scanner using Scion image software. The relative density of signals was calculated in the area encompassing the immunoreactive protein band and subtracting the background of an adjacent nonreactive area in the same lane of the protein of interest. Yeast Cell Fractionation—Spheroplasting of yeast cells, homogenization, and differential centrifugation at 25,000 × g of post-nuclear supernatants were performed as described previously (38Erdmann R. Veenhuis M. Mertens D. Kunau W.-H. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 2432-2436Crossref Scopus (263) Google Scholar). Cell fractionation by means of density gradient centrifugation was carried out as described previously (14Schäfer A. Kerssen D. Veenhuis M. Kunau W.H. Schliebs W. Mol. Cell. Biol. 2004; 24: 8895-8906Crossref PubMed Scopus (86) Google Scholar), but instead of postnuclear supernatant 3–4 mg of protein of 25,000 × g organellar pellet were loaded onto the gradient. For membrane extraction of organellar pellets, aliquots were adjusted to a final concentration of 0.1 m Na2CO3, pH 11.5, and 1 mm phenylmethylsulfonyl fluoride (PMSF). Samples were incubated for 30 min on ice and subjected to centrifugation at 100,000 × g for 1 h. Protease protection experiments were carried out with organellar pellets containing 100 μg of protein and increasing amounts of proteinase K (Sigma) in buffer (0.6 m sorbitol, 5 mm MES, 0.5 mm EDTA, 50 mm KCl, pH 6.0) with or without 1% Triton X-100. Digestion was carried out on ice for 10 min and stopped by adding PMSF (240 μg/ml) and SDS-PAGE sample buffer. All samples were analyzed by Western blotting. For flotation analyses of cell lysates, oleate grown yeast cells were lysed according to Lamb et al. (46Lamb J.R. Michaud W.A. Sikorski R.S. Hieter P.A. EMBO J. 1994; 13: 4321-4328Crossref PubMed Scopus (214) Google Scholar) using glass beads and lysis buffer (20 mm HEPES; 100 mm KOAc; 5 mm MgOAc; pH 7.5) containing protease inhibitors (240 μg/ml PMSF, 2 μg/ml aprotinin, 0.35 μg/ml bestatin, 1 μg/ml pepstatin, 2.5 μg/ml leupeptin, 0.16 mg/ml benzamidine, 5 μg/ml antipain, 0.21 mg/ml NaF, 6 μg/ml chymostatin). 1.5 mg of protein from the lysate were adjusted to a concentration of 45% (w/v) sucrose. The samples were laid onto sucrose cushions (220 μl of lysis buffer with 50% (w/v) sucrose) and overlaid with 500 μl of buffer II (lysis buffer; 40% (w/v) sucrose), 1900 μl of buffer I (lysis buffer; 25% (w/v) sucrose), and 1000 μl of lysis buffer. After ultracentrifugation for 3 h at 170,000 × g in a swing-out rotor, the flotation gradient was collected as 10 fractions from top (fraction 10) to bottom (fraction 1). The fractions were analyzed by SDS-PAGE and Western blot detection. The immunopurification of membrane-associated Pex5p-ProtA and its variants with IgG-coupled Sepharose was performed as described previously (14Schäfer A. Kerssen D. Veenhuis M. Kunau W.H. Schliebs W. Mol. Cell. Biol. 2004; 24: 8895-8906Crossref PubMed Scopus (86) Google Scholar, 29Agne B.