Publication Information

{'id': 'https://openalex.org/W2037197890', 'doi': 'https://doi.org/10.1074/jbc.m004543200', 'title': 'Rabbit Serum Paraoxonase 3 (PON3) Is a High Density Lipoprotein-associated Lactonase and Protects Low Density Lipoprotein against Oxidation', 'display_name': 'Rabbit Serum Paraoxonase 3 (PON3) Is a High Density Lipoprotein-associated Lactonase and Protects Low Density Lipoprotein against Oxidation', 'publication_year': 2000, 'publication_date': '2000-10-01', 'ids': {'openalex': 'https://openalex.org/W2037197890', 'doi': 'https://doi.org/10.1074/jbc.m004543200', 'mag': '2037197890', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/10931838'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m004543200', 'pdf_url': 'http://www.jbc.org/article/S0021925820890292/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S0021925820890292/pdf', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5037631099', 'display_name': 'Dragomir Draganov', 'orcid': 'https://orcid.org/0000-0002-4271-9799'}, 'institutions': [{'id': 'https://openalex.org/I27837315', 'display_name': 'University of Michigan–Ann Arbor', 'ror': 'https://ror.org/00jmfr291', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I27837315']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Dragomir I. Draganov', 'raw_affiliation_strings': ['From the #N#‡Departments of Anesthesiology and Pharmacology, University of Michigan, Ann Arbor, Michigan 48109-0615 and the #N##N#§Laboratory for Experimental Toxicology, Military Medical Academy, Sofia 1606, Bulgaria#N#'], 'affiliations': [{'raw_affiliation_string': 'From the #N#‡Departments of Anesthesiology and Pharmacology, University of Michigan, Ann Arbor, Michigan 48109-0615 and the #N##N#§Laboratory for Experimental Toxicology, Military Medical Academy, Sofia 1606, Bulgaria#N#', 'institution_ids': ['https://openalex.org/I27837315']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5109099105', 'display_name': 'Philip L. Stetson', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I27837315', 'display_name': 'University of Michigan–Ann Arbor', 'ror': 'https://ror.org/00jmfr291', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I27837315']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Philip L. Stetson', 'raw_affiliation_strings': ['From the #N#‡Departments of Anesthesiology and Pharmacology, University of Michigan, Ann Arbor, Michigan 48109-0615 and the #N##N#§Laboratory for Experimental Toxicology, Military Medical Academy, Sofia 1606, Bulgaria#N#'], 'affiliations': [{'raw_affiliation_string': 'From the #N#‡Departments of Anesthesiology and Pharmacology, University of Michigan, Ann Arbor, Michigan 48109-0615 and the #N##N#§Laboratory for Experimental Toxicology, Military Medical Academy, Sofia 1606, Bulgaria#N#', 'institution_ids': ['https://openalex.org/I27837315']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5113612079', 'display_name': 'Catherine E. Watson', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I27837315', 'display_name': 'University of Michigan–Ann Arbor', 'ror': 'https://ror.org/00jmfr291', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I27837315']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Catherine E. Watson', 'raw_affiliation_strings': ['From the #N#‡Departments of Anesthesiology and Pharmacology, University of Michigan, Ann Arbor, Michigan 48109-0615 and the #N##N#§Laboratory for Experimental Toxicology, Military Medical Academy, Sofia 1606, Bulgaria#N#'], 'affiliations': [{'raw_affiliation_string': 'From the #N#‡Departments of Anesthesiology and Pharmacology, University of Michigan, Ann Arbor, Michigan 48109-0615 and the #N##N#§Laboratory for Experimental Toxicology, Military Medical Academy, Sofia 1606, Bulgaria#N#', 'institution_ids': ['https://openalex.org/I27837315']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5023308849', 'display_name': 'Scott S. Billecke', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I27837315', 'display_name': 'University of Michigan–Ann Arbor', 'ror': 'https://ror.org/00jmfr291', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I27837315']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Scott S. Billecke', 'raw_affiliation_strings': ['From the #N#‡Departments of Anesthesiology and Pharmacology, University of Michigan, Ann Arbor, Michigan 48109-0615 and the #N##N#§Laboratory for Experimental Toxicology, Military Medical Academy, Sofia 1606, Bulgaria#N#'], 'affiliations': [{'raw_affiliation_string': 'From the #N#‡Departments of Anesthesiology and Pharmacology, University of Michigan, Ann Arbor, Michigan 48109-0615 and the #N##N#§Laboratory for Experimental Toxicology, Military Medical Academy, Sofia 1606, Bulgaria#N#', 'institution_ids': ['https://openalex.org/I27837315']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5111470080', 'display_name': 'Bert N. La Du', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I27837315', 'display_name': 'University of Michigan–Ann Arbor', 'ror': 'https://ror.org/00jmfr291', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I27837315']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Bert N. La Du', 'raw_affiliation_strings': ['From the #N#‡Departments of Anesthesiology and Pharmacology, University of Michigan, Ann Arbor, Michigan 48109-0615 and the #N##N#§Laboratory for Experimental Toxicology, Military Medical Academy, Sofia 1606, Bulgaria#N#'], 'affiliations': [{'raw_affiliation_string': 'From the #N#‡Departments of Anesthesiology and Pharmacology, University of Michigan, Ann Arbor, Michigan 48109-0615 and the #N##N#§Laboratory for Experimental Toxicology, Military Medical Academy, Sofia 1606, Bulgaria#N#', 'institution_ids': ['https://openalex.org/I27837315']}]}], 'institution_assertions': [], 'countries_distinct_count': 1, 'institutions_distinct_count': 1, 'corresponding_author_ids': [], 'corresponding_institution_ids': [], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 9.442, 'has_fulltext': True, 'fulltext_origin': 'ngrams', 'cited_by_count': 334, 'citation_normalized_percentile': {'value': 0.999208, 'is_in_top_1_percent': True, 'is_in_top_10_percent': True}, 'cited_by_percentile_year': {'min': 98, 'max': 99}, 'biblio': {'volume': '275', 'issue': '43', 'first_page': '33435', 'last_page': '33442'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T12975', 'display_name': 'Paraoxonase enzyme and polymorphisms', 'score': 1.0, 'subfield': {'id': 'https://openalex.org/subfields/1308', 'display_name': 'Clinical Biochemistry'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, 'topics': [{'id': 'https://openalex.org/T12975', 'display_name': 'Paraoxonase enzyme and polymorphisms', 'score': 1.0, 'subfield': {'id': 'https://openalex.org/subfields/1308', 'display_name': 'Clinical Biochemistry'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T13992', 'display_name': 'Cynara cardunculus studies', 'score': 0.9684, 'subfield': {'id': 'https://openalex.org/subfields/1110', 'display_name': 'Plant Science'}, 'field': {'id': 'https://openalex.org/fields/11', 'display_name': 'Agricultural and Biological Sciences'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T13322', 'display_name': 'Hibiscus Plant Research Studies', 'score': 0.9179, 'subfield': {'id': 'https://openalex.org/subfields/3004', 'display_name': 'Pharmacology'}, 'field': {'id': 'https://openalex.org/fields/30', 'display_name': 'Pharmacology, Toxicology and Pharmaceutics'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/paraoxonase', 'display_name': 'Paraoxonase', 'score': 0.9619018}, {'id': 'https://openalex.org/keywords/arylesterase', 'display_name': 'Arylesterase', 'score': 0.8544478}, {'id': 'https://openalex.org/keywords/phenylacetate', 'display_name': 'Phenylacetate', 'score': 0.4498793}], 'concepts': [{'id': 'https://openalex.org/C2776509667', 'wikidata': 'https://www.wikidata.org/wiki/Q7135605', 'display_name': 'Paraoxonase', 'level': 3, 'score': 0.9619018}, {'id': 'https://openalex.org/C37501387', 'wikidata': 'https://www.wikidata.org/wiki/Q18030661', 'display_name': 'PON1', 'level': 4, 'score': 0.9451965}, {'id': 'https://openalex.org/C2781389560', 'wikidata': 'https://www.wikidata.org/wiki/Q4802704', 'display_name': 'Arylesterase', 'level': 5, 'score': 0.8544478}, {'id': 'https://openalex.org/C185592680', 'wikidata': 'https://www.wikidata.org/wiki/Q2329', 'display_name': 'Chemistry', 'level': 0, 'score': 0.5424368}, {'id': 'https://openalex.org/C55493867', 'wikidata': 'https://www.wikidata.org/wiki/Q7094', 'display_name': 'Biochemistry', 'level': 1, 'score': 0.52872306}, {'id': 'https://openalex.org/C2780072125', 'wikidata': 'https://www.wikidata.org/wiki/Q28350', 'display_name': 'Lipoprotein', 'level': 3, 'score': 0.49381575}, {'id': 'https://openalex.org/C2776897752', 'wikidata': 'https://www.wikidata.org/wiki/Q7181411', 'display_name': 'Phenylacetate', 'level': 2, 'score': 0.4498793}, {'id': 'https://openalex.org/C153911025', 'wikidata': 'https://www.wikidata.org/wiki/Q7202', 'display_name': 'Molecular biology', 'level': 1, 'score': 0.3941429}, {'id': 'https://openalex.org/C181199279', 'wikidata': 'https://www.wikidata.org/wiki/Q8047', 'display_name': 'Enzyme', 'level': 2, 'score': 0.39409485}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.33396465}, {'id': 'https://openalex.org/C104317684', 'wikidata': 'https://www.wikidata.org/wiki/Q7187', 'display_name': 'Gene', 'level': 2, 'score': 0.3057127}, {'id': 'https://openalex.org/C2778163477', 'wikidata': 'https://www.wikidata.org/wiki/Q43656', 'display_name': 'Cholesterol', 'level': 2, 'score': 0.18955508}, {'id': 'https://openalex.org/C135763542', 'wikidata': 'https://www.wikidata.org/wiki/Q106016', 'display_name': 'Genotype', 'level': 3, 'score': 0.0}], 'mesh': [], 'locations_count': 1, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m004543200', 'pdf_url': 'http://www.jbc.org/article/S0021925820890292/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m004543200', 'pdf_url': 'http://www.jbc.org/article/S0021925820890292/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 40, 'referenced_works': ['https://openalex.org/W1512559452', 'https://openalex.org/W1671050155', 'https://openalex.org/W1756585660', 'https://openalex.org/W1841006369', 'https://openalex.org/W1855997514', 'https://openalex.org/W1885786785', 'https://openalex.org/W1968731162', 'https://openalex.org/W1983174210', 'https://openalex.org/W1990051093', 'https://openalex.org/W1996096298', 'https://openalex.org/W1997181066', 'https://openalex.org/W2001296496', 'https://openalex.org/W2008895292', 'https://openalex.org/W2011944835', 'https://openalex.org/W2019514014', 'https://openalex.org/W2025348773', 'https://openalex.org/W2025679035', 'https://openalex.org/W2028461731', 'https://openalex.org/W2029664139', 'https://openalex.org/W2033661020', 'https://openalex.org/W2038187631', 'https://openalex.org/W2038228048', 'https://openalex.org/W2049698305', 'https://openalex.org/W2050601245', 'https://openalex.org/W2054847996', 'https://openalex.org/W2056551158', 'https://openalex.org/W2065901389', 'https://openalex.org/W2081128757', 'https://openalex.org/W2088720117', 'https://openalex.org/W2100837269', 'https://openalex.org/W2101154649', 'https://openalex.org/W2122751858', 'https://openalex.org/W2144634347', 'https://openalex.org/W2150545098', 'https://openalex.org/W2156092482', 'https://openalex.org/W2183864879', 'https://openalex.org/W2212323528', 'https://openalex.org/W2254923557', 'https://openalex.org/W2280516717', 'https://openalex.org/W2314225431'], 'related_works': ['https://openalex.org/W4389936476', 'https://openalex.org/W4382652497', 'https://openalex.org/W2752578853', 'https://openalex.org/W2182867842', 'https://openalex.org/W2169120520', 'https://openalex.org/W2148689715', 'https://openalex.org/W2148436597', 'https://openalex.org/W2105973465', 'https://openalex.org/W2075995559', 'https://openalex.org/W2009945655'], 'abstract_inverted_index': {'The': [0, 12, 132, 191, 203, 323, 417, 450, 918, 1321, 1469, 1583, 1630, 1873, 1943, 2041, 2159, 2205, 2229, 2247, 2255, 2335, 2352, 2366, 2502, 2564, 2626, 2671, 2687, 2730, 2767, 2888, 3163, 3254, 3304, 3394, 3472, 3526, 3542, 3550, 3594, 3659, 3742, 3852, 4000, 4092, 4221, 4256, 4348, 4426], 'paraoxonase': [1, 72, 192, 263, 391, 418, 1230], 'gene': [2, 18, 193, 209, 419, 458], 'family': [3, 194, 420, 1148], 'contains': [4, 195], 'at': [5, 196, 424, 946, 954, 980, 1330, 1343, 1606, 1685, 1761, 1878, 1898, 1949, 2184, 2450, 2684, 2735, 2801, 2851, 2868, 2883, 2907, 3149, 3157, 3251, 3266, 3367, 3455, 3467, 3973, 4229], 'least': [6, 197, 425, 2185], 'three': [7, 198, 426, 1039, 3527], 'members:': [8, 199, 427], 'PON1,': [9, 64, 200, 255, 428, 504, 938, 3423], 'PON2,': [10, 201, 939], 'andPON3.': [11, 202], 'physiological': [13, 204, 692, 805], 'roles': [14, 205, 919], 'of': [15, 43, 59, 89, 206, 234, 250, 280, 460, 524, 527, 541, 586, 589, 659, 694, 702, 715, 807, 920, 1042, 1168, 1247, 1256, 1277, 1305, 1475, 1485, 1573, 1637, 1656, 1707, 1884, 1952, 2052, 2093, 2107, 2112, 2120, 2137, 2141, 2272, 2307, 2377, 2439, 2493, 2499, 2512, 2524, 2566, 2662, 2668, 2673, 2689, 2701, 2769, 2832, 2837, 2842, 2911, 2919, 2935, 2991, 3242, 3256, 3321, 3396, 3420, 3429, 3494, 3506, 3553, 3565, 3582, 3597, 3612, 3663, 3674, 3724, 3745, 3850, 3874, 3885, 3916, 3934, 3949, 3980, 4008, 4198, 4216, 4236, 4264, 4428, 4437, 4443, 4447, 4469], 'the': [16, 26, 38, 54, 86, 136, 145, 169, 182, 207, 217, 229, 245, 277, 327, 336, 360, 373, 522, 671, 713, 947, 955, 961, 974, 981, 1038, 1146, 1154, 1169, 1173, 1203, 1210, 1222, 1244, 1248, 1273, 1334, 1401, 1473, 1481, 1556, 1721, 1766, 1771, 1845, 1864, 1908, 1915, 1936, 1950, 1959, 1978, 1985, 1992, 2002, 2053, 2062, 2079, 2094, 2108, 2130, 2135, 2138, 2156, 2168, 2194, 2200, 2242, 2270, 2338, 2375, 2380, 2388, 2445, 2509, 2513, 2517, 2522, 2680, 2751, 2770, 2920, 2947, 2950, 2954, 2959, 2978, 2984, 2992, 3068, 3161, 3169, 3217, 3238, 3315, 3319, 3326, 3330, 3334, 3348, 3426, 3492, 3519, 3554, 3560, 3566, 3578, 3598, 3605, 3613, 3664, 3671, 3675, 3721, 3735, 3739, 3746, 3837, 3848, 3859, 3862, 3917, 3921, 3935, 3950, 3954, 3974, 3987, 4005, 4009, 4063, 4096, 4199, 4203, 4217, 4230, 4243, 4261, 4265, 4319, 4352, 4435, 4444, 4466], 'corresponding': [17, 208], 'products': [19, 210, 802, 2043, 2980], 'are': [20, 211, 472, 838, 924, 930, 3546, 3895, 4056, 4090, 4177, 4312, 4346], 'still': [21, 212, 697], 'uncertain.': [22, 213], 'Until': [23, 214], 'recently,': [24, 215], 'only': [25, 216], 'serum': [27, 45, 151, 180, 218, 236, 342, 371, 508, 582, 1178, 1251, 1278, 1287, 1335, 1477, 1486, 1523, 1638, 2298, 3400, 3887, 4065, 4321], 'paraoxonase/arylesterase': [28, 219, 509], '(PON1)': [29, 220], 'had': [30, 221], 'been': [31, 222], 'purified': [32, 147, 223, 338, 578, 1184, 1249, 1695, 2240, 2357, 3477, 3665], 'and': [33, 41, 70, 99, 125, 141, 181, 224, 232, 261, 290, 316, 332, 372, 430, 471, 480, 520, 532, 580, 591, 599, 631, 650, 670, 922, 940, 950, 977, 1033, 1113, 1150, 1185, 1217, 1258, 1260, 1280, 1302, 1311, 1333, 1350, 1380, 1389, 1410, 1426, 1450, 1459, 1545, 1553, 1567, 1598, 1619, 1627, 1674, 1712, 1735, 1755, 1770, 1786, 1801, 1828, 1847, 1866, 1935, 2029, 2067, 2085, 2091, 2103, 2110, 2147, 2152, 2179, 2193, 2216, 2221, 2238, 2302, 2383, 2401, 2457, 2490, 2516, 2529, 2535, 2552, 2590, 2659, 2775, 2815, 2839, 2871, 2878, 2896, 2928, 2938, 2943, 2958, 2971, 3010, 3025, 3038, 3040, 3057, 3117, 3176, 3183, 3214, 3333, 3411, 3422, 3459, 3482, 3489, 3508, 3515, 3535, 3574, 3670, 3755, 3776, 3833, 3861, 3876, 3929, 3976, 4059, 4098, 4147, 4211, 4232, 4315, 4354, 4403, 4434], 'characterized.': [34, 225, 1186], 'Here': [35, 226], 'we': [36, 227, 575, 1151, 1214, 3570, 3841], 'report': [37, 171, 228, 362], 'purification,': [39, 230], 'cloning,': [40, 231], 'characterization': [42, 233], 'rabbit': [44, 122, 157, 235, 313, 348, 388, 581, 1177, 1211, 1227, 1250, 1267, 1286, 1476, 1972, 2113, 2206, 3399, 3567, 3722, 3886, 3988, 4064, 4244, 4320], 'PON3.': [46, 190, 237, 381, 1268, 1715, 3851], 'PON3': [47, 65, 90, 95, 119, 134, 152, 238, 256, 281, 286, 310, 325, 343, 431, 923, 941, 1034, 1212, 1252, 1279, 1478, 1794, 1848, 2008, 2114, 2181, 2207, 2354, 2386, 3243, 3397, 3421, 3568, 4011, 4267, 4429, 4448], 'is': [48, 153, 168, 239, 344, 359, 512, 673, 696, 1188, 1272, 3401, 3557, 3601, 3668, 3679, 3749], 'a': [49, 174, 240, 365, 461, 525, 587, 935, 1165, 1176, 1189, 1254, 1551, 1645, 1653, 1699, 1704, 1730, 1738, 1789, 1816, 1824, 1831, 1856, 2047, 2117, 2172, 2224, 2359, 2464, 2467, 2474, 2496, 2572, 2634, 2665, 2694, 2739, 2782, 2788, 2794, 2804, 2812, 2816, 2829, 2908, 2915, 3002, 3028, 3290, 3295, 3311, 3479, 3483, 3495, 3844, 3866, 3898, 3942, 3981, 4173, 4180, 4237, 4454], '40-kDa': [50, 241, 1190, 3496, 3555, 3966, 4222], 'protein': [51, 242, 1191, 1354, 1910, 3497, 3556, 3600, 3748, 3967, 4223], 'associated': [52, 243, 514], 'with': [53, 105, 114, 244, 296, 305, 515, 1145, 1221, 1263, 1285, 1405, 1527, 1555, 1569, 1587, 1652, 1689, 1703, 1717, 1752, 1765, 1774, 1830, 1852, 1940, 1991, 2171, 2269, 2293, 2304, 2393, 2575, 2787, 2811, 2914, 3012, 3228, 3449, 3461, 3491, 3503, 3559, 3577, 3604, 3752, 3871, 3904, 3986, 4004, 4062, 4186, 4242, 4260, 4318, 4449], 'high': [55, 246, 382, 395, 403, 516, 1434, 3060], 'density': [56, 162, 247, 353, 383, 386, 401, 517, 717, 3104], 'lipoprotein': [57, 163, 248, 354, 384, 387, 3069, 3257], 'fraction': [58, 249], 'serum.': [60, 149, 251, 340], 'In': [61, 252, 1172, 2463, 2828], 'contrast': [62, 253], 'to': [63, 184, 254, 375, 454, 841, 847, 1289, 1325, 1408, 1624, 1798, 1862, 1867, 1914, 2001, 2061, 2129, 2154, 2199, 2251, 2347, 2373, 2384, 2520, 2761, 2873, 3066, 3100, 3114, 3122, 3179, 3248, 3314, 3359, 3362, 3417, 3531, 3610, 3858, 4453, 4464], 'has': [66, 135, 257, 326, 1193, 3726, 3968, 4224], 'very': [67, 258, 399, 3102], 'limited': [68, 259], 'arylesterase': [69, 260, 1159, 1614, 1690, 3451], 'no': [71, 262], 'activities': [73, 264, 1162, 1632, 1693, 1769, 2392, 3175, 3432], 'but': [74, 108, 265, 299, 1639, 3437], 'rapidly': [75, 266], 'hydrolyzes': [76, 96, 267, 287], 'lactones': [77, 98, 104, 111, 268, 289, 295, 302, 590, 598, 1259, 1402, 1425, 2441, 2568, 2772, 2993], 'such': [78, 269], 'as': [79, 144, 270, 335, 507, 844, 846, 1394, 1777, 1921, 2310, 2363, 2405, 2703, 2963, 3072, 3185, 3211, 3337, 3364, 3843, 3908, 4190], 'statin': [80, 271, 2771], 'prodrugs': [81, 272], '(e.g.lovastatin).': [82, 273], 'These': [83, 274], 'differences': [84, 275], 'facilitated': [85, 276], 'complete': [87, 278, 2988], 'separation': [88, 279], 'from': [91, 120, 148, 164, 282, 311, 339, 355, 1181, 1360, 1366, 1385, 1397, 1399, 1417, 1431, 1442, 1456, 1464, 1720, 1815, 2034, 2099, 2183, 2693, 2983, 3047, 3318, 3398, 4430], 'PON1': [92, 158, 283, 349, 583, 643, 695, 808, 835, 885, 1046, 1182, 1288, 1487, 1626, 1711, 1846, 3245, 4066, 4322], 'during': [93, 284, 3329, 3518], 'purification.': [94, 285], 'aromatic': [97, 288, 528, 2440], '5-': [100, 291], 'or': [101, 112, 292, 303, 968, 1160, 1691, 1901, 3240, 3244], '6-member': [102, 293], 'ring': [103, 294], 'aliphatic': [106, 297], 'substituents': [107, 298], 'not': [109, 300, 1796, 3856, 3931, 4213], 'simple': [110, 301], 'those': [113, 304, 931, 4060, 4316], 'polar': [115, 306], 'substituents.': [116, 307], 'We': [117, 308, 1242, 3405], 'cloned': [118, 309, 1216, 2166, 3571], 'total': [121, 312, 2497, 2666, 3039], 'liver': [123, 314, 389, 1228, 1973], 'RNA': [124, 315, 1974], 'expressed': [126, 317, 1265], 'it': [127, 318, 1262], 'in': [128, 159, 178, 319, 350, 369, 421, 478, 484, 640, 1045, 1096, 1114, 1412, 1472, 1490, 1532, 1661, 1804, 1835, 1902, 2071, 2167, 2190, 2209, 2233, 2282, 2379, 2387, 2447, 2479, 2481, 2495, 2561, 2599, 2640, 2642, 2664, 2682, 2758, 2845, 2854, 2932, 2994, 3160, 3232, 3237, 3294, 3403, 3738, 3847, 3925, 3941, 3953, 3984, 4057, 4095, 4105, 4172, 4207, 4240, 4313, 4351, 4361, 4456], 'mammalian': [129, 179, 320, 370, 962], '293T/17': [130, 321, 2258], 'cells.': [131, 322], 'recombinant': [133, 324, 1266, 2339, 2353], 'same': [137, 328, 1557], 'apparent': [138, 329], 'molecular': [139, 330, 1355, 3504, 3740], 'mass': [140, 331], 'substrate': [142, 333, 1245, 2472, 2632, 2755, 2843, 2961], 'specificity': [143, 334, 1246], 'enzyme': [146, 177, 337, 368, 707, 1874, 2340, 2494, 2663, 2838, 3676], 'Rabbit': [150, 341, 1294, 1522], 'more': [154, 345, 839, 1887, 3970, 4226], 'efficient': [155, 346], 'than': [156, 347, 929, 1158, 1888], 'protecting': [160, 351], 'low': [161, 352, 385, 400, 716, 1352, 3103], 'copper-induced': [165, 356], 'oxidation.': [166, 357, 1293], 'This': [167, 358, 1187], 'first': [170, 183, 361, 374], 'that': [172, 363, 577, 705, 1153, 1192, 1200, 1218], 'identifies': [173, 364], 'second': [175, 366, 1700, 1722, 1817, 3480], 'PON': [176, 367, 451, 1147, 1170], 'describe': [185, 376], 'an': [186, 377, 851, 1194, 3977, 4233], 'enzymatic': [187, 378, 2731, 3174], 'activity': [188, 379, 652, 1156, 1615, 1621, 1719, 1885, 2368, 3452, 3464, 3474, 3854, 3903, 3924, 3936, 4185, 4206, 4218, 4468], 'for': [189, 380, 646, 795, 932, 1226, 1327, 1340, 1483, 1612, 1710, 1886, 2006, 2069, 2105, 2349, 2532, 2763, 2880, 2940, 2953, 2977, 3035, 3152, 3173, 3246, 3539, 3897, 3920, 4179, 4202], 'microsomal': [390, 1229], 'polyacrylamide': [392], 'gel': [393, 405, 1741, 1781, 3062, 3486, 3956], 'electrophoresis': [394, 1782], 'performance': [396, 404, 1435, 3061], 'liquid': [397, 1436], 'chromatography': [398, 407, 1437, 1636, 3064, 3428, 3444], 'lipoproteins': [402, 518, 718, 3105], 'filtration': [406, 1742, 3063, 3487, 3957], 'apolipoprotein': [408], 'platelet-activated': [409, 3615], 'factor': [410, 3616], 'acetyl': [411, 3617], 'hydrolase': [412, 3618], 'reverse': [413], 'transcriptase-polymerase': [414], 'chain': [415], 'reaction': [416, 2627], 'mammals': [422], 'includes': [423], 'PON2': [429, 921, 1032], '(1Primo-Parmo': [432, 486, 985, 1047, 2009, 4012, 4268], 'S.L.': [433, 487, 986, 1048, 2010, 2605, 2709, 4013, 4269], 'Sorenson': [434, 488, 751, 903, 987, 1014, 1049, 1076, 2011, 4014, 4041, 4270, 4297], 'R.C.': [435, 489, 904, 988, 1015, 1050, 1077, 2012, 4015, 4042, 4271, 4298], 'Teiber': [436, 490, 989, 1051, 2013, 4016, 4272], 'J.': [437, 491, 561, 612, 812, 824, 990, 1052, 1233, 1235, 2014, 2313, 3081, 3193, 3382, 3585, 3587, 3991, 3993, 4017, 4247, 4249, 4273], 'La': [438, 492, 608, 632, 680, 753, 815, 991, 1053, 1495, 1511, 2015, 2410, 2427, 2553, 2591, 2610, 2714, 4018, 4274], 'Du': [439, 493, 536, 609, 654, 681, 754, 816, 893, 992, 1004, 1054, 1066, 1496, 1512, 2016, 2411, 2428, 2611, 2715, 4019, 4031, 4275, 4287], 'B.N.': [440, 494, 537, 610, 655, 682, 755, 817, 894, 993, 1005, 1055, 1067, 1497, 1513, 2017, 2412, 2429, 2612, 2716, 4020, 4032, 4276, 4288], 'Genomics.': [441, 495, 994, 1056, 2018, 4021, 4277], '1996;': [442, 496, 566, 735, 995, 1057, 2019, 4022, 4278], '33:': [443, 497, 996, 1058, 2020, 4023, 4279], '498-507Crossref': [444, 498, 997, 1059, 2021, 4024, 4280], 'PubMed': [445, 499, 569, 738, 772, 790, 830, 880, 913, 998, 1024, 1060, 1086, 1108, 1136, 1239, 1930, 2022, 2621, 2725, 3090, 3133, 3202, 3284, 3391, 3591, 3654, 3715, 3769, 3813, 3828, 3997, 4025, 4051, 4085, 4142, 4160, 4253, 4281, 4307, 4341, 4398, 4416], 'Scopus': [446, 500, 570, 739, 773, 791, 831, 881, 914, 999, 1025, 1061, 1087, 1109, 1137, 1931, 2023, 2622, 2726, 3285, 3655, 3716, 3770, 3814, 3829, 4026, 4052, 4086, 4143, 4161, 4282, 4308, 4342, 4399, 4417], '(589)': [447, 501, 1000, 1062, 2024, 4027, 4283], 'Google': [448, 502, 572, 689, 741, 775, 793, 833, 883, 916, 1001, 1027, 1063, 1089, 1111, 1139, 1240, 1504, 1520, 1933, 2025, 2419, 2436, 2624, 2728, 3091, 3134, 3203, 3287, 3392, 3592, 3657, 3718, 3772, 3816, 3831, 3998, 4028, 4054, 4088, 4145, 4163, 4254, 4284, 4310, 4344, 4401, 4419], 'Scholar).': [449, 503, 573, 642, 690, 834, 884, 917, 1028, 1090, 1241, 1521, 2334, 2437, 2563, 2625, 2729, 3092, 3135, 3204, 3393, 3593, 3658, 3719, 3773, 3999, 4255], 'genes': [452], 'appear': [453], 'have': [455, 1215], 'arisen': [456], 'by': [457, 675, 711, 850, 1209, 1298, 1650, 1779, 1894, 1907, 2058, 2444, 2571, 2678, 2779, 3059, 3096, 3177, 3209, 3261, 3309, 3347, 3356, 3440, 3836], 'duplication': [459], 'common': [462, 1166], 'evolutionary': [463], 'precursor': [464, 3620, 4108, 4364], 'because': [465, 4442], 'they': [466], 'share': [467, 942, 970, 1141], 'considerable': [468, 1270], 'structural': [469, 1143], 'homology': [470, 1144], 'located': [473], 'adjacently': [474], 'on': [475, 481, 973, 1644, 1698, 1823, 2046, 2078, 2134, 2898, 3027, 3339, 3498, 3548, 3677, 3869], 'chromosome': [476, 482], '7': [477], 'humans': [479], '6': [483], 'mice': [485, 837], 'also': [505, 584, 886, 3345], 'known': [506, 2699], '(EC': [510], '3.1.8.1),': [511], 'closely': [513, 1220], '(HDL)1': [519], 'catalyzes': [521], 'hydrolysis': [523, 2525, 2565, 2690, 2768, 2990, 3408, 3414], 'variety': [526, 588], 'carboxylic': [529, 2955], 'acid': [530, 957, 983, 1206, 2461, 2514, 2537, 2674, 2956, 2979, 3580, 3662], 'esters': [531, 1257, 1427], 'several': [533, 676, 700], 'organophosphates': [534], '(2La': [535, 653], 'Kalow': [538, 656], 'W.': [539, 657], 'Pharmacogenetics': [540, 658], 'Drug': [542, 637, 660, 683, 1498, 1514, 2413, 2430, 2558, 2596], 'Metabolism.': [543, 661], 'Pergamon': [544, 662], 'Press,': [545, 663], 'Inc.,': [546, 664, 1967, 2288], 'New': [547, 665, 1316, 2277], 'York,': [548, 666], 'NY1992:': [549, 667], '51-91Google': [550, 668], 'Scholar,': [551, 618, 742, 776, 1002, 1064, 2420, 2601, 3817, 4029, 4285], '3Davies': [552], 'H.G.': [553], 'Richter': [554, 4069, 4325], 'R.J.': [555], 'Keifer': [556], 'M.': [557, 744, 778, 823, 861, 896, 900, 1007, 1011, 1069, 1073, 1117, 1119, 1123, 3276, 3371, 3375, 3377, 4034, 4038, 4290, 4294], 'Broomfield': [558, 2613, 2717], 'C.A.': [559, 2614, 2718], 'Sowalla': [560], 'Furlong': [562, 868, 4079, 4335], 'C.E.': [563, 869, 4080, 4336], 'Nat.': [564], 'Genet.': [565], '14:': [567], '334-336Crossref': [568], '(553)': [571], 'Recently,': [574], 'reported': [576, 1224], 'human': [579, 2007, 2063, 2259, 3614, 3666, 3754, 4010, 4106, 4266, 4362], 'hydrolyze': [585], 'cyclic': [592], 'carbonate': [593], 'esters,': [594], 'including': [595], 'naturally': [596], 'occurring': [597], 'pharmacological': [600], 'agents': [601], '(4Billecke': [602], 'S.': [603, 865, 898, 902, 1009, 1013, 1071, 1075, 1125, 1131, 3634, 3695, 3760, 3793, 3819, 4036, 4040, 4122, 4151, 4292, 4296, 4378, 4407], 'Draganov': [604], 'D.': [605], 'Counsell': [606], 'R.': [607, 752, 1101, 4070, 4072, 4326, 4328], 'FASEB': [611], '1999;': [613, 782, 910, 1021, 1083, 1236, 2618, 2722, 3588, 3766, 3825, 3994, 4048, 4157, 4250, 4304, 4413], '13': [614], '(Abstr.': [615], '764):': [616], 'A1013Google': [617], '5Billecke,': [619], 'S.,': [620, 2541, 2579], 'Draganov,': [621, 2542, 2580], 'D.,': [622, 2543, 2581], 'Counsell,': [623, 2544, 2582], 'R.,': [624, 2545, 2583], 'Stetson,': [625, 2546, 2584], 'P.,': [626, 2547, 2585], 'Watson,': [627, 2548, 2586], 'C.,': [628, 630, 2549, 2551, 2587, 2589], 'Hsu,': [629, 2550, 2588], 'Du,': [633, 2554, 2592], 'B.': [634, 725, 2555, 2593, 3632, 3693, 3791, 4120, 4376], 'N.': [635, 2556, 2594], '(2000)': [636, 2557, 2595], 'Metab.': [638, 684, 1499, 1515, 2414, 2431, 2559, 2597], 'Dispos.,28,': [639, 2560, 2598], 'press.Google': [641, 2562, 2600], 'requires': [644], 'Ca2+': [645], 'both': [647, 1613, 2191, 3431, 3753], 'its': [648, 1281, 1895, 2253, 4431, 4457], 'stability': [649], 'hydrolytic': [651, 4467], 'Scholar),': [669, 1934, 2026, 4164, 4420], 'latter': [672], 'stimulated': [674], 'phospholipids': [677, 798], '(6Kuo': [678, 1493, 2408], 'C.-L.': [679, 1494, 2409], 'Dispos.': [685, 1500, 1516, 2415, 2432], '1995;': [686, 827, 1501, 2416, 3651, 3712, 3810, 4139, 4395], '23:': [687, 1502, 2417], '935-944PubMed': [688, 1503, 2418], 'Any': [691], 'role': [693], 'speculative;': [698], 'however,': [699], 'lines': [701, 3323], 'evidence': [703], 'suggest': [704], 'this': [706, 1491, 1799], 'protects': [708, 887], 'against': [709, 888, 1292, 3140], 'atherosclerosis': [710, 848], 'preventing': [712], 'oxidation': [714, 3225, 3258, 3343], '(LDL)': [719], '(see': [720, 3572], 'Refs.': [721], '7Mackness': [722], 'M.I.': [723], 'Mackness': [724], 'Durrington': [726], 'P.N.': [727], 'Connelly': [728], 'P.W.': [729, 3649, 3710, 3808, 4137, 4393], 'Hegele': [730], 'R.A.': [731], 'Curr.': [732, 766], 'Opin.': [733, 767], 'Lipidol.': [734, 768], '7:': [736], '69-76Crossref': [737], '(424)': [740], '8Navab': [743], 'Hama': [745, 813, 864], 'S.Y.': [746, 814], 'Hough': [747], 'G.P.': [748], 'Hedrick': [749], 'C.C.': [750], 'Kobashigawa': [756], 'J.A.': [757, 761, 2609, 2713], 'Fonarow': [758], 'G.C.': [759], 'Berliner': [760, 811], 'Laks': [762], 'H.': [763, 3270, 3274, 3373, 3637, 3698, 3796, 4125, 4381], 'Fogelman': [764, 820, 872], 'A.M.': [765, 821, 873], '1998;': [769, 877, 1133], '9:': [770], '449-456Crossref': [771], '(76)': [774], '9Aviram': [777], 'Mol.': [779], 'Med.': [780], 'Today.': [781], '5:': [783], '381-386Abstract': [784], 'Full': [785, 787, 3087, 3199, 3388], 'Text': [786, 788, 3088, 3200, 3389], 'PDF': [789, 3089, 3201, 3390], '(109)': [792], 'Scholar': [794], 'reviews).': [796], 'Oxidized': [797], 'and/or': [799], 'their': [800, 2059, 3181, 3357], 'degradation/metabolic': [801], 'may': [803], 'be': [804, 1164], 'substrates': [806, 2394], '(10Watson': [809], 'A.D.': [810], 'Faull': [818], 'K.F.': [819], 'Navab': [822, 860, 899, 1010, 1072, 4037, 4293], 'Clin.': [825], 'Invest.': [826], '96:': [828], '2882-2891Crossref': [829], '(1047)': [832], 'knockout': [836], 'susceptible': [840], 'organophosphate': [842], 'toxicity': [843, 891], 'well': [845, 927], 'produced': [849], 'atherogenic': [852], 'diet': [853], '(11Shih': [854], 'D.M.': [855, 3628, 3689, 3787, 4116, 4372], 'Gu': [856], 'L.': [857], 'Xia': [858], 'Y.-R.': [859], 'Li': [862], 'W.-F.': [863], 'Castellani': [866], 'L.W.': [867, 3622, 3683, 3781, 4110, 4366], 'Costa': [870], 'L.G.': [871], 'Lusis': [874], 'A.J.': [875], 'Nature.': [876, 1926, 3650, 3711, 3809, 4138, 4394], '394:': [878], '284-287Crossref': [879], '(974)': [882], 'bacterial': [889], 'endotoxin-induced': [890], '(12La': [892], 'Aviram': [895, 1006, 1068, 4033, 4289], 'Billecke': [897, 1008, 1070, 4035, 4291], 'Primo-Parmo': [901, 1012, 1074, 2604, 2708, 4039, 4295], 'Standiford': [905, 1016, 1078, 4043, 4299], 'T.J.': [906, 1017, 1079, 4044, 4300], 'Chem.': [907, 1018, 1080, 2615, 2719, 4045, 4301], 'Biol.': [908, 1019, 1081, 2616, 2720, 4046, 4302], 'Interact.': [909, 1020, 1082, 2617, 2721, 4047, 4303], '119–120:': [911, 1022, 1084, 2619, 2723, 4049, 4305], '379-388Crossref': [912, 1023, 1085, 4050, 4306], '(178)': [915, 1026, 1088, 4053, 4309], 'much': [925], 'less': [926], 'understood': [928], 'PON1.': [933], 'Within': [934], 'given': [936, 3896, 4178], 'species,': [937], 'about': [943, 951], '70%': [944], 'identity': [945, 953, 972, 979, 3182], 'nucleotide': [948, 975, 1040], 'level': [949, 976, 984, 2376], '60%': [952], 'amino': [956, 982, 1198, 1205, 3562, 3579, 3661, 3730, 3971, 4002, 4103, 4168, 4227, 4258, 4359, 4424], 'level,': [958], 'whereas': [959], 'between': [960, 2508], 'species': [963], 'particular': [964], 'PONs': [965], '(1,': [966], '2,': [967], '3)': [969], '81–91%': [971], '79–90%': [978], '12La': [1003, 1065, 4030, 4286], 'To': [1029], 'date,': [1030], 'all': [1031, 2092, 3513, 3933, 4215], 'cDNAs': [1035], 'sequenced': [1036, 2189, 2250], 'lack': [1037], 'residues': [1041], 'codon': [1043], '106': [1044], 'Some': [1091], 'lactone': [1092, 2960], 'hydrolases': [1093], 'previously': [1094, 1488, 1923, 2705], 'described': [1095, 1922, 2311, 2364, 2406, 2704, 3073, 3186, 3212, 3909, 4191], 'bacteria': [1097], '(13Kanagasundaram': [1098], 'V.': [1099], 'Scopes': [1100], 'Biochim.': [1102], 'Biophys.': [1103], 'Acta.': [1104], '1992;': [1105], '1171:': [1106], '198-200Crossref': [1107], '(35)': [1110, 2623, 2727], 'Scholar)': [1112, 1140, 3288, 3832, 4055, 4089, 4146, 4311, 4345, 4402], 'fungi': [1115], '(14Kobayashi': [1116], 'Shinohara': [1118], 'Sakoh': [1120], 'C.': [1121, 3624, 3626, 3685, 3687, 3783, 3785, 4068, 4074, 4112, 4114, 4324, 4330, 4368, 4370], 'Kataoka': [1122], 'Shimizu': [1124], 'Proc.': [1126], 'Natl.': [1127], 'Acad.': [1128], 'Sci.': [1129], 'U.': [1130], 'A.': [1132, 1508, 2424, 3341], '95:': [1134], '12787-12792Crossref': [1135], '(61)': [1138], 'remarkable': [1142], 'members,': [1149], 'hypothesized': [1152], 'lactonase': [1155, 1179, 1620, 1692, 1718, 1768, 2367, 3463, 3473, 3853], 'rather': [1157], 'organophosphatase': [1161], 'could': [1163, 3733], 'feature': [1167], 'proteins.': [1171], 'present': [1174, 3952], 'study,': [1175], 'distinct': [1180], 'was': [1183, 1296, 1323, 1336, 1364, 1415, 1440, 1524, 1562, 1585, 1802, 1892, 1919, 1947, 1975, 1989, 2165, 2197, 2212, 2231, 2249, 2267, 2341, 2355, 2371, 2442, 2569, 2676, 2691, 2777, 2999, 3207, 3226, 3259, 3307, 3344, 3475, 3537, 3906, 4188, 4440], 'N-terminal': [1195, 1944, 3540, 3660, 3729], 'sequence': [1196, 1207, 1223, 2136, 2196, 3564, 3581, 3607, 3947, 4007, 4263], '(25': [1197, 1664], 'acids)': [1199], 'exactly': [1201], 'matches': [1202], 'deduced': [1204, 2057, 3561, 3606, 4006, 4262], 'predicted': [1208], 'cDNA': [1213, 2115, 2121, 3569], 'agrees': [1219], 'recently': [1225], '(MsPON)': [1231], '(15Ozols': [1232, 3584, 3990, 4246], 'Biochem.': [1234, 3586, 3992, 4248], '338:': [1237, 3589, 3995, 4251], '265-272Crossref': [1238, 3590, 3996, 4252], 'defined': [1243], 'over': [1253], 'number': [1255, 2203], 'confirmed': [1261], 'transiently': [1264], 'Of': [1269], 'interest': [1271], 'close': [1274], 'HDL': [1275, 3118], 'association': [1276, 4446], 'enhanced': [1282], 'ability': [1283], 'compared': [1284], 'protect': [1290], 'LDL': [1291, 3110, 3206, 3221], 'blood': [1295, 1322], 'collected': [1297, 1605, 1684, 1760, 1803, 2342, 3024], 'ear': [1299], 'vein': [1300], 'bleeding': [1301], 'cardiac': [1303], 'puncture': [1304], 'anesthetized': [1306], '(ketamine,': [1307], '40': [1308], 'mg/kg': [1309, 1314], 'intramuscular,': [1310], 'acetopromazine,': [1312], '1': [1313, 1542, 1580, 1594, 1607, 1669, 1747, 1756, 1810, 1841, 2470, 2487, 2500, 2630, 2648, 2669, 2833, 2860, 2881, 3019, 3146, 3435, 3446, 3522, 3758, 4149, 4405], 'intramuscular)': [1315], 'Zealand': [1317], 'White': [1318], 'female': [1319], 'rabbits.': [1320], 'allowed': [1324], 'clot': [1326], '30': [1328], 'min': [1329, 1342, 2882, 2966, 2969, 2973], 'room': [1331], 'temperature,': [1332], 'obtained': [1337, 1359, 1384, 1416, 1455, 2080, 2697], 'after': [1338, 1634, 2343, 2987], 'centrifugation': [1339], '15': [1341], '2,000': [1344], '×': [1345, 1746, 2823, 3007, 3927, 4209], 'g.': [1346], 'DEAE': [1347, 1646, 1701, 1723, 1818, 3441, 3481], 'Bio-Gel': [1348, 3003], 'A': [1349, 1565, 1826, 1871, 2320, 2922, 3839, 3878], 'SDS-PAGE': [1351, 1918, 3678, 3870], 'range': [1353], 'weight': [1356], 'standards': [1357], 'were': [1358, 1383, 1392, 1403, 1429, 1454, 1462, 1604, 1610, 1640, 1683, 1694, 1725, 1750, 1759, 1784, 1820, 1850, 1876, 1938, 2032, 2044, 2065, 2088, 2097, 2150, 2188, 2280, 2403, 2526, 2733, 2756, 2849, 2866, 2890, 2904, 2962, 2981, 3023, 3054, 3094, 3138, 3166, 3438, 3453, 3465, 3529, 3834, 4462], 'Bio-Rad.': [1361], 'Sephacryl': [1362, 1739, 3484, 3955], '200': [1363, 1740, 3485], 'purchased': [1365, 1393, 1430, 1441, 1463, 2033, 2098], 'Amersham': [1367], 'Pharmacia': [1368], 'Biotech.': [1369], 'Cibacron': [1370, 1528], 'Blue': [1371, 1529], '3GA-agarose': [1372], 'type': [1373], '3000,': [1374], 'concanavalin': [1375, 1790, 1825, 1870, 3838, 3877], 'A-Sepharose': [1376, 1791], '4B,': [1377], 'Tergitol': [1378, 1678, 1905], 'NP-10,': [1379], 'mevastatin': [1381], '(Compactin)': [1382], 'Sigma.': [1386], 'Lovastatin': [1387], '(Mevacor®)': [1388], 'simvastatin': [1390], '(Zocor®)': [1391], '20-mg': [1395], 'tablets': [1396], 'Merck,': [1398], 'which': [1400, 3352, 3732, 4439, 4461], 'extracted': [1404], 'chloroform,': [1406], 'evaporated': [1407], 'dryness,': [1409], 'redissolved': [1411], 'methanol.': [1413], 'ε-Caprolactone': [1414], 'Acros': [1418], 'Chimica': [1419], '(Fair': [1420], 'Lawn,': [1421], 'NJ).': [1422], 'All': [1423], 'other': [1424, 1775, 2567, 3501, 4450], 'used': [1428, 2104, 2153, 2268, 2372, 2519, 2757, 3215, 3406, 3842], 'Sigma-Aldrich.': [1432], 'Acetonitrile': [1433], '(HPLC)': [1438], 'grade': [1439], 'Mallinckrodt': [1443], 'Chemical': [1444], 'Works.': [1445], 'Glacial': [1446], 'acetic': [1447, 2924], 'acid,': [1448], 'methanol,': [1449], 'water': [1451], '(HPLC': [1452], 'grade)': [1453], 'Fisher.': [1457], 'Centicons': [1458], 'Centriprep': [1460], 'concentrators': [1461], 'Amicon,': [1465], 'Inc.': [1466], '(Beverly,': [1467], 'MA).': [1468], 'initial': [1470], 'steps': [1471, 3514], 'purification': [1474, 1484, 3395, 3419, 3520, 3849, 3900, 4182], 'essentially': [1479], 'followed': [1480, 2570, 2677, 3260], 'procedure': [1482], 'developed': [1489, 1586], 'laboratory': [1492], 'Scholar,16Gan': [1505], 'K.N.': [1506, 2422], 'Smolen': [1507, 2423], 'Eckerson': [1509, 2425], 'H.W.': [1510, 2426], '1991;': [1517, 2433, 3084, 3196, 4082, 4338], '19:': [1518, 2434], '100-106PubMed': [1519, 2435], 'mixed': [1525], 'batchwise': [1526], '3': [1530, 1533, 1889, 3969, 4225], 'GA-agarose': [1531], 'm': [1534, 2996], 'NaCl,': [1535, 3470], '50': [1536, 2482, 3013, 3507], 'mm': [1537, 1543, 1575, 1581, 1589, 1658, 1665, 1670, 1709, 1811, 1842, 2471, 2476, 2483, 2488, 2631, 2636, 2644, 2649, 2856, 2861, 3014, 3020, 3147, 3457, 3469], 'Tris/HCl': [1538, 1576, 1590, 1666, 2484, 2857], 'buffer': [1539, 1558, 1577, 1591, 1663, 1754, 1807, 1838, 1854, 1865, 2753], '(pH': [1540, 1578, 1592, 1667, 1808, 1839, 2485, 2646, 2858, 3017, 3143, 3235], '8.0),': [1541, 1579, 1593, 1668, 2486, 2647, 3018], 'CaCl2,': [1544, 1671, 2489, 2650], '5': [1546, 2826, 3249], 'μm': [1547, 3230], 'EDTA,': [1548], 'poured': [1549, 2891], 'into': [1550, 2223, 2892], 'column,': [1552, 1827, 3860], 'washed': [1554, 1851], 'until': [1559, 2900], 'theA': [1560], '280': [1561, 1899], 'below': [1563, 2096], '0.3': [1564], 'units': [1566], 'further': [1568, 1696, 3476], 'two': [1570, 1631], 'column': [1571, 1584, 1649, 1702, 1724, 1743, 1800, 1819, 2362, 2389, 2820, 3005, 3488, 3840, 3958], 'volumes': [1572], '25': [1574, 1588, 1805, 1836, 2736, 2852, 2855], 'CaCl2.': [1582, 1812, 1843, 2862, 3021], 'mmCaCl2,': [1595], '20%': [1596, 1672], 'glycerol,': [1597, 1673], '0.1%': [1599], 'sodium': [1600], 'deoxycholate;': [1601], '10-ml': [1602], 'fractions': [1603, 1758, 1814, 3053, 3137, 3165, 3460, 3864, 3918, 4200], 'ml/min.': [1608, 1687], 'Fractions': [1609, 1680, 1688, 1716, 1764, 3022, 3093, 3448], 'monitored': [1611, 2443], '(phenyl': [1616], 'acetate': [1617, 3413], 'hydrolysis)': [1618, 1623, 2370], '(lovastatin': [1622, 2369], 'localize': [1625, 2385], 'PON3,': [1628], 'respectively.': [1629, 2945, 3424, 3471], 'co-eluted': [1633, 3433], 'Blue-agarose': [1635, 2361, 3427], 'almost': [1641], 'completely': [1642], 'separated': [1643, 2045], 'anion': [1647, 3442], 'exchange': [1648, 3443], 'elution': [1651], 'linear': [1654], '300-ml': [1655], '0–175': [1657, 1713], 'NaCl': [1659, 1705, 3458], 'gradient': [1660, 1706, 1834], 'TCGT': [1662, 1753, 1853], '0.2%': [1675], 'non-ionic': [1676], 'detergent': [1677], 'NP-10).': [1679], '(5': [1681], 'ml)': [1682], '0.55': [1686], 'separately': [1697], '0–120': [1708], 'mmfor': [1714], 'pooled,': [1726, 1821], 'concentrated': [1727], '10-fold': [1728], 'using': [1729, 1855, 1958, 1977, 2116, 2241, 2358, 2698, 2738, 2781, 3043, 3289], '10-kDa': [1731], 'Centricon': [1732, 1859], 'ultrafiltration': [1733, 1860], 'unit,': [1734], 'loaded': [1736, 1822, 3000], 'onto': [1737, 3001], '(100': [1744, 2864, 2875], 'cm': [1745], 'cm).': [1748], 'Proteins': [1749], 'eluted': [1751, 1829, 2905, 3011, 3454, 3466], 'ml': [1757], '17': [1762], 'ml/h.': [1763], 'highest': [1767], 'lowest': [1772], 'contamination': [1773, 3873], 'proteins,': [1776, 4451], 'determined': [1778, 1893, 3346], 'SDS-polyacrylamide': [1780], '(PAGE),': [1783], 'pooled': [1785], 'passed': [1787], 'through': [1788, 3325, 3478, 3512], '4B': [1792], 'column.': [1793], 'did': [1795, 3855], 'bind': [1797, 3857], 'mmTris/HCl': [1806, 1837], '7.2),': [1809, 1840], 'PON1-containing': [1813], '0–200': [1832], 'mmα-d-mannopyranoside': [1833], 'Finally,': [1844], 'preparations': [1849, 1875], '50-kDa': [1857, 3599], 'cut-off': [1858], 'unit': [1861], 'adjust': [1863], 'remove': [1868], 'residual': [1869], 'fragments.': [1872], 'stored': [1877, 2897], '4': [1879, 3150, 3158], '°C': [1880, 2737, 2853, 3151, 3159], 'without': [1881], 'substantial': [1882], 'loss': [1883], 'months.': [1890], 'Protein': [1891, 1954, 1963], 'UV': [1896, 2448], 'absorption': [1897, 2510, 3327], 'nm': [1900, 2452, 2455, 2459, 3268, 3369], 'samples': [1903], 'containing': [1904, 2337, 2750, 3145], 'NP-10': [1906], 'BCA': [1909], 'assay': [1911, 2574, 2760], '(Pierce),': [1912], 'according': [1913, 2000, 2128], "manufacturer's": [1916, 2003, 2131], 'protocol.': [1917, 1987], 'performed': [1920, 1948, 1990, 2734], '(17Laemmli': [1924], 'U.K.': [1925], '1970;': [1927], '227:': [1928], '680-685Crossref': [1929], '(218068)': [1932], 'gels': [1937], 'stained': [1939], 'Coomassie': [1941], 'Blue.': [1942], 'peptide': [1945, 3544], 'sequencing': [1946, 2070], 'University': [1951], 'Michigan': [1953], 'Sequencing': [1955, 2074], 'Core': [1956, 2075], 'Laboratory': [1957, 2321], 'Model': [1960], '494': [1961], 'HT': [1962], 'Sequencer': [1964], '(Applied': [1965], 'Biosystems': [1966], 'Foster': [1968], 'City,': [1969], 'CA).': [1970, 3303], 'Total': [1971], 'isolated': [1976, 3164, 3208], 'RNeasy': [1979], 'Kit': [1980], '(Qiagen,': [1981], 'Valencia,': [1982], 'CA)': [1983, 2178], 'following': [1984], "supplier's": [1986], 'RT-PCR': [1988, 1995, 2042], 'Titan': [1993], 'One-tube': [1994], 'system': [1996], '(Roche': [1997, 2125, 3032], 'Molecular': [1998, 2126, 2318, 3033], 'Biochemicals)': [1999, 2127, 3034], 'instructions.': [2004, 2132], 'Primers': [2005], 'Px3–6': [2027], '(GGCATAGAACTGTTCTGGTCCAAGAACC)': [2028], 'Px3–17': [2030], '(GCTTCTGAAGATATTGATATACTCCCCAGTGGGC)': [2031], 'Midland': [2035], 'Certified': [2036], 'Reagent': [2037], 'Co.': [2038], '(Midland,': [2039], 'TX).': [2040], '1%': [2048], 'agarose': [2049], 'gel.': [2050], 'Bands': [2051], 'expected': [2054], 'size': [2055, 3673], '(as': [2056], 'similarity': [2060], 'PON3)': [2064], 'excised': [2066], 'submitted': [2068, 2198, 3538], 'our': [2072], 'DNA': [2073, 2309], 'Laboratory.': [2076], 'Based': [2077, 2133], 'sequence,': [2081], 'primers': [2082, 2095, 2140], 'RPx3–4': [2083], '(CTCATCTGGTGCAAAGTTTGG)': [2084], 'RPx3–1': [2086], '(ACAACAACGCTCTCTTGTAC)': [2087], 'designed': [2089, 2151], '(these': [2090], 'Life': [2100], 'Technologies,': [2101, 2219, 2300], 'Inc.)': [2102, 2220, 2301], 'amplification': [2106, 2119], '5′-': [2109], '3′-ends': [2111], '5′,3′-rapid': [2118], 'ends': [2122], '(RACE)': [2123], 'kit': [2124, 2175], 'new': [2139, 2893, 3943, 4174], 'these': [2142], 'fragments,': [2143], 'RPx3–5': [2144], '(ATCGGAA': [2145], 'TTCCATGGCGAAGCTCCTGC)': [2146], 'RPx3–6': [2148], '(AGGCCTCGAGCTGGAGACTAGAGCAC)': [2149], 'amplify': [2155], 'full-length': [2157], 'cDNA.': [2158], 'PCR': [2160], 'product': [2161], '(∼1200': [2162], 'base': [2163], 'pairs)': [2164], 'pCR®II': [2169, 2210], 'vector': [2170, 2211, 2227], 'TOPO®TA': [2173], 'cloning': [2174], '(Invitrogen,': [2176], 'Carlsbad,': [2177], 'sequenced.': [2180], 'clones': [2182], 'five': [2186], 'animals': [2187], 'directions,': [2192], 'consensus': [2195], 'GenBankTM': [2201], '(accession': [2202], 'AF220944).': [2204], 'clone': [2208], 'digested': [2213], 'withEcoRI': [2214], '(Promega)': [2215], 'XhoI': [2217], '(Life': [2218, 2299], 'ligated': [2222], 'pcDNA3.1(+)': [2225], 'expression': [2226], '(Invitrogen).': [2228], 'plasmid': [2230, 2244, 2308], 'propagated': [2232], 'Escherichia': [2234], 'coliTOP10': [2235], 'cells': [2236, 2346], '(Invitrogen)': [2237], 'then': [2239, 3155], 'Qiagen': [2243], 'maxi': [2245], 'kit.': [2246], 'insert': [2248], 'verify': [2252], 'structure.': [2254], 'highly': [2256], 'transfectable': [2257], 'embryonic': [2260], 'kidney': [2261], 'cell': [2262], 'line': [2263, 3313], '(ATCC': [2264], 'CRL': [2265], '11268)': [2266], 'permission': [2271], 'David': [2273], 'Baltimore': [2274], '(Rockefeller': [2275], 'University,': [2276], 'York).': [2278], 'Cells': [2279], 'grown': [2281], 'minimum': [2283], 'essential': [2284], 'medium': [2285, 2336, 2382], '(Celox': [2286], 'Laboratories,': [2287], 'St.': [2289], 'Paul,': [2290], 'MN)': [2291], 'supplemented': [2292], '10%': [2294], 'heat-deactivated': [2295], 'fetal': [2296], 'bovine': [2297, 2657], 'transfected': [2303, 2345], '10': [2305, 2840], 'μg': [2306], '(18Sambrook': [2312], 'Fritsch': [2314], 'E.F.': [2315], 'Maniatis': [2316], 'T.': [2317], 'Cloning:': [2319], 'Manual.': [2322], '2nd': [2323, 3524], 'Ed.': [2324], 'Cold': [2325, 2329], 'Spring': [2326, 2330], 'Harbor': [2327], 'Laboratory,': [2328], 'Harbor,': [2331], 'NY1989:': [2332], '16.30-16.37Google': [2333], 'allowing': [2344], 'grow': [2348], '4–5': [2350], 'days.': [2351, 3220], 'partly': [2356], 'small': [2360], 'above.': [2365], 'follow': [2374, 3418], 'expression/secretion': [2378], 'culture': [2381], 'fractions.': [2390], 'Esterase': [2391], 'phenyl': [2395, 3412], 'acetate,': [2396, 2400], 'S-phenyl': [2397], 'thioacetate,': [2398], 'α-naphtyl': [2399], 'paraoxon': [2402], 'measured': [2404, 3365, 3907, 4189], 'elsewhere': [2407, 3074], '16Gan': [2421], 'Hydrolysis': [2438], 'increase': [2446, 2681], 'absorbance': [2449, 2683], '270': [2451], '(dihydrocoumarin),': [2453], '274': [2454], '(2-coumaranone),': [2456], '290': [2458], '(homogentisic': [2460], 'lactone).': [2462], 'typical': [2465, 3899, 4181], 'experiment': [2466], 'cuvette': [2468, 2628], 'contained': [2469, 2629], '(from': [2473, 2633], '100': [2475, 2635, 3928, 4210], 'stock,': [2477], 'dissolved': [2478, 2639], 'methanol)': [2480, 2641], '5–20': [2491, 2660], 'μl': [2492, 2661, 2836, 2841], 'volume': [2498, 2667, 2831], 'ml.': [2501, 2670], 'molar': [2503], 'difference': [2504, 3737], 'extinction': [2505], 'coefficients': [2506, 2511], '(difference': [2507], 'formed': [2515, 2957], 'lactone)': [2518], 'calculate': [2521], 'rate': [2523, 2672, 2688, 2910], '1295,': [2527], '876,': [2528], '816': [2530], 'm−1cm−1': [2531], 'dihydrocoumarin,': [2533], '2-coumaranone,': [2534], 'homogentisic': [2536], 'lactone,': [2538], 'respectively': [2539], '(5Billecke,': [2540, 2578], 'colorimetric': [2573], 'phenol': [2576, 2654], 'red': [2577], '19Billecke': [2602], 'S.S.': [2603, 2707], 'Dunlop': [2606, 2710], 'C.S.': [2607, 2711], 'Dorn': [2608, 2712], '251-256Crossref': [2620, 2724], 'stock': [2637], 'solution,': [2638], '2': [2643], 'HEPES': [2645], '0.004%': [2651], '(106': [2652], 'μm)': [2653], 'red,': [2655], '0.005%': [2656], 'albumin,': [2658], 'production': [2675], 'monitoring': [2679, 3262], '422': [2685], 'nm.': [2686], 'derived': [2692], 'calibration': [2695], 'curve': [2696], 'amounts': [2700], 'HCl': [2702, 3016], '(19Billecke': [2706], 'assays': [2732], 'dual': [2740], 'beam': [2741], 'Cary': [2742], '3E': [2743], 'UV/visible': [2744], 'spectrophotometer': [2745], '(Varian,': [2746], 'Australia).': [2747], 'Reference': [2748], 'cuvettes': [2749], 'appropriate': [2752], 'plus': [2754], 'each': [2759, 3536], 'correct': [2762], 'any': [2764], 'spontaneous': [2765], 'hydrolysis.': [2766], '(mevastatin,': [2773], 'lovastatin,': [2774, 2942], 'simvastatin)': [2776], 'analyzed': [2778, 3026, 3058, 3167], 'HPLC': [2780, 2786, 2901], 'Beckman': [2783, 2817], 'System': [2784], 'Gold': [2785], 'model': [2789, 2795, 2805], '126': [2790], 'programmable': [2791], 'solvent': [2792], 'module,': [2793], '168': [2796], 'diode': [2797], 'array': [2798], 'detector': [2799], 'set': [2800], '238': [2802], 'nm,': [2803], '7125': [2806], 'rheodyne': [2807], 'manual': [2808], 'injector': [2809], 'valve': [2810], '20-μl': [2813], 'loop,': [2814], 'ODS': [2818], 'Ultrasphere': [2819], '(C18,': [2821], '250': [2822], '4.6': [2824], 'mm,': [2825], 'μm).': [2827], 'final': [2830, 3845], 'ml,': [2834], '10–200': [2835], 'solution': [2844], 'methanol': [2846], '(0.5': [2847], 'mg/ml)': [2848], 'incubated': [2850], '7.6),': [2859], 'Aliquots': [2863], 'μl)': [2865], 'removed': [2867], 'specified': [2869], 'times': [2870, 2952], 'added': [2872], 'acetonitrile': [2874], 'μl),': [2876], 'vortexed,': [2877], 'centrifuged': [2879], 'maximum': [2884], 'speed': [2885], '(Beckman': [2886], 'Microfuge).': [2887], 'supernatants': [2889], 'tubes,': [2894], 'capped,': [2895], 'ice': [2899], 'analysis.': [2902], 'Samples': [2903], 'isocratically': [2906], 'flow': [2909], '1.0': [2912], 'ml/min': [2913], 'mobile': [2916], 'phase': [2917, 3332], 'consisting': [2918], 'following:': [2921], '=': [2923, 2930, 3112, 3120, 3914, 4196], 'acid/acetonitrile/water': [2925], '(2:249:249,': [2926], 'v/v/v)': [2927], 'B': [2929], 'acetonitrile,': [2931], 'A/B': [2933], 'ratios': [2934], '50/50,': [2936], '45/55,': [2937], '40/60': [2939], 'mevastatin,': [2941], 'simvastatin,': [2944], 'Under': [2946], 'above': [2948, 3213], 'conditions': [2949], 'retention': [2951], 'follows:': [2964], '4.5/6.4': [2965], '(mevastatin),': [2967], '4.4/6.6': [2968], '(lovastatin),': [2970], '4.8/6.6': [2972], '(simvastatin).': [2974], 'Response': [2975], 'factors': [2976], 'calculated': [2982], 'peak': [2985, 3450, 3462], 'heights': [2986], 'alkaline': [2989], '0.02': [2995], 'NaOH.': [2997], 'Serum': [2998], 'A-15m': [3004], '(36': [3006], '1.8': [3008], 'cm)': [3009], 'Tris': [3015], 'Hitachi': [3029], '912': [3030], 'autoanalyzer': [3031], 'phospholipids,': [3036], 'triglycerides,': [3037], 'esterified': [3041], 'cholesterol': [3042, 3070], 'commercially': [3044], 'available': [3045], 'kits': [3046], 'Wako': [3048], 'Bioproducts': [3049], '(Richmond,': [3050], 'VA).': [3051], 'Representative': [3052], 'combined,': [3055], 'concentrated,': [3056], '(HPGC)': [3065], 'determine': [3067], 'distribution': [3071], '(20Kieft': [3075, 3187], 'K.A.': [3076, 3188], 'Bocan': [3077, 3189], 'T.M.': [3078, 3190, 3645, 3706, 3804, 4133, 4389], 'Krause': [3079, 3191], 'B.R.': [3080, 3192], 'Lipid': [3082, 3128, 3194, 3383], 'Res.': [3083, 3129, 3195, 3279, 3384], '32:': [3085, 3197], '859-866Abstract': [3086, 3198], 'prepared': [3095], 'sequential': [3097], 'flotation': [3098], 'ultracentrifugation': [3099, 3210], 'isolate': [3101], '(VLDL)': [3106], '(d': [3107, 3111, 3119], '<1.019': [3108], 'g/ml),': [3109, 3116], '1.019': [3113], '1.063': [3115, 3121], '1.2': [3123], 'g/ml)': [3124], '(21Hatch': [3125], 'F.T.': [3126], 'Adv.': [3127], '1968;': [3130], '6:': [3131, 3282], '1-68Crossref': [3132], 'Lipoprotein': [3136, 3342], 'dialyzed': [3139], 'phosphate-buffered': [3141, 3233], 'saline': [3142, 3234], '7.4)': [3144, 3236], 'CaCl2': [3148], '24': [3153], 'h,': [3154], 'kept': [3156], 'dark.': [3162], 'within': [3168, 3216], 'next': [3170, 3218, 3922, 4204], '3–4': [3171, 3219], 'days': [3172], 'HPGC': [3178], 'confirm': [3180], 'purity': [3184], 'Human': [3205], '(0.1': [3222], 'mg': [3223], 'protein/ml)': [3224], 'induced': [3227], '2–10': [3229], 'CuSO4': [3231], 'absence': [3239], 'presence': [3241], 'up': [3247], 'h': [3250], '37': [3252], '°C.': [3253], 'kinetics': [3255], 'conjugated': [3263], 'diene': [3264], 'formation': [3265], '234': [3267], '(22Esterbauer': [3269], 'Striegl': [3271], 'G.': [3272, 3630, 3691, 3789, 4118, 4374], 'Puhl': [3273], 'Rotheneder': [3275], 'Free': [3277], 'Radic.': [3278], 'Commun.': [3280], '1989;': [3281, 3385], '67-75Crossref': [3283], '(1716)': [3286], 'quartz': [3291], 'microtiter': [3292], 'plate': [3293, 3298], 'SPECTRAmax®': [3296], '190': [3297], 'reader': [3299], '(Molecular': [3300], 'Devices,': [3301], 'Sunnyvale,': [3302], 'lag': [3305, 3331], 'time': [3306], 'estimated': [3308, 3672], 'drawing': [3310], 'perpendicular': [3312], 'x': [3316], 'axis': [3317], 'intersection': [3320], 'straight': [3322], 'drawn': [3324], 'curves': [3328], 'propagation': [3335], 'phase,': [3336], 'illustrated': [3338], 'Fig.4': [3340], 'lipid': [3349, 3354], 'peroxides': [3350, 3355], 'test,': [3351], 'analyzes': [3353], 'capacity': [3358], 'convert': [3360], 'iodide': [3361], 'iodine,': [3363], 'photometrically': [3366], '365': [3368], '(23El-Saadani': [3370], 'Esterbauer': [3372], 'El-Sayed': [3374], 'Goher': [3376], 'Nassar': [3378], 'A.Y.': [3379], 'Jurgens': [3380], 'G.A.': [3381], '30:': [3386, 4083, 4339], '627-630Abstract': [3387], 'summarized': [3402], 'TableI.': [3404], 'lovastatin': [3407, 3905, 4187], '(lactonase': [3409], 'activity)': [3410, 3416], '(arylesterase': [3415], 'During': [3425], 'serum,': [3430], '(Fig.': [3434, 3445, 3521], 'A)': [3436], 'resolved': [3439, 3543], 'B).': [3447], '87': [3456], '105': [3468], 'correlated': [3490], 'intensity': [3493], 'SDS-PAGE.': [3499], 'Two': [3500], 'proteins': [3502, 3528, 3778, 3951, 4100, 4356], 'masses': [3505], '63': [3509], 'kDa': [3510, 3681], 'co-purified': [3511], 'became': [3516], 'enriched': [3517], 'C,': [3523, 3881], 'lane).': [3525], 'transferred': [3530], 'polyvinylidene': [3532], 'difluoride': [3533], 'membrane,': [3534], 'sequencing.': [3541], 'sequences': [3545], 'presented': [3547], 'TableII.': [3549], 'N': [3551, 3595, 3743], 'terminus': [3552, 3596, 3744], 'identical': [3558, 3576, 3603, 3751, 4001, 4061, 4102, 4257, 4317, 4358], 'acids': [3563, 3972, 4003, 4104, 4228, 4259, 4360], 'below)': [3573], '96%': [3575], 'MsPON': [3583, 3989, 4245], '73%': [3602], '(residues': [3608], '22': [3609], '36)': [3611], '(PAF-AH)': [3619], '(25Tjoelker': [3621, 3682, 3780, 4109, 4365], 'Wilder': [3623, 3684, 3782, 4111, 4367], 'Eberhardt': [3625, 3686, 3784, 4113, 4369], 'Staffarini': [3627, 3688, 3786, 4115, 4371], 'Dietsch': [3629, 3690, 3788, 4117, 4373], 'Schimpf': [3631, 3692, 3790, 4119, 4375], 'Hooper': [3633, 3694, 3792, 4121, 4377], 'Le': [3635, 3696, 3794, 4123, 4379], 'Trong': [3636, 3697, 3795, 4124, 4380], 'Cousens': [3638, 3699, 3797, 4126, 4382], 'L.S.': [3639, 3700, 3798, 4127, 4383], 'Zimmerman': [3640, 3701, 3799, 4128, 4384], 'G.A': [3641, 3702, 3800, 4129, 4385], 'Yamada': [3642, 3703, 3801, 4130, 4386], 'Y.': [3643, 3704, 3802, 4131, 4387], 'McIntyre': [3644, 3705, 3803, 4132, 4388], 'Prescott': [3646, 3707, 3805, 4134, 4390], 'S.M.': [3647, 3708, 3806, 4135, 4391], 'Gray': [3648, 3709, 3807, 4136, 4392], '374:': [3652, 3713, 3811, 4140, 4396], '549-553Crossref': [3653, 3714, 3812, 4141, 4397], '(487)': [3656, 3717, 3815, 4144, 4400], 'PAF-AH': [3667, 3725, 3775, 4107, 4363], 'Ile-42,': [3669], '44–45': [3680], 'Thus,': [3720], 'analogue': [3723], '20': [3727], 'additional': [3728], 'acids,': [3731], 'explain': [3734], 'observed': [3736], 'mass.': [3741], '63-kDa': [3747, 4099, 4355], '93%': [3750], 'mouse': [3756], 'vanin': [3757, 3777, 4148, 4404], '(26Granjeaud': [3759, 4150, 4406], 'Naquet': [3761, 3820, 4152, 4408], 'P.': [3762, 3821, 4153, 4409], 'Galland': [3763, 3822, 4154, 4410], 'F.': [3764, 3823, 4155, 4411], 'Immunogenetics.': [3765, 3824, 4156, 4412], '49:': [3767, 3826, 4158, 4414], '964-972Crossref': [3768, 3827, 4159, 4415], '(37)': [3771, 3830, 4162, 4418], 'Both': [3774], 'areN-glycosylated': [3779], '26Granjeaud': [3818], 'retained': [3835], 'step': [3846], 'washout': [3863], 'showed': [3865], 'single': [3867], 'band': [3868], 'trace': [3872], 'albumin': [3875], 'fragments': [3879], '(Fig.1': [3880], 'lanes': [3882], '3–5).Table': [3883], 'IPurification': [3884], 'PON3VolumeProteinActivitySpecific': [3888], 'activityYieldFold': [3889], 'purificationmlmgnmol/minnmol/min/mg%nSerum1557,0002,2940.331001Blue-agarose721088357.837241st': [3890], 'DEAE401032632.614992nd': [3891], 'DEAE217.132145.814139Sephacryl': [3892], '20060.7592125.84382Concanavalin': [3893], 'A60.2431130.01.4395Results': [3894], 'run.': [3901, 4183], 'Enzyme': [3902, 4184], 'under': [3910, 4192], '“Experimental': [3911, 4193], 'Procedures”;': [3912, 4194], 'yield': [3913, 4195], '(activity': [3915, 4197], 'combined': [3919, 4201], 'step)/(total': [3923, 4205], 'serum)': [3926, 4208], 'does': [3930, 4212], 'include': [3932, 4214], 'actually': [3937, 4219], 'recovered.': [3938, 4220], 'Open': [3939, 4170], 'table': [3940, 4171], 'tab': [3944, 4175], 'Table': [3945], 'IIN-terminal': [3946], 'analysis': [3948], 'poolMolecular': [3959], 'massSequenceProteinkDa40AKL': [3960], 'LL': [3961], 'LTLLG': [3962], 'AS': [3963], 'LAFVGE': [3964], 'RLLAFRNPON350LDWQDVNPVAHIKSSPAF-AH63XDTFIAAVYEHAVILPVanin-1The': [3965], 'beginning': [3975, 4231], 'arginine': [3978, 4234], 'instead': [3979, 4235], 'valine': [3982, 4238], '(italicized)': [3983, 4239], 'comparison': [3985, 4241], 'bold,': [4058, 4314], '(24Hassett': [4067, 4323], 'Humbert': [4071, 4327], 'Chapline': [4073, 4329], 'Crabb': [4075, 4331], 'J.W.': [4076, 4332], 'Omiecinski': [4077, 4333], 'C.J.': [4078, 4334], 'Biochemistry.': [4081, 4337], '10141-10149Crossref': [4084, 4340], '(213)': [4087, 4343], 'underlined.': [4091, 4347], 'bold': [4093, 4349], 'letters': [4094, 4350], '50-': [4097, 4353], 'represent': [4101, 4357], 'respectively;': [4165, 4421], 'X,': [4166, 4422], 'undetermined': [4167, 4423], 'acid.': [4169, 4425], 'Results': [4176], 'isolation': [4427], 'natural': [4432], 'environment': [4433], 'use': [4436], 'detergents,': [4438], 'unavoidable': [4441], 'tight': [4445], 'led': [4452], 'decrease': [4455], 'specific': [4458], 'activity.': [4459], 'Phospholipids,': [4460], 'shown': [4463], 'stimulate': [4465], 'pu': [4470]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W2037197890', 'counts_by_year': [{'year': 2024, 'cited_by_count': 7}, {'year': 2023, 'cited_by_count': 6}, {'year': 2022, 'cited_by_count': 6}, {'year': 2021, 'cited_by_count': 5}, {'year': 2020, 'cited_by_count': 7}, {'year': 2019, 'cited_by_count': 12}, {'year': 2018, 'cited_by_count': 9}, {'year': 2017, 'cited_by_count': 13}, {'year': 2016, 'cited_by_count': 13}, {'year': 2015, 'cited_by_count': 15}, {'year': 2014, 'cited_by_count': 16}, {'year': 2013, 'cited_by_count': 10}, {'year': 2012, 'cited_by_count': 26}], 'updated_date': '2025-01-05T14:51:49.677962', 'created_date': '2016-06-24'}