Title: Dual Role of NRSF/REST in Activation and Repression of the Glucocorticoid Response
Abstract: Restriction of glutamine synthetase to the nervous system is mainly achieved through the mutual function of the glucocorticoid receptor and the neural restrictive silencing factor, NRSF/REST. Glucocorticoids induce glutamine synthetase expression in neural tissues while NRSF/REST represses the hormonal response in non-neural cells. NRSF/REST is a modular protein that contains two independent repression domains, at the N and C termini of the molecule, and is dominantly expressed in nonneural cells. Neural tissues express however splice variants, REST4/5, which contain the repression domain at the N, but not at the C terminus of the molecule. Here we show that full-length NRSF/REST or its C-terminal domain can inhibit almost completely the induction of gene transcription by glucocorticoids. By contrast, the N-terminal domain not only fails to repress the hormonal response but rather stimulates it markedly. The inductive activity of the N-terminal domain is mediated by hBrm, which is recruited to the promoter only in the concomitant presence of GR. Importantly, a similar inductive activity is also exerted by the splice variant REST4. These findings raise the possibility that NRSF/REST exhibits a dual role in regulation of glutamine synthetase. It represses gene induction in nonneural cells and enhances the hormonal response, via its splice variant, in the nervous system. Restriction of glutamine synthetase to the nervous system is mainly achieved through the mutual function of the glucocorticoid receptor and the neural restrictive silencing factor, NRSF/REST. Glucocorticoids induce glutamine synthetase expression in neural tissues while NRSF/REST represses the hormonal response in non-neural cells. NRSF/REST is a modular protein that contains two independent repression domains, at the N and C termini of the molecule, and is dominantly expressed in nonneural cells. Neural tissues express however splice variants, REST4/5, which contain the repression domain at the N, but not at the C terminus of the molecule. Here we show that full-length NRSF/REST or its C-terminal domain can inhibit almost completely the induction of gene transcription by glucocorticoids. By contrast, the N-terminal domain not only fails to repress the hormonal response but rather stimulates it markedly. The inductive activity of the N-terminal domain is mediated by hBrm, which is recruited to the promoter only in the concomitant presence of GR. Importantly, a similar inductive activity is also exerted by the splice variant REST4. These findings raise the possibility that NRSF/REST exhibits a dual role in regulation of glutamine synthetase. It represses gene induction in nonneural cells and enhances the hormonal response, via its splice variant, in the nervous system. The glucocorticoid receptor (GR) 2The abbreviations used are:GRglucocorticoid receptorDMEMDulbecco's modified Eagle's mediumWTwild-typeNRSENRSF/REST-binding siteAbantibodyDBDDNA binding domainTSAtrichostatin AGREglucocorticoid response elementHDAChistone deacetylase 2The abbreviations used are:GRglucocorticoid receptorDMEMDulbecco's modified Eagle's mediumWTwild-typeNRSENRSF/REST-binding siteAbantibodyDBDDNA binding domainTSAtrichostatin AGREglucocorticoid response elementHDAChistone deacetylase is a ligand-dependent transcription factor that plays diverse roles in development and homeostasis by regulating the expression of target genes in a tissue- and cell type-specific manner. The expression pattern of glucocorticoid inducible genes is mainly determined by the composite of transcription factor binding sites at the regulatory region of target genes, and by the availability of transcriptional activators that cooperatively enhance the hormonal response. Expression of glucocorticoid inducible genes may also be determined by transcriptional repressors that block the hormonal response. This latter type of action is exerted, for example, by the neural restrictive silencing factor NRSF/REST, which is expressed in non-neural tissues and can restrict the hormonal induction of avian glutamine synthetase to neural tissues (1Avisar N. Shiftan L. Ben-Dror I. Havazelet N. Vardimon L. J. Biol. Chem. 1999; 274: 11399-11407Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar). The molecular mechanism that underlies the interplay between GR and negative or positive transacting factors is largely unknown. glucocorticoid receptor Dulbecco's modified Eagle's medium wild-type NRSF/REST-binding site antibody DNA binding domain trichostatin A glucocorticoid response element histone deacetylase glucocorticoid receptor Dulbecco's modified Eagle's medium wild-type NRSF/REST-binding site antibody DNA binding domain trichostatin A glucocorticoid response element histone deacetylase Glutamine synthetase is a key enzyme in the recycling of the neurotransmitter glutamate and is expressed in neural tissues at a particularly high level (for review, see Ref. 2Vardimon L. Ben-Dror I. Avisar N. Oren A. Shiftan L. J. Neurobiol. 1999; 40: 513-527Crossref PubMed Scopus (63) Google Scholar). Expression of glutamine synthetase is regulated by glucocorticoids, which induce a high level of glutamine synthetase in neural tissue, but not in various non-neural cells. This is despite the fact that non-neural cells express functional glucocorticoid receptor molecules capable of inducing other target genes. Analysis of the regulatory region of avian glutamine synthetase has revealed the presence of an NRSF/REST binding site (NRSE), upstream of the glucocorticoid response element (GRE) (1Avisar N. Shiftan L. Ben-Dror I. Havazelet N. Vardimon L. J. Biol. Chem. 1999; 274: 11399-11407Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar). This site represses the induction of gene transcription by glucocorticoids in non-neural cells and in embryonic neural retina, but not in neural cells. The repressive activity of NRSE is not restricted to the glutamine synthetase promoter and can also be conferred on a synthetic GRE-TK promoter. Its function is orientation- and position-independent with respect to the transcriptional start site, but is dependent on a location proximal to the GRE. Because NRSF/REST is mainly expressed in neural progenitors and non-neural cell types (3Chong J.A. Tapia-Ramirez J. Kim S. Toledo-Aral J.J. Zheng Y. Boutros M.C. Altshuller Y.M. Frohman M.A. Kraner S.D. Mandel G. Cell. 1995; 80: 949-957Abstract Full Text PDF PubMed Scopus (914) Google Scholar, 4Schoenherr C.J. Anderson D.J. Science. 1995; 267: 1360-1363Crossref PubMed Scopus (919) Google Scholar), it has been suggested to play an important role in limiting the induction of glutamine synthetase to neural tissues. Many genes whose expression is restricted to neural tissues contain the neural restrictive silencing element, NRSE, that limits transcription in non-neural cells by binding the transcription factor NRSF/REST. NRSF/REST is a modular protein that contains, in addition to a DNA-binding domain (DBD) with eight consecutive zinc fingers, two independent repression domains located at the N and C terminals of the molecule (3Chong J.A. Tapia-Ramirez J. Kim S. Toledo-Aral J.J. Zheng Y. Boutros M.C. Altshuller Y.M. Frohman M.A. Kraner S.D. Mandel G. Cell. 1995; 80: 949-957Abstract Full Text PDF PubMed Scopus (914) Google Scholar, 4Schoenherr C.J. Anderson D.J. Science. 1995; 267: 1360-1363Crossref PubMed Scopus (919) Google Scholar, 5Tapia-Ramirez J. Eggen B.J. Peral-Rubio M.J. Toledo-Aral J.J. Mandel G. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 1177-1182Crossref PubMed Scopus (113) Google Scholar). The repressive activity of the two domains can be exerted when fused to a heterologous DBD and is mainly mediated by histone deacetylase 1 and 2 (HDAC1/2), which are recruited to the N-terminal repression domain through association with mSin3 (6Grimes J.A. Nielsen S.J. Battaglioli E. Miska E.A. Speh J.C. Berry D.L. Atouf F. Holdener B.C. Mandel G. Kouzarides T. J. Biol. Chem. 2000; 275: 9461-9467Abstract Full Text Full Text PDF PubMed Scopus (192) Google Scholar, 7Roopra A. Sharling L. Wood I.C. Briggs T. Bachfischer U. Paquette A.J. Buckley N.J. Mol. Cell. Biol. 2000; 20: 2147-2157Crossref PubMed Scopus (182) Google Scholar, 8Naruse Y. Aoki T. Kojima T. Mori N. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 13691-13696Crossref PubMed Scopus (202) Google Scholar, 9Huang Y. Myers S.J. Dingledine R. Nat. Neurosci. 1999; 2: 867-872Crossref PubMed Scopus (334) Google Scholar) and to the C-terminal repression domain through association with a novel corepressor CoREST (10Ballas N. Battaglioli E. Atouf F. Andres M.E. Chenoweth J. Anderson M.E. Burger C. Moniwa M. Davie J.R. Bowers W.J. Federoff H.J. Rose D.W. Rosenfeld M.G. Brehm P. Mandel G. Neuron. 2001; 31: 353-365Abstract Full Text Full Text PDF PubMed Scopus (350) Google Scholar, 11You A. Tong J.K. Grozinger C.M. Schreiber S.L. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 1454-1458Crossref PubMed Scopus (389) Google Scholar, 12Humphrey G.W. Wang Y. Russanova V.R. Hirai T. Qin J. Nakatani Y. Howard B.H. J. Biol. Chem. 2001; 276: 6817-6824Abstract Full Text Full Text PDF PubMed Scopus (267) Google Scholar). NRSF/REST can also recruit chromatin modifiers, such as histone methyltransferases, which presumably contribute to long term repression of neural genes (13Shi Y. Sawada J. Sui G. Affar el B. Whetstine J.R. Lan F. Ogawa H. Luke M.P. Nakatani Y. Nature. 2003; 422: 735-738Crossref PubMed Scopus (632) Google Scholar, 14Lunyak V.V. Burgess R. Prefontaine G.G. Nelson C. Sze S.H. Chenoweth J. Schwartz P. Pevzner P.A. Glass C. Mandel G. Rosenfeld M.G. Science. 2002; 298: 1747-1752Crossref PubMed Scopus (394) Google Scholar, 15Roopra A. Qazi R. Schoenike B. Daley T.J. Morrison J.F. Mol. Cell. 2004; 14: 727-738Abstract Full Text Full Text PDF PubMed Scopus (223) Google Scholar). The NRSE site is found in a considerably large number of genes that contribute to different aspects of the neuronal phenotype (16Bruce A.W. Donaldson I.J. Wood I.C. Yerbury S.A. Sadowski M.I. Chapman M. Gottgens B. Buckley N.J. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 10458-10463Crossref PubMed Scopus (375) Google Scholar). Because NRSF/REST is dominantly expressed in non-neural cells, it has been originally viewed as a negative regulator that helps restrict neurogenesis to neurons by blocking the expression of neural specific genes in non-neural cells. An increasing number of studies suggest however that the functional role of NRSF/REST might be more complex. For example, multiple splice variants of NRSF/REST have been identified, two of which, REST 4 and REST 5, are expressed only in neural tissues and contain 5 of the 8 zinc fingers in the DBD, a nuclear targeting domain, and the N-terminal repressor domain of NRSF/REST (17Palm K. Belluardo N. Metsis M. Timmusk T. J. Neurosci. 1998; 18: 1280-1296Crossref PubMed Google Scholar, 18Shimojo M. Lee J.H. Hersh L.B. J. Biol. Chem. 2001; 276: 13121-13126Abstract Full Text Full Text PDF PubMed Scopus (54) Google Scholar). Additionally, several studies have shown that the NRSE site does not only serve as an off switch of gene expression in non-neural cells, but also modulates levels of gene expression in neurons. Transgenic analysis of the promoters of the β2 nicotinic acetylcholine receptor subunit (19Bessis A. Champtiaux N. Chatelin L. Changeux J.P. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 5906-5911Crossref PubMed Scopus (122) Google Scholar) and L1 cell adhesion molecule gene (20Kallunki P. Edelman G.M. Jones F.S. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 3233-3238Crossref PubMed Scopus (61) Google Scholar) has demonstrated that the NRSE, in addition to its repressive function, is also involved in gene activation in subsets of neural cells. Similarly, transient transfection studies have shown that the NRSE site in the promoter of various neuronal genes, including Dynamin I, GluR2, and NMDA receptor, can mediate gene activation in neural cells (21Yoo J. Jeong M.J. Lee S.S. Lee K.I. Kwon B.M. Kim D.S. Park Y.M. Han M.Y. Biochem. Biophys. Res. Commun. 2001; 283: 928-932Crossref PubMed Scopus (22) Google Scholar, 22Bai G. Zhuang Z. Liu A. Chai Y. Hoffman P.W. J. Neurochem. 2003; 86: 992-1005Crossref PubMed Scopus (31) Google Scholar, 23Brene S. Messer C. Okado H. Hartley M. Heinemann S.F. Nestler E.J. Eur. J. Neurosci. 2000; 12: 1525-1533Crossref PubMed Scopus (70) Google Scholar). Studies in developing Xenopus laevis embryos have shown that inhibition of NRSF/REST action by means of a dominant negative protein or anti-sense oligonucleotides results in decreased expression of the NaV1.2 gene as well as of other neuronal genes in specific neural cells (24Armisen R. Fuentes R. Olguin P. Cabrejos M.E. Kukuljan M. J. Neurosci. 2002; 22: 8347-8351Crossref PubMed Google Scholar). Finally, a recent report has suggested that a small non-coding double stranded RNA, containing NRSE motif, can stimulate the differentiation of adult hippocampal stem cells to mature neurons by converting NRSF/REST from a repressor to an activator of neuronal genes (25Kuwabara T. Hsieh J. Nakashima K. Taira K. Gage F.H. Cell. 2004; 116: 779-793Abstract Full Text Full Text PDF PubMed Scopus (382) Google Scholar). These findings suggest that the NRSE site may mediate transcriptional activation or repression of neural genes depending on the cellular context. In this study we investigated the interplay between GR and NRSF/REST and examined whether both the N- and C-terminal repression domains inhibit the hormonal response. Unexpectedly, our results demonstrated that while full-length NRSF/REST or its C-terminal domain repressed gene induction, the N-terminal domain of NRSF/REST (N′NRSF) markedly elevated the hormonal response. The inductive activity of N′NRSF is not mediated by Sin3/HDAC, which has been previously shown to associate with N′NRSF, but rather by hBrm that is recruited to the promoter only in the concomitant presence of N′NRSF and GR. A similar inductive activity was exerted by REST4, a splice variant of NRSF/REST that is expressed in neural tissues and contains the N-, but not the C-terminal domain of NRSF/REST. These findings suggest that NRSF/REST might play a dual role in the hormonal control of glutamine synthetase expression: It represses glutamine synthetase induction in non-neural cells and enhances expression, via its splice variant, in neural tissues. Plasmids—The following expression vectors were described before: pNRSF (REEX1, Ref. 5Tapia-Ramirez J. Eggen B.J. Peral-Rubio M.J. Toledo-Aral J.J. Mandel G. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 1177-1182Crossref PubMed Scopus (113) Google Scholar), pC′NRSF (GAL4-R9, Ref. 26Thiel G. Lietz M. Cramer M. J. Biol. Chem. 1998; 273: 26891-26899Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar), pN′NRSF (GAL4-R1, Ref. 26Thiel G. Lietz M. Cramer M. J. Biol. Chem. 1998; 273: 26891-26899Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar) pREST4 (27Lietz M. Bach K. Thiel G. Eur. J. Neurosci. 2001; 14: 1303-1312Crossref PubMed Google Scholar), pGal4-PCAF (28Krumm A. Madisen L. Yang X.J. Goodman R. Nakatani Y. Groudine M. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 13501-13506Crossref PubMed Scopus (55) Google Scholar), pGal4-p300 (28Krumm A. Madisen L. Yang X.J. Goodman R. Nakatani Y. Groudine M. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 13501-13506Crossref PubMed Scopus (55) Google Scholar), pGR (29Miesfeld R. Rusconi S. Godowski P.J. Maler B.A. Okret S. Wikstrom A.C. Gustafsson J.A. Yamamoto K.R. Cell. 1986; 46: 389-399Abstract Full Text PDF PubMed Scopus (520) Google Scholar), pmycN′NRSF (27Lietz M. Bach K. Thiel G. Eur. J. Neurosci. 2001; 14: 1303-1312Crossref PubMed Google Scholar). The plasmids pGal4-hBrm and pVP-16-hBrm were constructed on the backbone of pBind and pAct, respectively (Promega). hBrm was amplified by PCR from phBrm (30Muchardt C. Yaniv M. EMBO J. 1993; 12: 4279-4290Crossref PubMed Scopus (522) Google Scholar) using the following oligonucleotide primers: CATCTAGAATGTCAACGCCCACAGAC and CAGGTACCCCAAGGAAAAAGGTCCAT. The plasmid Gal4HDAC2 was constructed on the backbone of pBind. HDAC2 was amplified by PCR from pFLAG-HDAC2 (31Laherty C.D. Yang W.M. Sun J.M. Davie J.R. Seto E. Eisenman R.N. Cell. 1997; 89: 349-356Abstract Full Text Full Text PDF PubMed Scopus (839) Google Scholar) using the following oligonucleotide primers: ATGGATCCTCATGGCGTACAGTCA and GCGACGCGTTGTCAAATTCAGG. The reporter plasmid pUAS was generated by introducing five binding sites for the yeast transcription factor Gal4 (5×UAS) upstream to the TK promoter into the previously described plasmid pBLCAT2 (32Luckow B. Schutz G. Nucleic Acids Res. 1987; 15: 5490Crossref PubMed Scopus (1401) Google Scholar). pUASGRE was generated by introducing the 5×UAS sequence upstream to the GRE (17 bp) into the previously described plasmid pGRE (pΔG46TCO, Ref. 33Ben-Dror I. Havazelet N. Vardimon L. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 1117-1121Crossref PubMed Scopus (33) Google Scholar). pUAS66GRE contains a fragment of 66 bp inserted between the UAS and GRE sequence in pUASGRE. The fragment was derived from a subclone of the previously described p2.4GS construct (1Avisar N. Shiftan L. Ben-Dror I. Havazelet N. Vardimon L. J. Biol. Chem. 1999; 274: 11399-11407Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar) and includes the sequence that spans between nucleotides 528 and 572 in the promoter of avian glutamine synthetase (GenBank™ accession number AF105022). pRepUASGRE was constructed by replacing the CMV promoter in the pCEP4 vector (Invitrogen) with the UASGRE-TK promoter and the adjacent luciferase gene derived from pUASGRE. The pNRSEGRE construct was described before (pNRSE2-GRE-TK, Ref. 1Avisar N. Shiftan L. Ben-Dror I. Havazelet N. Vardimon L. J. Biol. Chem. 1999; 274: 11399-11407Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar). All above plasmids were constructed to contain the reporter gene firefly luciferase. Transfection efficiency was controlled by using pRenilla (pTK-Renilla; Promega). The yeast reporter plasmid pyUASGRE-LacZ (CEN-ARS URA3) was generated in two steps: First, a DNA fragment containing the UASGRE sequences, derived from pUASGRE, was introduced 5′ to the Cyc1 promoter into the plasmid pLacZi (Clontech). Subsequently, the UASGRE-Cyc1 LacZ fragment was excised from the plasmid generated in the first step and used to replace the LacZ gene in the plasmid YcpLac33. The expression plasmid pyGR (2μ TRP1) consists of full-length rat GR cDNA expressed from the yeast GPD promoter (pG-N795, Ref. 34Yoshinaga S.K. Peterson C.L. Herskowitz I. Yamamoto K.R. Science. 1992; 258: 1598-1604Crossref PubMed Scopus (413) Google Scholar). To generate the pyN′NRSF (2μ LEU2) expression vector, the DNA fragment encoding amino acids 1–152 of NRSF/REST was derived from pN′NRSF and introduced in-frame to the Gal4 DBD in pY2 (35Sadowski I. Bell B. Broad P. Hollis M. Gene. 1992; 118: 137-141Crossref PubMed Scopus (201) Google Scholar). The pY2 plasmid was termed pyGal4DBD and served as control. In both plasmids the auxotrophic TRP1 marker was replaced by LEU2 and the ARS-Cen was exchanged with a 2μ fragment. (The cloning details can be obtained upon request.) Tissue and Cell Culture and Transfection Procedures—Retinal tissue was isolated under sterile conditions from eyes of chicken embryos (White Leghorn) at day 10 of embryonic development. The tissue was organ-cultured in Erlenmeyer flasks in Dulbecco's modified Eagle's medium (DMEM) with 10% fetal calf serum (FCS) on a gyratory shaker at 38 °C. Plasmid DNA was transfected into pieces of intact retinal tissue by electroporation, under conditions described before (33Ben-Dror I. Havazelet N. Vardimon L. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 1117-1121Crossref PubMed Scopus (33) Google Scholar). Following electroporation, retinas transfected in the same cuvette were placed in two Erlenmeyer flasks and cultured for 24 h in the absence or presence of 0.33 μg/ml cortisol. HeLa, COS7, and SW13 cells were grown in DMEM supplemented with 10% FCS. Neuro-2A cells were grown in MEM-Eagle supplemented with 10% fetal calf serum and 1 mm MEM-sodium pyruvate. For transfection, the cells were seeded in 6-well plates at 3 × 105 cells/plate and transfected after 24 h with DNA using the calcium phosphate method for COS7 and SW13 cells and jet-PEITM (Polyplus transfection) for HeLa and Neuro-2 cells according to the manufacturer's instructions. Transfection efficiency was controlled by cotransfection of pTK-Renilla. Total DNA amount was kept constant by adding empty vectors. Cells were cultured for 24 h in the absence or presence of 0.33 μg/ml cortisol (Sigma), with or without 100 ng/ml TSA (Sigma). Luciferase Firefly and Renilla activities were assayed with the Dual Luciferase kit (Promega) and recorded by a luminometer (LKB, Rockville, MD). Protein Preparation and Western Blotting—Whole cell extracts were prepared from COS7 or SW13 cells (transfected or untransfected) by sonication of the cells in passive lysis buffer (Promega) together with the recommended amount of Complete, a mixture of protease inhibitors (Roche Applied Sciences, Mannheim, Germany), followed by centrifugation at 20,000 × g for 15 min at 4 °C. Yeast cell extracts were prepared by alkaline lysis, as described (36Rabinovich E. Kerem A. Frohlich K.U. Diamant N. Bar-Nun S. Mol. Cell. Biol. 2002; 22: 626-634Crossref PubMed Scopus (468) Google Scholar). Protein amounts were determined using Bradford reagent (Bio-Rad). Protein samples were resolved on 10% SDS-PAGE gels, electroblotted onto nitrocellulose, and incubated with the following mouse antibodies (Abs) anti-Myc (9B11; Cell Signaling) or NRSF/REST (12C11, a generous gift from D. J. Anderson and co-workers (37Chen Z.F. Paquette A.J. Anderson D.J. Nat. Genet. 1998; 20: 136-142Crossref PubMed Scopus (396) Google Scholar)), rabbit Abs anti-Vph1 (10D-A7-B2; Molecular Probes, Inc), hBrm or Brg1 (N-19 or H-88, respectively; Santa Cruz Biotechnology) or goat Abs anti-HDAC2 (C-19; Santa Cruz Biotechnology). The corresponding horseradish peroxidase-conjugated secondary Abs (ICN Pharmaceuticals Inc. or Jackson ImmunoResearch Laboratories Inc.) were used, and the cross reactivity was visualized by the enhanced chemoluminescence (ECL) procedure (Pierce). Nuclear Proteins and Immunoprecipitation—Nuclear extracts were prepared from COS7 cells that were plated at a density of 2 × 106/10-cm plate and transfected with DNA. Nuclear extracts were prepared according to the method of Lee et al. (38Lee K.A. Bindereif A. Green M.R. Gene Anal. Tech. 1988; 5: 22-31Crossref PubMed Scopus (394) Google Scholar). Briefly, 1 ml of extraction buffer was added to each plate (10 mm Hepes, pH 7.9, 1.5 mm MgCl2, 10 mm KCl) together with the recommended amount of Complete. After three freeze-thaw cycles, cytoplasmic extracts were recovered by centrifugation at 15,000 × g for 5 min, and pellets were resuspended in buffer C (20 mm Hepes, pH 7.9, 1.5 mm MgCl2, 420 mm KCl, 0.2 mm EDTA, 25% glycerol) together with the recommended amount of Complete. Following a 30-min incubation at 4 °C, nuclear extracts were recovered by centrifugation at 15,000 × g for 5 min. For immunoprecipitation, nuclear extracts (0.5 mg) were precleared by incubation for 16 h at 4 °C with preimmune serum bound to protein A-Sepharose (Amersham Biosciences). Cleared extracts were immunoprecipitated with protein A-Sepharose bound to mouse anti-Myc antibodies (Abs) (9B11, Cell Signaling) overnight at 4 °C. Immunoprecipitates were washed twice with Buffer I (10 mm Tris, pH 8, 150 mm NaCl) and once with 20 mm Tris (pH 8) prior to the addition of sample buffer. The eluted proteins were analyzed by Western blotting. Yeast Cells—All yeast experiments were performed in Saccharomyces cerevisiae strain YJO (39Balasubramanian B. Morse R.H. Mol. Cell. Biol. 1999; 19: 2977-2985Crossref PubMed Scopus (21) Google Scholar). YJO: MATa; trp1; ura3-52; leu2-3,112; ade2-101; gal4Δ; gal80Δ; MEL1. The disrupted SIN3 locus was obtained from strain Y01695 (EUROSCARF). Y01695: MAT a; his3Δ1; leu2Δ0; met15Δ0; ura3Δ0; YOL004w:: kanMX4. For SIN3 replacement in YJO the disrupted SIN3 locus from Y01695 chromosomal DNA was amplified by PCR using the oligonucleotides TGTGTGCCAAAGCAGTGAACC (S-1) and TGGTGTTCCTACGGGAGATGG (S-2). The obtained 2.8-kb PCR product was transformed into YJO yeast strain allowing homologues recombination to occur. Yeast cells were incubated for 2 h at 30°C in YPD-rich medium for recovery and then streaked onto YPD plates containing G418. SIN3 disruption in the obtained transformants (termed ΔSin3) was confirmed by two sets of PCR reactions: 1) Primers S-1 and S-2, which generated a 2.8-kb fragment in ΔSin3 and a 5.8-kb fragment in wild-type cells. 2) Forward primer GGGTCAATCTTTAGCTTGGA upstream of the deletion and reverse primer CTGTCAAGGAGGGTATTCTG downstream of the KanMX4, a region unique to the disrupted gene (40Giaever G. Chu A.M. Ni L. Connelly C. Riles L. Veronneau S. Dow S. Lucau-Danila A. Anderson K. Andre B. Arkin A.P. Astromoff A. El-Bakkoury M. Bangham R. Benito R. Brachat S. Campanaro S. Curtiss M. Davis K. Deutschbauer A. Entian K.D. Flaherty P. Foury F. Garfinkel D.J. Gerstein M. Gotte D. Guldener U. Hegemann J.H. Hempel S. Herman Z. Jaramillo D.F. Kelly D.E. Kelly S.L. Kotter P. LaBonte D. Lamb D.C. Lan N. Liang H. Liao H. Liu L. Luo C. Lussier M. Mao R. Menard P. Ooi S.L. Revuelta J.L. Roberts C.J. Rose M. Ross-Macdonald P. Scherens B. Schimmack G. Shafer B. Shoemaker D.D. Sookhai-Mahadeo S. Storms R.K. Strathern J.N. Valle G. Voet M. Volckaert G. Wang C.Y. Ward T.R. Wilhelmy J. Winzeler E.A. Yang Y. Yen G. Youngman E. Yu K. Bussey H. Boeke J.D. Snyder M. Philippsen P. Davis R.W. Johnston M. Nature. 2002; 418: 387-391Crossref PubMed Scopus (3222) Google Scholar), which generated a PCR product in ΔSin3, but not in WT cells. Yeast cells were transformed with the use of a lithium acetate protocol (Clontech). Yeast cells were grown overnight in synthetic dropout medium supplemented with 2% glucose and amino acids as required, and then diluted in YPD to an optical density (OD600 nm) of 0.3. Cultures were incubated with or without 10–4m deoxycorticosterone (DOC, Sigma) and harvested after 5 h. β-Galactosidase activity was determined as previously described (41Paz I. Meunier J.R. Choder M. Gene. 1999; 236: 33-42Crossref PubMed Scopus (15) Google Scholar) and normalized to protein amount. The N-terminal Domain of NRSF/REST Enhances the Hormonal Response—NRSF/REST possesses two distinct repression domains that lie near the N and C termini of the molecule. To investigate the interplay between NRSF/REST and GR, we first examined whether both domains can silence the hormonal response. To minimize effects because of the action of endogenous NRSF/REST on transfected promoters, or exogenous NRSF/REST on cellular genes, we utilized expression vectors that contain Gal4-DBD fused to full-length NRSF/REST (NRSF) or to either the N (N′NRSF) or C (C′NRSF) terminal repression domains, and a reporter plasmid (UASGRE), which contains binding sites for GR (GRE) and Gal4 (UAS). Transfection experiments in HeLa cells revealed that, as expected, full-length NRSF/REST repressed the hormonal response. Similar results were obtained with C′NRSF. By contrast, N′NRSF not only failed to repress the hormonal response, but rather stimulated it markedly (Fig. 1A). The inductive activity of N′NRSF was dose-dependent, saturable (Fig. 1B) and required the presence of binding sites for both N′NRSF and GR. N′NRSF had no effect on promoter activity in the absence of a N′NRSF binding site (Fig. 1C), and repressed promoter activity in the absence of a binding site for GR (Fig. 1F). Overexpression of GR, by transfection of a GR expression vector, elevated the inductive activity in a dose-dependent manner and under all examined conditions N′NRSF could further stimulate the hormonal response (Fig. 1E). The N′NRSF binding site in the UAS-GRE construct is located 17-bp upstream of the GRE. In the glutamine synthetase gene, the NRSE sequence is located 66-bp upstream of the GRE (1Avisar N. Shiftan L. Ben-Dror I. Havazelet N. Vardimon L. J. Biol. Chem. 1999; 274: 11399-11407Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar). We examined whether replacement of the 17-bp sequence in the UAS-GRE construct with the 66-bp sequence influences the mode of action. Our results showed that here too NRSF and C′NRSF repressed, while N′NRSF activated the hormonal-dependent response (Fig. 1D). The inductive activity of N′NRSF could also be observed in explants of embryonic neural retina (Fig. 1G), and in COS-7 cells, which lack endogenous GR and were therefore cotransfected with a GR expression vector (Fig. 1H). Here too, C′NRSF repressed while N′NRSF elevated the hormonal response. Considering that transiently transfected DNA might not form proper chromatin structure, we decided to examine whether the activating function N′NRSF can also be observed on a replicating gene. Therefore, we cloned the UAS-GRE construct into pREP4 episomal vector that contains Epstein-Barr virus replication origin and encodes nuclear antigen EBNA-1. Cotransfection experiments clearly showed that chromatin formation did not hinder the ability of N′NRSF to enhance the hormonal response (Fig. 1I). The Inductive Activity of N′NRSF Is Not Mediated by the Sin3-HDAC Complex—Removal of acetyl groups from histones by HDACs frequently accompanies suppression of gene activity, and therefore HDACs are generally viewed as corepressors. There are now numerous examples, however, where HDACs appear to be required for gene activation (42Laribee R.N. Klemsz M.J. J. Immunol. 2001; 167: 5160-5166Crossref PubMed Scopus (58) Google Scholar, 43Wang X.Q. Alfaro M.L. Evans G.F. Zuckerman S.H. Biochem. Biophys. Res. Commun. 2002; 294: 66