Publication Information

{'id': 'https://openalex.org/W2035425520', 'doi': 'https://doi.org/10.1074/jbc.m703512200', 'title': 'Amino Acid Transport in Schistosomes', 'display_name': 'Amino Acid Transport in Schistosomes', 'publication_year': 2007, 'publication_date': '2007-06-02', 'ids': {'openalex': 'https://openalex.org/W2035425520', 'doi': 'https://doi.org/10.1074/jbc.m703512200', 'mag': '2035425520', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/17545149'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m703512200', 'pdf_url': 'http://www.jbc.org/article/S0021925820781299/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S0021925820781299/pdf', 'any_repository_has_fulltext': True}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5080077337', 'display_name': 'Greice Krautz‐Peterson', 'orcid': 'https://orcid.org/0000-0002-8650-7894'}, 'institutions': [{'id': 'https://openalex.org/I121934306', 'display_name': 'Tufts University', 'ror': 'https://ror.org/05wvpxv85', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I121934306']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Greice Krautz-Peterson', 'raw_affiliation_strings': ['Molecular Helminthology Laboratory, Division of Infectious Diseases, Department of Biomedical Sciences, Tufts University, Cummings School of Veterinary Medicine, Grafton, Massachusetts 01536'], 'affiliations': [{'raw_affiliation_string': 'Molecular Helminthology Laboratory, Division of Infectious Diseases, Department of Biomedical Sciences, Tufts University, Cummings School of Veterinary Medicine, Grafton, Massachusetts 01536', 'institution_ids': ['https://openalex.org/I121934306']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5020798782', 'display_name': 'Simone M. R. Camargo', 'orcid': 'https://orcid.org/0000-0003-0091-7380'}, 'institutions': [{'id': 'https://openalex.org/I202697423', 'display_name': 'University of Zurich', 'ror': 'https://ror.org/02crff812', 'country_code': 'CH', 'type': 'education', 'lineage': ['https://openalex.org/I202697423']}], 'countries': ['CH'], 'is_corresponding': False, 'raw_author_name': 'Simone Camargo', 'raw_affiliation_strings': ['Institute of Physiology, University of Zürich, Winterthurerstrasse 190, CH-8057 Zürich, Switzerland'], 'affiliations': [{'raw_affiliation_string': 'Institute of Physiology, University of Zürich, Winterthurerstrasse 190, CH-8057 Zürich, Switzerland', 'institution_ids': ['https://openalex.org/I202697423']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5077290327', 'display_name': 'Katja Huggel', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I202697423', 'display_name': 'University of Zurich', 'ror': 'https://ror.org/02crff812', 'country_code': 'CH', 'type': 'education', 'lineage': ['https://openalex.org/I202697423']}], 'countries': ['CH'], 'is_corresponding': False, 'raw_author_name': 'Katja Huggel', 'raw_affiliation_strings': ['Institute of Physiology, University of Zürich, Winterthurerstrasse 190, CH-8057 Zürich, Switzerland'], 'affiliations': [{'raw_affiliation_string': 'Institute of Physiology, University of Zürich, Winterthurerstrasse 190, CH-8057 Zürich, Switzerland', 'institution_ids': ['https://openalex.org/I202697423']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5015311189', 'display_name': 'François Verrey', 'orcid': 'https://orcid.org/0000-0003-3250-9824'}, 'institutions': [{'id': 'https://openalex.org/I202697423', 'display_name': 'University of Zurich', 'ror': 'https://ror.org/02crff812', 'country_code': 'CH', 'type': 'education', 'lineage': ['https://openalex.org/I202697423']}], 'countries': ['CH'], 'is_corresponding': False, 'raw_author_name': 'François Verrey', 'raw_affiliation_strings': ['Institute of Physiology, University of Zürich, Winterthurerstrasse 190, CH-8057 Zürich, Switzerland'], 'affiliations': [{'raw_affiliation_string': 'Institute of Physiology, University of Zürich, Winterthurerstrasse 190, CH-8057 Zürich, Switzerland', 'institution_ids': ['https://openalex.org/I202697423']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5077133720', 'display_name': 'Charles B. Shoemaker', 'orcid': 'https://orcid.org/0000-0001-9738-1361'}, 'institutions': [{'id': 'https://openalex.org/I121934306', 'display_name': 'Tufts University', 'ror': 'https://ror.org/05wvpxv85', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I121934306']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Charles B. Shoemaker', 'raw_affiliation_strings': ['Molecular Helminthology Laboratory, Division of Infectious Diseases, Department of Biomedical Sciences, Tufts University, Cummings School of Veterinary Medicine, Grafton, Massachusetts 01536'], 'affiliations': [{'raw_affiliation_string': 'Molecular Helminthology Laboratory, Division of Infectious Diseases, Department of Biomedical Sciences, Tufts University, Cummings School of Veterinary Medicine, Grafton, Massachusetts 01536', 'institution_ids': ['https://openalex.org/I121934306']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5051992962', 'display_name': 'Patrick J. Skelly', 'orcid': 'https://orcid.org/0000-0002-5733-0524'}, 'institutions': [{'id': 'https://openalex.org/I121934306', 'display_name': 'Tufts University', 'ror': 'https://ror.org/05wvpxv85', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I121934306']}], 'countries': ['US'], 'is_corresponding': True, 'raw_author_name': 'Patrick J. Skelly', 'raw_affiliation_strings': ['Molecular Helminthology Laboratory, Division of Infectious Diseases, Department of Biomedical Sciences, Tufts University, Cummings School of Veterinary Medicine, Grafton, Massachusetts 01536'], 'affiliations': [{'raw_affiliation_string': 'Molecular Helminthology Laboratory, Division of Infectious Diseases, Department of Biomedical Sciences, Tufts University, Cummings School of Veterinary Medicine, Grafton, Massachusetts 01536', 'institution_ids': ['https://openalex.org/I121934306']}]}], 'institution_assertions': [], 'countries_distinct_count': 2, 'institutions_distinct_count': 2, 'corresponding_author_ids': ['https://openalex.org/A5051992962'], 'corresponding_institution_ids': ['https://openalex.org/I121934306'], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 1.457, 'has_fulltext': True, 'fulltext_origin': 'pdf', 'cited_by_count': 44, 'citation_normalized_percentile': {'value': 0.824679, 'is_in_top_1_percent': False, 'is_in_top_10_percent': False}, 'cited_by_percentile_year': {'min': 93, 'max': 94}, 'biblio': {'volume': '282', 'issue': '30', 'first_page': '21767', 'last_page': '21775'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T12770', 'display_name': 'Amino Acid Enzymes and Metabolism', 'score': 0.9999, 'subfield': {'id': 'https://openalex.org/subfields/1303', 'display_name': 'Biochemistry'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, 'topics': [{'id': 'https://openalex.org/T12770', 'display_name': 'Amino Acid Enzymes and Metabolism', 'score': 0.9999, 'subfield': {'id': 'https://openalex.org/subfields/1303', 'display_name': 'Biochemistry'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T11027', 'display_name': 'Metabolism and Genetic Disorders', 'score': 0.9979, 'subfield': {'id': 'https://openalex.org/subfields/1308', 'display_name': 'Clinical Biochemistry'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T12229', 'display_name': 'Pharmacological Effects and Toxicity Studies', 'score': 0.9947, 'subfield': {'id': 'https://openalex.org/subfields/2735', 'display_name': 'Pediatrics, Perinatology and Child Health'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}], 'keywords': [], 'concepts': [{'id': 'https://openalex.org/C185592680', 'wikidata': 'https://www.wikidata.org/wiki/Q2329', 'display_name': 'Chemistry', 'level': 0, 'score': 0.5268465}, {'id': 'https://openalex.org/C515207424', 'wikidata': 'https://www.wikidata.org/wiki/Q8066', 'display_name': 'Amino acid', 'level': 2, 'score': 0.4603178}, {'id': 'https://openalex.org/C55493867', 'wikidata': 'https://www.wikidata.org/wiki/Q7094', 'display_name': 'Biochemistry', 'level': 1, 'score': 0.36725634}], 'mesh': [{'descriptor_ui': 'D000596', 'descriptor_name': 'Amino Acids', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D027301', 'descriptor_name': 'Fusion Regulatory Protein 1, Light Chains', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': True}, {'descriptor_ui': 'D027301', 'descriptor_name': 'Fusion Regulatory Protein 1, Light Chains', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D015801', 'descriptor_name': 'Helminth Proteins', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': True}, {'descriptor_ui': 'D015801', 'descriptor_name': 'Helminth Proteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D012550', 'descriptor_name': 'Schistosoma mansoni', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D000596', 'descriptor_name': 'Amino Acids', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D000818', 'descriptor_name': 'Animals', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D001692', 'descriptor_name': 'Biological Transport', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D001700', 'descriptor_name': 'Biomphalaria', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D001700', 'descriptor_name': 'Biomphalaria', 'qualifier_ui': 'Q000469', 'qualifier_name': 'parasitology', 'is_major_topic': False}, {'descriptor_ui': 'D018509', 'descriptor_name': 'DNA, Helminth', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D018509', 'descriptor_name': 'DNA, Helminth', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D020224', 'descriptor_name': 'Expressed Sequence Tags', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D027301', 'descriptor_name': 'Fusion Regulatory Protein 1, Light Chains', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D015801', 'descriptor_name': 'Helminth Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D009865', 'descriptor_name': 'Oocytes', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D009865', 'descriptor_name': 'Oocytes', 'qualifier_ui': 'Q000502', 'qualifier_name': 'physiology', 'is_major_topic': False}, {'descriptor_ui': 'D016133', 'descriptor_name': 'Polymerase Chain Reaction', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D012549', 'descriptor_name': 'Schistosoma japonicum', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D012549', 'descriptor_name': 'Schistosoma japonicum', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D012549', 'descriptor_name': 'Schistosoma japonicum', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D012550', 'descriptor_name': 'Schistosoma mansoni', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D012550', 'descriptor_name': 'Schistosoma mansoni', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D014162', 'descriptor_name': 'Transfection', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D014981', 'descriptor_name': 'Xenopus', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}], 'locations_count': 3, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m703512200', 'pdf_url': 'http://www.jbc.org/article/S0021925820781299/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': True, 'landing_page_url': 'https://www.zora.uzh.ch/id/eprint/14336/39/Krautz_2007V.pdf', 'pdf_url': 'https://www.zora.uzh.ch/id/eprint/14336/39/Krautz_2007V.pdf', 'source': {'id': 'https://openalex.org/S4306401281', 'display_name': 'Zurich Open Repository and Archive (University of Zurich)', 'issn_l': None, 'issn': None, 'is_oa': True, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I202697423', 'host_organization_name': 'University of Zurich', 'host_organization_lineage': ['https://openalex.org/I202697423'], 'host_organization_lineage_names': ['University of Zurich'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': 'acceptedVersion', 'is_accepted': True, 'is_published': False}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/17545149', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m703512200', 'pdf_url': 'http://www.jbc.org/article/S0021925820781299/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [{'id': 'https://metadata.un.org/sdg/3', 'display_name': 'Good health and well-being', 'score': 0.6}], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 41, 'referenced_works': ['https://openalex.org/W1593109390', 'https://openalex.org/W1599900616', 'https://openalex.org/W1613701641', 'https://openalex.org/W1799412247', 'https://openalex.org/W1969895363', 'https://openalex.org/W1974719543', 'https://openalex.org/W1978648837', 'https://openalex.org/W1984044473', 'https://openalex.org/W1990861050', 'https://openalex.org/W1996131891', 'https://openalex.org/W1997267426', 'https://openalex.org/W2004788977', 'https://openalex.org/W2006169459', 'https://openalex.org/W2025145426', 'https://openalex.org/W2026978183', 'https://openalex.org/W2033384299', 'https://openalex.org/W2040439993', 'https://openalex.org/W2055043387', 'https://openalex.org/W2055793157', 'https://openalex.org/W2058845714', 'https://openalex.org/W2059964311', 'https://openalex.org/W2064159550', 'https://openalex.org/W2072266447', 'https://openalex.org/W2072267457', 'https://openalex.org/W2084717328', 'https://openalex.org/W2086562923', 'https://openalex.org/W2089236362', 'https://openalex.org/W2107277218', 'https://openalex.org/W2117023388', 'https://openalex.org/W2121704271', 'https://openalex.org/W2136451615', 'https://openalex.org/W2139428235', 'https://openalex.org/W2144325627', 'https://openalex.org/W2167965719', 'https://openalex.org/W2170630666', 'https://openalex.org/W2317964084', 'https://openalex.org/W2323580363', 'https://openalex.org/W2332557213', 'https://openalex.org/W2474428299', 'https://openalex.org/W4324114039', 'https://openalex.org/W610062301'], 'related_works': ['https://openalex.org/W4391375266', 'https://openalex.org/W4387497383', 'https://openalex.org/W2948807893', 'https://openalex.org/W2778153218', 'https://openalex.org/W2748952813', 'https://openalex.org/W2527526854', 'https://openalex.org/W2078814861', 'https://openalex.org/W1986764834', 'https://openalex.org/W1976181487', 'https://openalex.org/W1531601525'], 'abstract_inverted_index': {'Schistosomes': [0, 246, 492, 555, 1022], 'are': [1, 242, 247, 488, 493, 532, 616, 1771, 2475, 3646, 3669, 3797, 3843, 3860, 3874, 4160, 4170, 4181], 'human': [2, 248, 1337, 1645, 1765, 3997, 4225], 'parasitic': [3, 249, 494], 'flatworms': [4, 250], 'that': [5, 67, 140, 159, 172, 207, 221, 233, 251, 313, 386, 405, 418, 453, 467, 479, 496, 527, 850, 1530, 1543, 1568, 1598, 1898, 2113, 2158, 3501, 3583, 4089, 4233], 'constitute': [6, 252], 'an': [7, 253, 738, 1446, 1545, 1720, 1900, 1957, 2920, 3317, 3773], 'important': [8, 254, 1644], 'public': [9, 255], 'health': [10, 256], 'problem': [11, 257], 'globally.': [12, 258], 'Adult': [13, 259, 1725], 'parasites': [14, 260, 1726, 3058, 3329], 'live': [15, 261], 'in': [16, 55, 141, 145, 176, 262, 301, 387, 391, 422, 564, 647, 749, 913, 928, 949, 982, 1099, 1177, 1292, 1299, 1551, 1692, 1719, 1748, 1773, 2255, 2261, 2387, 2420, 2522, 2562, 2578, 2600, 2740, 2778, 2781, 2809, 2833, 3006, 3065, 3078, 3088, 3113, 3127, 3154, 3177, 3207, 3289, 3316, 3458, 3534, 3620, 3748, 3840, 3891, 3916, 3988, 4040, 4095, 4107, 4178, 4205, 4213, 4218], 'the': [17, 46, 62, 77, 205, 222, 227, 239, 263, 292, 308, 323, 451, 468, 473, 485, 573, 582, 601, 617, 641, 656, 660, 669, 750, 763, 779, 794, 798, 853, 901, 905, 914, 926, 929, 983, 1039, 1100, 1104, 1110, 1116, 1119, 1182, 1336, 1368, 1371, 1439, 1522, 1538, 1596, 1603, 1613, 1621, 1640, 1764, 1786, 1792, 1907, 1914, 1919, 1930, 1942, 1946, 1949, 1953, 1966, 1972, 1975, 2014, 2029, 2042, 2049, 2059, 2066, 2074, 2122, 2127, 2137, 2145, 2162, 2177, 2200, 2236, 2264, 2322, 2335, 2347, 2369, 2456, 2470, 2516, 2637, 2790, 2797, 2978, 2990, 3104, 3120, 3123, 3138, 3158, 3163, 3183, 3331, 3336, 3392, 3405, 3411, 3420, 3433, 3477, 3502, 3510, 3529, 3540, 3560, 3564, 3609, 3615, 3650, 3706, 3738, 3756, 3814, 3833, 3871, 3886, 3904, 3910, 3989, 3996, 4026, 4046, 4052, 4087, 4090, 4096, 4100, 4108, 4143, 4150, 4185, 4188, 4224], 'bloodstream': [18, 264], 'where': [19, 265, 662, 1106], 'they': [20, 266, 651, 672], 'import': [21, 127, 267, 373, 674, 897], 'nutrients': [22, 268, 675, 899, 927], 'such': [23, 269], 'as': [24, 199, 270, 445, 590, 787, 933, 1378, 1380, 1430, 1445, 1486, 1529, 1542, 1670, 1741, 2287, 2389, 2427, 2477, 2506, 2546, 2868, 2929, 3030, 3844, 3992], 'amino': [25, 34, 271, 280, 1165, 1328, 1373, 1447, 1482, 1488, 1535, 1623, 2416, 2761, 2791, 3515, 3720, 4029], 'acids': [26, 272, 1374, 1536, 2417, 3721], 'across': [27, 273, 677, 900, 1537, 3248], 'their': [28, 274, 678, 1030], 'body': [29, 275, 679, 796], 'surface': [30, 276, 680, 903, 1040], '(the': [31, 277], 'tegument).': [32, 278], 'One': [33, 279, 1932, 2374, 2912], 'acid': [35, 281, 1166, 1329, 1448, 1483, 1489, 1624, 2762, 3516, 4030, 4208], 'transporter,': [36, 282], 'Schistosome': [37, 283, 975], 'Permease': [38, 284, 1169], '1': [39, 285, 1170, 2539, 2582, 2661, 2708, 2729, 3169, 3198, 3340, 3589], 'light': [40, 286, 1171, 1216, 1245, 3984], 'chain,': [41, 287, 1172], 'SPRM1lc,': [42, 288], 'a': [43, 58, 107, 111, 117, 152, 289, 304, 353, 357, 363, 398, 529, 663, 753, 759, 788, 1024, 1300, 1431, 1563, 1599, 1609, 1895, 1984, 2104, 2601, 2860, 2969, 2998, 3079, 3098, 3114, 3231, 3466, 3507, 3523, 3575, 3724, 3731, 3864, 3882, 3898, 3955], 'member': [44, 60, 290, 306, 3508, 3580], 'of': [45, 49, 61, 65, 76, 79, 291, 295, 307, 311, 322, 325, 535, 575, 605, 613, 665, 752, 797, 898, 907, 973, 987, 1029, 1041, 1103, 1112, 1185, 1195, 1224, 1302, 1370, 1524, 1531, 1534, 1544, 1554, 1602, 1651, 1722, 1791, 1941, 1945, 1952, 1965, 1971, 1974, 2046, 2057, 2161, 2253, 2482, 2493, 2502, 2519, 2541, 2568, 2647, 2663, 2796, 2830, 3004, 3082, 3140, 3241, 3253, 3319, 3342, 3371, 3449, 3509, 3514, 3544, 3555, 3563, 3567, 3608, 3614, 3630, 3671, 3697, 3705, 3727, 3733, 3737, 3755, 3832, 3855, 3903, 3913, 4025, 4045, 4142, 4155, 4168, 4187, 4203], 'glycoprotein-associated': [47, 293, 1183, 1193, 1222], 'family': [48, 64, 294, 310, 1184, 1194, 1223, 3513, 3531, 3566, 3579], 'transporters': [50, 296, 1186, 1484, 3517], '(gpaAT),': [51, 297], 'has': [52, 298, 1174], 'been': [53, 299, 947, 1175], 'characterized': [54, 300, 571, 1176, 1480], 'schistosomes.': [56, 302], 'Only': [57, 303, 3574], 'single': [59, 108, 305, 354, 1164, 2105, 3576, 3865, 4151], 'SLC3': [63, 309, 3530, 3565, 3578], 'glycoproteins': [66, 312, 3568], 'associate': [68, 314, 3571], 'with': [69, 125, 157, 204, 315, 371, 403, 450, 1335, 1595, 1696, 1763, 1802, 1948, 2048, 2188, 2208, 2214, 2242, 2328, 2346, 2381, 2527, 2538, 2581, 2596, 2660, 2699, 2720, 2827, 2916, 2954, 3062, 3182, 3219, 3293, 3346, 3379, 3404, 3432, 3522, 3572, 3683, 3723, 3741, 3982, 4033, 4099, 4220, 4236, 4241], 'gpaATs': [70, 316], 'is': [71, 103, 149, 160, 174, 190, 224, 317, 349, 395, 406, 420, 436, 470, 570, 737, 837, 980, 1035, 1097, 1290, 1560, 1593, 1606, 2776, 3506, 3618, 3625, 3632, 3713, 3718, 3746, 3811, 3880, 3976, 4038, 4049, 4105, 4231], 'found': [72, 318, 1098, 1291, 1935], 'following': [73, 319, 2015, 2184, 2757, 2845, 2989, 3121, 3266, 3335, 3393, 3421], 'extensive': [74, 320], 'searching': [75, 321], 'genomes': [78, 324, 3543], 'Schistosoma': [80, 326, 989], 'mansoni': [81, 327, 990, 1653, 1794, 1921, 3255, 3415, 3546, 3708], 'and': [82, 97, 116, 135, 144, 168, 187, 196, 328, 343, 362, 381, 390, 414, 433, 442, 559, 584, 658, 864, 971, 1033, 1295, 1298, 1384, 1443, 1455, 1638, 1664, 1707, 1712, 1731, 1759, 1784, 1996, 2019, 2151, 2170, 2211, 2222, 2227, 2278, 2282, 2317, 2330, 2332, 2350, 2368, 2383, 2463, 2504, 2544, 2556, 2571, 2598, 2615, 2621, 2641, 2717, 2839, 2854, 2863, 2891, 2919, 2923, 2963, 2977, 2985, 3023, 3053, 3086, 3103, 3179, 3203, 3225, 3228, 3275, 3278, 3304, 3309, 3357, 3374, 3395, 3401, 3423, 3429, 3460, 3497, 3519, 3539, 3547, 3635, 3639, 3668, 3691, 3730, 3794, 3799, 3817, 3906, 3963, 4085, 4115, 4200], 'S.': [83, 329, 886, 1067, 1496, 1652, 1793, 1808, 1920, 2111, 2138, 2189, 2435, 2880, 2941, 3254, 3414, 3545, 3548, 3707, 3759, 3775], 'japonicum.': [84, 330], 'In': [85, 331, 1363, 1630, 1776, 2101, 3869], 'this': [86, 90, 332, 336, 1042, 1364, 1619, 1631, 1643, 1777, 2001, 2053, 2102, 2464, 2533, 3841, 3980], 'report,': [87, 333, 1632], 'we': [88, 334, 1633, 1779, 1912, 3584], 'characterize': [89, 335, 1639, 1785], 'schistosome': [91, 146, 178, 337, 392, 424, 614, 735, 1209, 1238, 1552, 1614, 1622, 1787, 1909, 3503, 3601, 3689, 3872, 3951], 'permease': [92, 338, 1210, 1239, 1625, 2229, 3504, 3588, 3835], 'heavy': [93, 339, 1213, 1242, 1626, 2230, 2458, 3524, 3590, 3836, 3857, 4103], 'chain': [94, 340, 1627, 2231, 2459, 3525, 3837, 3858, 3985, 4104], '(SPRM1hc)': [95, 341], 'gene': [96, 101, 342, 347, 2037, 3246, 3419, 3610, 3617, 3624], 'protein.': [98, 344], 'The': [99, 345, 522, 568, 609, 734, 834, 896, 1426, 1892, 2003, 2035, 2183, 2473, 2632, 2693, 2735, 2823, 3073, 3209, 3265, 3280, 3537, 3623, 3642, 3701, 3751, 3901, 4146, 4164, 4173], '72-kDa': [100, 346], 'product': [102, 348, 1986, 2324], 'predicted': [104, 350, 3715, 3861, 3876, 3920, 3977, 4111, 4152], 'to': [105, 210, 351, 456, 621, 844, 925, 1118, 1181, 1437, 1612, 1782, 1805, 1917, 2125, 2175, 2192, 2468, 2487, 2514, 2689, 2793, 2799, 2815, 2925, 3119, 3162, 3213, 3222, 3352, 3442, 3446, 3528, 3532, 3570, 3656, 3772, 3802, 3862, 3877, 3978], 'possess': [106, 352, 3661, 3863, 3954], 'transmembrane': [109, 355, 3866, 4112, 4153, 4166], 'domain,': [110, 356], '(βα)8': [112, 358, 3899], '(TIM': [113, 359], 'barrel)': [114, 360], 'conformation': [115, 361], 'catalytic': [118, 364, 3957], 'triad.': [119, 365], 'Xenopus': [120, 142, 366, 388, 1324, 1774, 2256, 2262, 2338, 3535, 4206, 4214], 'oocytes': [121, 367, 2453, 2484, 2523, 2535, 2575, 4215, 4234], 'functionally': [122, 368, 1761], 'expressing': [123, 369, 2454, 2524, 4216], 'SPRM1hc': [124, 148, 173, 189, 208, 370, 394, 419, 435, 454, 1637, 1758, 1976, 2036, 2047, 2226, 2254, 2260, 2266, 2529, 2760, 3005, 3242, 3245, 3391, 3495, 3586, 3596, 3616, 3698, 3709, 3716, 3739, 3815, 3914, 4032, 4204, 4222], 'SPRM1lc': [126, 158, 372, 404, 1326, 1366, 1436, 1456, 1525, 1559, 1605, 2525, 3505, 4034, 4061, 4169, 4217], 'phenylalanine,': [128, 374, 1382], 'arginine,': [129, 375, 1375], 'lysine,': [130, 376, 1376], 'alanine,': [131, 377], 'glutamine,': [132, 378, 1702, 3299], 'histidine,': [133, 379, 1377], 'tryptophan,': [134, 380], 'leucine.': [136, 382], 'Biochemical': [137, 383], 'characterization': [138, 384, 1548, 3607], 'demonstrates': [139, 385, 1549], 'extracts': [143, 147, 389, 393, 1553], 'associated': [150, 396, 1561, 3512], 'into': [151, 397, 659, 1038, 1562, 2334], 'high': [153, 399, 1564], 'molecular': [154, 400, 1565, 3725], 'weight': [155, 401, 1566, 3726], 'complex': [156, 402, 1567], 'disrupted': [161, 407, 1571], 'by': [162, 201, 408, 447, 572, 743, 758, 839, 1572, 1608, 1729, 1981, 2040, 2194, 2272, 2379, 2768, 2908, 3137, 3175, 3243, 3258, 3384, 3603, 3921, 4057, 4162], 'reducing': [163, 409, 1573, 2746], 'agents.': [164, 410], 'Quantitative': [165, 411], 'real-time': [166, 412], 'PCR': [167, 413, 1985, 2195, 2218, 2273, 2323], 'Western': [169, 415], 'analysis': [170, 416, 2501, 4059], 'demonstrate': [171, 417], 'expressed': [175, 421, 1198, 1227, 1322, 1772, 2476], 'each': [177, 423, 2542, 2904], 'life': [179, 425, 1556, 2898, 3250, 3267], 'stage': [180, 426], 'examined': [181, 427, 3227], '(eggs,': [182, 428], 'cercariae,': [183, 429, 3273], 'schistosomula,': [184, 430, 3274], 'adult': [185, 194, 431, 440, 576, 1296, 1989, 2011, 2275, 3012, 3057, 3276, 3600], 'males': [186, 432, 3277], 'females).': [188, 434], 'widely': [191, 437], 'distributed': [192, 225, 438, 471, 2244], 'throughout': [193, 439], 'male': [195, 441], 'female': [197, 443, 602], 'worms': [198, 444], 'determined': [200, 446, 2451, 3762], 'immunolocalization.': [202, 448], 'Consistent': [203, 449], 'hypothesis': [206, 452, 1597], 'functions': [209, 455], 'facilitate': [211, 457, 2794], 'nutrient': [212, 458, 919], 'uptake': [213, 459, 1330, 2421, 2449, 2563, 4209], 'from': [214, 460, 1114, 1642, 1659, 1736, 1988, 2010, 2110, 2365, 2485, 2636, 2850, 2895, 2903, 2983, 3327, 3368, 3599, 3654, 3680, 3743, 3758, 3819], 'host': [215, 461, 618, 625, 930, 1032], 'blood,': [216, 462], 'immunogold': [217, 463], 'electron': [218, 464, 3235], 'microscopy': [219, 465], 'confirms': [220, 466], 'protein': [223, 469, 1289, 1620, 1641, 1766, 2690, 3717, 3740, 3795, 3816, 3981], 'on': [226, 472, 1936, 2355, 3107, 3465, 4051, 4086], 'host-interactive': [228, 474, 984], 'tegumental': [229, 475, 835, 915], 'membranes.': [230, 476], 'We': [231, 477, 1617], 'propose': [232, 478], 'surface-exposed,': [234, 480], 'host-interactive,': [235, 481], 'nutrient-transporting': [236, 482, 908], 'proteins': [237, 483, 909, 921, 945, 3859, 3873, 3952], 'like': [238, 484], 'SPRM1': [240, 486], 'heterodimer': [241, 487, 4048], 'promising': [243, 489], 'vaccine': [244, 490], 'candidates.': [245, 491], 'platyhelminths': [495], 'currently': [497], 'infect': [498, 557], 'several': [499, 2366, 3785], 'hundred': [500], 'million': [501], 'people': [502, 531], 'globally': [503], '(1Chitsulo': [504], 'L.': [505, 511, 1248, 1341, 1387, 2393, 3089, 4063], 'Engels': [506], 'D.': [507, 1127], 'Montresor': [508], 'A.': [509, 1068, 1675, 2881, 2942, 3038], 'Savioli': [510], 'Acta.': [512, 545], 'Trop.': [513, 546, 823], '2000;': [514, 1084, 3937], '77:': [515], '41-51Crossref': [516], 'PubMed': [517, 550, 634, 691, 703, 717, 729, 773, 809, 829, 875, 968, 1004, 1017, 1053, 1072, 1087, 1138, 1159, 1265, 1282, 1316, 1358, 1404, 1421, 1474, 1504, 1516, 1587, 1684, 1887, 2096, 2306, 2410, 2443, 2683, 2885, 2946, 3047, 3490, 3945, 4016, 4080, 4134], 'Scopus': [518, 551, 635, 704, 718, 730, 774, 810, 830, 876, 1005, 1018, 1054, 1073, 1088, 1139, 1160, 1266, 1283, 1317, 1359, 1405, 1422, 1475, 1505, 1517, 1588, 1685, 1888, 2097, 2411, 2444, 2684, 2886, 2947, 3048, 3491, 3946, 4017, 4081, 4135], '(955)': [519], 'Google': [520, 553, 637, 692, 706, 720, 732, 776, 812, 832, 878, 894, 969, 1007, 1020, 1056, 1075, 1090, 1141, 1162, 1268, 1285, 1319, 1361, 1407, 1424, 1477, 1507, 1519, 1590, 1687, 1890, 2099, 2307, 2413, 2446, 2686, 2888, 2949, 3050, 3493, 3948, 4019, 4083, 4137], 'Scholar).': [521, 554, 733, 777, 833, 895, 1021, 1091, 1286, 1320, 1362, 1425, 1478, 1520, 1591, 1688, 1891, 2100, 2308, 2414, 2447, 2950, 3949, 4020], 'World': [523], 'Health': [524], 'Organization': [525], 'estimates': [526], 'about': [528], 'billion': [530], 'at': [533, 1716, 2028, 2073, 2144, 2588, 2626, 2629, 2643, 2657, 2752, 2789, 2960, 3070, 3133, 3146, 3171, 3200, 3237, 3313], 'risk': [534], 'exposure': [536], '(2Bergquist': [537], 'R.': [538, 542, 544, 1252, 1273, 1307, 1345, 1391, 1412, 1458, 1578, 1810, 2397, 2667, 3090, 4000, 4067, 4118], 'Al-Sherbiny': [539], 'M.': [540], 'Barakat': [541], 'Olds': [543], '2002;': [547, 1501, 2440], '82:': [548, 1002], '183-192Crossref': [549], '(113)': [552], 'also': [556, 2008, 3875, 3953], 'livestock': [558], 'cause': [560], 'serious': [561], 'economic': [562], 'hardship': [563], 'many': [565, 596], 'developing': [566], 'nations.': [567], 'disease': [569], 'presence': [574, 906], 'worms,': [577, 588], 'or': [578, 791, 940, 1628, 2461, 2530, 2573, 2744, 3557, 3787, 3824, 4223], 'blood': [579, 643, 654, 931], 'flukes,': [580], 'within': [581, 624, 640, 1115, 1323, 3909], 'portal': [583], 'mesenteric': [585], 'veins.': [586], 'These': [587], 'living': [589], 'male/female': [591], 'pairs,': [592], 'can': [593, 645, 652, 673, 1526, 1569], 'survive': [594], 'for': [595, 938, 1435, 1926, 2077, 2148, 2156, 2181, 2315, 2319, 2548, 2585, 2623, 2654, 2749, 3129, 3143, 3168, 3197, 3286, 3410, 3553, 3694, 3995, 4060], 'years': [597], 'during': [598, 1027], 'which': [599, 1179, 1999, 3605, 3631], 'time': [600], 'produces': [603], 'hundreds': [604], 'eggs': [606, 623, 1733], 'per': [607], 'day.': [608], 'primary': [610, 3164], 'pathological': [611], 'consequences': [612], 'infection': [615], 'immunological': [619, 941], 'response': [620], 'these': [622, 857, 3856], 'tissues': [626, 1121, 1303], '(3Warren': [627], 'K.S.': [628], 'Immunol.': [629], 'Rev.': [630], '1982;': [631], '61:': [632, 715], '189-213Crossref': [633], '(74)': [636], 'Scholar).Adult': [638], 'schistosomes,': [639, 1178], 'vertebrate': [642, 1031], 'stream,': [644], 'feed': [646], 'two': [648, 744, 2196, 2817, 3115, 3561], 'ways.': [649], 'First,': [650, 3322], 'ingest': [653], 'through': [655], 'mouth': [657], 'gut': [661], 'battery': [664], 'enzymes': [666], 'breaks': [667], 'down': [668], 'material.': [670], 'Second,': [671], 'directly': [676, 1982], '(or': [681, 848], 'tegument)': [682], '(4Fripp': [683], 'P.J.': [684, 994, 1010, 1046, 1059, 1078, 1125, 1144, 1254, 1271, 1305, 1347, 1393, 1410, 1464, 1576, 1673, 2399, 2673, 2872, 2933, 3034, 4006, 4069, 4124], 'Comp.': [685], 'Biochem.': [686, 3935], 'Physiol.': [687], '1967;': [688], '23:': [689], '893-898Crossref': [690], 'Scholar,': [693, 707, 721, 813, 879, 1008, 1057, 1076, 1142, 1269, 1408, 1508], '5Asch': [694], 'H.L.': [695, 709], 'Read': [696, 710], 'C.P.': [697, 711], 'Exp.': [698, 724, 999], 'Parasitol.': [699, 713, 725, 805, 871, 1000, 1083, 1149, 1680], '1975;': [700, 714, 726], '38:': [701], '123-135Crossref': [702], '(30)': [705], '6Asch': [708], 'J.': [712, 804, 822, 870, 888, 954, 956, 959, 992, 1082, 1256, 1349, 1395, 1462, 1500, 1679, 2090, 2292, 2294, 2297, 2401, 2439, 2671, 4004, 4071, 4122], '378-379Crossref': [716], '(26)': [719], '7Pappas': [722], 'P.W.': [723], '37:': [727], '469-530Crossref': [728], '(158)': [731], 'tegument': [736, 780, 902, 1026, 1105, 1117], 'unusual': [739], 'structure,': [740], 'being': [741], 'enclosed': [742], 'closely': [745], 'apposed': [746], 'lipid': [747], 'bilayers': [748], 'form': [751], 'normal': [754], 'plasma': [755, 916, 985, 1441, 3990], 'membrane': [756, 986, 1102, 1442, 1539, 4022], 'overlain': [757], 'membrane-like': [760], 'secretion': [761], 'called': [762, 911, 3881, 4036], 'membranocalyx': [764], '(8Wilson': [765], 'R.A.': [766, 1843, 1873], 'Barnes': [767], 'P.E.': [768, 1814], 'Parasitology.': [769, 1013, 1049, 1134, 1278, 1312, 1417, 1583, 1750, 3043], '1974;': [770], '68:': [771], '239-258Crossref': [772], '(110)': [775], 'Because': [778], 'lacks': [781], 'lateral': [782], 'membranes,': [783], 'its': [784, 3983], 'cytoplasm': [785, 836], 'extends': [786], 'continuous': [789], 'unit,': [790], 'syncytium,': [792], 'around': [793], 'entire': [795, 1908, 2004, 2060, 2201, 2265], 'worm': [799, 3013], '(9Morris': [800, 866], 'G.P.': [801, 867, 1835], 'Threadgold': [802, 868], 'L.T.': [803, 869], '1968;': [806, 872], '54:': [807, 873], '15-27Crossref': [808, 874], '(123)': [811, 877], '10Smith': [814], 'J.H.': [815, 885], 'Reynolds': [816], 'E.S.': [817], 'Von': [818], 'Lichtenberg': [819], 'F.': [820, 1260, 1275, 1309, 1353, 1399, 1414, 1468, 1498, 1510, 1580, 1744, 2405, 2437, 2677, 4010, 4075, 4128], 'Am.': [821], 'Med.': [824, 889], 'Hyg.': [825], '1969;': [826, 891], '18:': [827], '28-49Crossref': [828], '(107)': [831], 'connected': [838], 'numerous,': [840], 'thin': [841], 'cytoplasmic': [842], 'processes': [843], 'interconnected,': [845], 'cell': [846], 'bodies': [847, 1667], 'cytons)': [849], 'lie': [851], 'beneath': [852], 'peripheral': [854], 'muscle': [855], 'layers;': [856], 'contain': [858], 'nuclei,': [859], 'endoplasmic': [860], 'reticula,': [861], 'golgi': [862], 'complexes,': [863], 'mitochondria': [865], '11Silk': [880], 'M.H.': [881], 'Spence': [882], 'I.M.': [883], 'Gear': [884], 'Afr.': [887], 'Sci.': [890, 1065, 2878, 2939, 3936], '34:': [892], '1-10PubMed': [893], 'implies': [904], '(sometimes': [910], 'permeases)': [912], 'membrane.': [917], 'Such': [918], 'importing': [920], 'must': [922], 'be': [923, 936, 1527, 1570], 'exposed': [924, 3161, 3212], 'and,': [932, 3770], 'such,': [934], 'should': [935], 'available': [937, 2163], 'chemotherapeutic': [939], 'assault.Several': [942], 'glucose': [943, 1094, 1113], 'transporter': [944, 1095, 1167, 3998, 4031], 'have': [946], 'identified': [948, 1956, 2039, 2109, 3582, 3890], 'schistosomes': [950, 1297], '(12Skelly': [951, 2289], 'P.': [952, 2290], 'Cunningham': [953, 2291], 'Kim': [955, 2293], 'Shoemaker': [957, 995, 1011, 1047, 1060, 1079, 1132, 1147, 1257, 1276, 1310, 1350, 1396, 1415, 1465, 1581, 2295, 2402, 2674, 2873, 2934, 3041, 4007, 4072, 4125], 'C.': [958, 1123, 1492, 1865, 2296, 2431, 3927, 3929, 3931], 'Biol.': [960, 2092, 2298], 'Chem.': [961, 2299], '1994;': [962, 2300], '269:': [963, 2301], '4247-4253Abstract': [964, 2302], 'Full': [965, 1154, 1156, 2303, 3940, 3942], 'Text': [966, 1155, 1157, 2304, 3941, 3943], 'PDF': [967, 1158, 2305, 3944], 'Scholar)': [970, 2687, 4084], 'one': [972, 1797, 2171, 2499], 'these,': [974], 'Glucose': [976], 'Transporter': [977], '4': [978, 2630, 2658, 3071, 4116], '(SGTP4),': [979], 'detected': [981, 2967], 'intravascular': [988], '(13Jiang': [991], 'Skelly': [993, 1124, 1253, 1346, 1392, 1463, 2398, 2672, 4005, 4068, 4123], 'C.B.': [996, 1012, 1048, 1061, 1080, 1133, 1148, 1258, 1277, 1311, 1351, 1397, 1416, 1466, 1582, 2403, 2675, 2874, 2935, 3042, 4008, 4073, 4126], 'Caulfield': [997, 1130], 'J.P.': [998, 1131, 1820, 1825], '1996;': [1001, 1069, 2882, 2943], '201-210Crossref': [1003], '(36)': [1006], '14Skelly': [1009], '2001;': [1014, 1050, 3044, 3487], '122:': [1015, 1051], '67-73Crossref': [1016, 1052], '(38)': [1019, 1055], 'synthesize': [1023], 'new': [1025, 1043], 'invasion': [1028], 'SGTP4': [1034], 'rapidly': [1036], 'deposited': [1037], 'structure': [1044], '(14Skelly': [1045], '15Skelly': [1058], 'Proc.': [1062, 2875, 2936], 'Natl.': [1063, 2876, 2937], 'Acad.': [1064, 2877, 2938], 'U.': [1066, 2879, 2940], '93:': [1070, 2883, 2944], '3642-3646Crossref': [1071, 2884, 2945], '(83)': [1074, 2887, 2948], '16Skelly': [1077], 'Int.': [1081, 1678], '30:': [1085], '625-631Crossref': [1086], '(35)': [1089], 'A': [1092, 1450, 1939, 2784, 3592, 3612, 3735, 3968, 4021], 'second': [1093], '(SGTP1)': [1096], 'basal': [1101], 'it': [1107], 'likely': [1108, 2178], 'facilitates': [1109], 'distribution': [1111], 'internal': [1120], '(17Zhong': [1122], 'Leaffer': [1126], 'Cohn': [1128], 'R.G.': [1129, 1859], '1995;': [1135], '110:': [1136], '383-394Crossref': [1137], '(44)': [1140], '18Skelly': [1143], 'Tielens': [1145], 'A.G.M.': [1146], 'Today.': [1150], '1998;': [1151, 1262, 1355, 1401, 1471, 2407, 2680, 4013, 4077, 4131], '14:': [1152], '402-406Abstract': [1153], '(42)': [1161], 'Scholar).A': [1163], '(Schistosome': [1168], 'SPRM1lc)': [1173], 'belongs': [1180], '(gpaAT)': [1187], '2The': [1188], 'abbreviations': [1189, 1218], 'used': [1190, 1219, 1913, 2174, 2187, 2419, 2814], 'are:': [1191, 1220], 'gpaAT,': [1192, 1221], 'transporters;': [1196, 1225], 'EST,': [1197, 1226], 'sequence': [1199, 1228, 1803, 1897, 1978, 2045, 2157, 2180, 2775, 3634, 3809], 'tag;': [1200, 1229], 'PBS,': [1201, 1230], 'phosphate-buffered': [1202, 1231, 2866], 'saline;': [1203, 1232], 'TM,': [1204, 1233], 'transmembrane;': [1205, 1234], 'FAM,': [1206, 1235], '6-carboxylfluorescein;': [1207, 1236], 'SPRM1,': [1208, 1237], '1;': [1211, 1240], 'hc,': [1212, 1241], 'chain;': [1214, 1243], 'lc,': [1215, 1244], 'chain.2The': [1217], 'chain.': [1246], '(19Mastroberardino': [1247, 1340, 1386, 2392, 4062], 'Spindler': [1249, 1342, 1388, 1459, 2394, 2668, 4001, 4064, 4119], 'B.': [1250, 1343, 1389, 1460, 2395, 2669, 4002, 4065, 4120], 'Pfeiffer': [1251, 1272, 1306, 1344, 1390, 1411, 1577, 2396, 4066], 'Loffing': [1255, 1348, 1394, 1461, 2400, 2670, 4003, 4070, 4121], 'Verrey': [1259, 1274, 1308, 1352, 1398, 1413, 1467, 1497, 1579, 2404, 2436, 2676, 4009, 4074, 4127], 'Nature.': [1261, 1354, 1400, 2406, 4076], '395:': [1263, 1356, 1402, 2408, 4078], '288-291Crossref': [1264, 1357, 1403, 2409, 4079], '(456)': [1267, 1360, 1406, 2412, 4082], '20Skelly': [1270, 1409], '1999;': [1279, 1313, 1418, 1584], '119:': [1280, 1314, 1419, 1585], '569-576Crossref': [1281, 1315, 1420, 1586], '(28)': [1284, 1318, 1423, 1589], 'This': [1287, 1592, 1969, 2774, 4043], '∼55-kDa': [1288], 'both': [1293, 1769, 2851], 'larval': [1294], 'variety': [1301], '(20Skelly': [1304, 1575], 'When': [1321], 'oocytes,': [1325, 2263, 2426], 'promoted': [1327], 'but': [1331, 2121], 'only': [1332, 2455, 3628], 'when': [1333, 1768, 2508], 'co-expressed': [1334], 'glycoprotein,': [1338], 'h4F2hc': [1339, 1427, 1454, 1615, 1767, 1788, 1806, 3556, 4227], 'context,': [1365], 'facilitated': [1367], 'transport': [1369, 2521, 2550], 'basic': [1372], 'well': [1379], 'leucine,': [1381], 'methionine,': [1383], 'glutamine': [1385], 'protein,': [1428], 'acting': [1429], 'chaperone,': [1432], 'was': [1433, 1654, 1934, 1979, 2007, 2038, 2063, 2108, 2114, 2154, 2173, 2269, 2325, 2363, 2377, 2385, 2450, 2466, 2495, 2512, 2634, 2765, 2787, 2813, 2848, 2914, 2966, 3015, 3095, 3256, 3325, 3350, 3363, 3480, 3581, 3597, 3699, 3761, 3888, 3993], 'necessary': [1434], 'reach': [1438], 'oocyte': [1440], 'function': [1444, 1485, 3533], 'permease.': [1449], 'disulfide': [1451, 1610, 4097, 4179], 'bond': [1452, 1611], 'links': [1453], '(21Pfeiffer': [1457, 2666, 3999, 4117], 'FEBS': [1469, 2678, 4011, 4129], 'Lett.': [1470, 2679, 4012, 4130], '439:': [1472, 2681, 4014, 4132], '157-162Crossref': [1473, 2682, 4015, 4133], '(90)': [1476, 2685, 4018, 4136], 'All': [1479, 2022, 3454, 3659], 'heterodimeric': [1481, 4028], 'obligatory': [1487], 'exchangers': [1490], '(22Meier': [1491, 2430], 'Ristic': [1493, 2432], 'Z.': [1494, 2433], 'Klauser': [1495, 2434], 'EMBO': [1499, 2438], '21:': [1502, 2441], '580-589Crossref': [1503, 2442], '(248)': [1506, 2445], '23Verrey': [1509], 'Pflugers': [1511], 'Arch.': [1512], '2003;': [1513, 1681, 1884], '445:': [1514], '529-533Crossref': [1515], '(229)': [1518], 'Thus': [1521], 'role': [1523], 'viewed': [1528], 'equilibrating': [1532], 'concentrations': [1533], 'rather': [1540], 'than': [1541], 'influx': [1546], 'transporter.Biochemical': [1547], 'that,': [1550], 'all': [1555, 3328], 'cycle': [1557, 3251, 3268], 'stages,': [1558], 'agents': [1574], 'consistent': [1594], 'significant': [1600], 'fraction': [1601], 'endogenous': [1604, 3412], 'linked': [1607], 'homolog.': [1616, 1789], 'call': [1618], 'SPRM1hc.': [1629, 4156], 'clone': [1634, 2123], 'cDNA': [1635, 1991, 2012, 2191, 2277, 3353, 3366, 3594, 3710], 'encoding': [1636, 3595, 4238, 4243], 'parasite.EXPERIMENTAL': [1646], 'PROCEDURESParasites—The': [1647], 'Puerto': [1648], 'Rican': [1649], 'strain': [1650], 'used.': [1655], 'Cercariae': [1656], 'were': [1657, 1668, 1690, 1727, 1734, 2026, 2168, 2186, 2220, 2233, 2344, 2353, 2372, 2418, 2536, 2576, 2592, 2619, 2652, 2695, 2738, 2825, 2857, 2900, 2906, 2952, 2995, 3059, 3075, 3111, 3125, 3160, 3211, 3226, 3270, 3282, 3397, 3425, 3440, 3456, 3550, 3919, 4211], 'obtained': [1658, 1987, 2169, 3283, 3598], 'infected': [1660, 1737], 'Biomphalaria': [1661], 'glabrata': [1662], 'snails': [1663], 'isolated': [1665, 1735], 'parasite': [1666, 1732, 1990, 2276, 2897], 'prepared': [1669], 'described': [1671, 1742, 2288, 2391, 2870, 3031], '(24Skelly': [1672], "Da'dara": [1674], 'Harn': [1676], 'D.A.': [1677], '33:': [1682], '363-369Crossref': [1683], '(152)': [1686], 'Parasites': [1689], 'cultured': [1691], 'RPMI': [1693, 3290], 'medium': [1694, 3291], 'supplemented': [1695, 2580, 3292], '10': [1697, 2624, 3234, 3294, 3640], 'mm': [1698, 1701, 2605, 2610, 2701, 2706, 2709, 2712, 2722, 2727, 2730, 3295, 3298], 'HEPES,': [1699], '2': [1700, 2486, 2648, 3297], '5%': [1703, 1723, 3150, 3300, 3320], 'fetal': [1704, 3301], 'calf': [1705, 3302], 'serum,': [1706], 'antibiotics': [1708, 3305], '(100': [1709, 3306], 'units/ml': [1710, 3307], 'penicillin': [1711, 3308], '100': [1713, 2359, 2705, 2726, 2828, 3310], 'μg/ml': [1714, 2360, 3311], 'streptomycin)': [1715, 3312], '37': [1717, 3314], '°C,': [1718, 3315], 'atmosphere': [1721, 3318], 'CO2.': [1724, 3321], 'recovered': [1728, 2849], 'perfusion': [1730], 'mouse': [1738], 'liver': [1739], 'tissue': [1740], '(25Hackett': [1743], 'Hyde': [1745], 'J.E.': [1746], 'Protocols': [1747], 'Molecular': [1749], 'Vol.': [1751], '21.': [1752], 'Humana': [1753], 'Press,': [1754], '1993:': [1755], '89-99Google': [1756], 'Scholar).Identifying': [1757], 'SjSPRM1hc—SPRM1lc': [1760], 'associates': [1762], 'molecules': [1770], 'oocytes.': [1775, 3536], 'work': [1778, 3842], 'set': [1780], 'out': [1781, 2497, 3017], 'identify': [1783, 2055, 2132, 2176], 'Analysis': [1790, 3925], 'transcriptome': [1795], 'revealed': [1796, 3784], 'EST': [1798, 1893, 1915, 1947, 1967, 3692], '(designated': [1799], 'SmAE': [1800], '607755.1)': [1801], 'similarity': [1804, 3810], '(26Verjovski-Almeida': [1807], 'DeMarco': [1809], 'Martins': [1811], 'E.A.': [1812], 'Guimaraes': [1813], 'Ojopi': [1815], 'E.P.': [1816], 'Paquola': [1817], 'A.C.': [1818], 'Piazza': [1819], 'Nishiyama': [1821], 'Jr.,': [1822], 'M.Y.': [1823], 'Kitajima': [1824], 'Adamson': [1826], 'R.E.': [1827], 'Ashton': [1828], 'P.D.': [1829], 'Bonaldo': [1830], 'M.F.': [1831], 'Coulson': [1832], 'P.S.': [1833], 'Dillon': [1834], 'Farias': [1836], 'L.P.': [1837], 'Gregorio': [1838], 'S.P.': [1839], 'Ho': [1840], 'P.L.': [1841], 'Leite': [1842, 1878], 'Malaquias': [1844], 'L.C.': [1845, 1879], 'Marques': [1846], 'R.C.': [1847], 'Miyasato': [1848], 'P.A.': [1849], 'Nascimento': [1850], 'A.L.': [1851], 'Ohlweiler': [1852], 'F.P.': [1853], 'Reis': [1854], 'E.M.': [1855], 'Ribeiro': [1856], 'M.A.': [1857], 'Sa': [1858], 'Stukart': [1860], 'G.C.': [1861], 'Soares': [1862], 'M.B.': [1863], 'Gargioni': [1864], 'Kawano': [1866], 'T.': [1867], 'Rodrigues': [1868], 'V.': [1869], 'Madeira': [1870], 'A.M.': [1871], 'Wilson': [1872], 'Menck': [1874], 'C.F.': [1875], 'Setubal': [1876], 'J.C.': [1877], 'Dias-Neto': [1880], 'E.': [1881], 'Nat.': [1882], 'Genet.': [1883], '35:': [1885], '148-157Crossref': [1886], '(417)': [1889], 'encoded': [1894], 'partial': [1896], 'lacked': [1899], 'initiator': [1901], 'methionine.': [1902], 'To': [1903, 2131], 'most': [1904], 'easily': [1905], 'uncover': [1906], 'coding': [1910, 1977, 2005, 2044, 2061, 2129, 2135, 2164, 2204, 2267, 3633, 3753], 'sequence,': [1911], 'data': [1916, 2141, 2471, 3777], 'search': [1918], 'genome': [1922, 2140, 3690], 'assembly': [1923], '(version': [1924], '3)': [1925], 'genomic': [1927, 1954, 2050, 3452], 'clones': [1928, 2367], 'containing': [1929, 2052, 2358, 2565, 2603], 'sequence.': [1931], 'match': [1933], 'contig': [1937, 1955, 2051], '0011683.': [1938], 'comparison': [1940, 2492, 3736], 'extreme': [1943], '5′-end': [1944, 1973], 'equivalent': [1950, 2921], 'region': [1951], 'inframe': [1958], 'initiation': [1959], 'codon': [1960], 'just': [1961], '15': [1962, 3287], 'bases': [1963], 'upstream': [1964, 2160], 'start.': [1968], 'identification': [1970], 'confirmed': [1980], 'sequencing': [1983, 3788], 'using': [1992, 2013, 2065, 2235, 2246, 2274, 2285, 2452, 2498, 2859, 2968, 2997, 3018, 3097, 3149, 3230, 3330, 3354, 3365], 'oligonucleotides': [1993, 2185], '(Hc-6:': [1994], '5′-TGTTCTATTGTCATCTACATTTTGTG-3′': [1995], 'Hc-7:': [1997], '5′-GTGAGGACAATAAAACCCGCGCC-3′),': [1998], 'span': [2000, 3443], 'region.': [2002, 2130], 'DNA': [2006, 2024, 2062, 2268, 3754], 'amplified': [2009, 2023, 2271], 'oligonucleotides:': [2016], 'Hc-2': [2017], 'CGGAACTTTATCTGTTGTAGTACTGA': [2018], 'Hc-5:': [2020], '5′-CTTGCAAGCGGTTAGTTTGTGTAAAG-3′.': [2021], 'fragments': [2025, 2198, 2219], 'sequenced': [2027], 'Tufts': [2030], 'University': [2031], 'Core': [2032], 'Sequencing': [2033], 'Facility.': [2034], 'comparing': [2041], 'complete': [2043, 3542, 3593, 3752], 'sequence.To': [2054], 'homologs': [2056, 3554, 3696, 3742, 3818], 'SPRM1hc,': [2058, 4239], 'analyzed': [2064], 'Basic': [2067], 'Local': [2068], 'Alignment': [2069], 'Search': [2070], 'Tool': [2071], '(BLAST)': [2072], 'National': [2075], 'Center': [2076, 2147], 'Biotechnology': [2078, 2152], 'Information': [2079], '(27Altschul': [2080], 'S.F.': [2081], 'Gish': [2082], 'W.': [2083, 2085], 'Miller': [2084], 'Myers': [2086], 'E.W.': [2087], 'Lipman': [2088], 'D.J.': [2089], 'Mol.': [2091], '1990;': [2093], '215:': [2094], '403-410Crossref': [2095], '(68989)': [2098], 'way': [2103, 2500], 'close': [2106], 'homolog': [2107, 3757, 4226], 'japonicum': [2112, 2139, 2190, 3549, 3760, 3776], 'designated': [2115, 3764], 'SjPRM1hc': [2116, 2203, 3803], '(GenBank™': [2117, 3780], 'accession': [2118, 3703, 3767, 3781, 3830], 'number': [2119, 3704, 3768, 3782], 'AAW26021.1)': [2120], 'appeared': [2124], 'lack': [2126], 'N-terminal': [2128], 'further': [2133], 'potential': [2134, 2202, 3956], 'DNA,': [2136], 'base,': [2142], 'housed': [2143], 'Shanghai': [2146], 'Life': [2149], 'Science': [2150], 'Information,': [2153], 'probed': [2155, 2953], 'extended': [2159], 'DNA.': [2165, 3453], 'Several': [2166], 'hits': [2167], '(TISJA01484276)': [2172], '5′-coding': [2179], 'SjPRM1hc.': [2182], 'amplify': [2193], 'overlapping': [2197], 'comprising': [2199, 2759], 'sequence:': [2205], 'SjPRMhcfor1,': [2206], '5′-CTATCATTTACATTTTGCAAGCGG-3′': [2207], 'SjPRMhcrev1,': [2209], '5′-GCATCCACCGCTAATAATTTTGG-3′,': [2210], 'SjPRMhcfor2,': [2212], '5′-GGTCGTCCGAAAAATAAGAAAGG-3′': [2213], 'SjPRMhcrev2,': [2215], '5′-CACACAGAAGCGTAAATTTCAGC-3′.': [2216], 'Both': [2217, 3950], 'purified': [2221, 2364, 2955], 'sequenced.': [2223, 2373], 'Comparisons': [2224], 'between': [2225, 3813, 4110], 'related': [2228, 3834], 'sequences': [2232, 2310, 3796, 3838], 'undertaken': [2234], 'UPGMA': [2237], 'best': [2238], 'tree': [2239], 'building': [2240], 'method,': [2241], 'gaps': [2243], 'proportionally,': [2245], 'DS': [2247], 'Gene': [2248, 3260, 3496], 'software': [2249], '(Accelrys': [2250], 'Inc.).Functional': [2251], 'Expression': [2252, 3240, 3261], 'laevis': [2257, 2425], 'Oocytes—To': [2258], 'express': [2259], 'first': [2270, 3643, 3889], 'oligonucleotides,': [2279], 'Hc-XO1': [2280, 2316], '(5′-CGCCTCGAGATGAGTTCGAGCGGTACCAATGG-3′)': [2281], 'Hc-XO2': [2283], '(5′-CGCGGATCCTCATTCACATTTGAAAACATATATCATAG-3′),': [2284], 'conditions': [2286], 'Underlined': [2309], 'denote': [2311], 'restriction': [2312], 'sites;': [2313], 'XhoI': [2314, 2329], 'BamHI': [2318, 2331], 'Hc-XO2.': [2320], 'Next,': [2321, 3339], 'gel-purified,': [2326], 'digested': [2327, 2337], 'ligated': [2333], 'similarly': [2336], 'expression': [2339, 3247], 'plasmid,': [2340, 2375], 'pSDeasy.': [2341], 'TOP10': [2342], 'cells': [2343], 'transformed': [2345], 'ligation': [2348], 'mixture': [2349], 'recombinant': [2351], 'transformants': [2352], 'selected': [2354, 2513], 'agar': [2356], 'plates': [2357], 'ampicillin.': [2361], 'Plasmid': [2362], 'cloned': [2370], 'inserts': [2371], 'pNAA009,': [2376], 'linearized': [2378], 'digestion': [2380], 'PstI': [2382], 'cRNA': [2384, 2543], 'synthesized': [2386, 3383], 'vitro,': [2388], 'earlier': [2390, 3032, 3774], 'Tritiated': [2415], 'experiments': [2422], 'involving': [2423], 'X.': [2424], 'previously': [2428, 2869, 2930], 'detailed': [2429], 'Background': [2448], 'corresponding': [2457], '(SPRM1hc': [2460], 'h4F2hc),': [2462], 'value': [2465], 'subtracted': [2467], 'generate': [2469], 'shown.': [2472], 'results': [2474], 'mean': [2478], '±': [2479], 'S.E.': [2480], '(pmol/oocyte/h)': [2481], '13–42': [2483], '6': [2488, 3644], 'independent': [2489], 'experiments.': [2490], 'Statistical': [2491], 'means': [2494], 'carried': [2496, 3016], 'variance': [2503], 'Tuckey': [2505], 'post-test': [2507], 'p': [2509], '<': [2510], '0.05.l-Arginine': [2511], 'monitor': [2515], 'concentration': [2517], 'dependence': [2518], 'substrate': [2520], 'together': [2526, 4240], 'either': [2528, 4221], 'h4F2hc.': [2531], 'For': [2532, 3390, 3474], 'study,': [2534], 'injected': [2537, 4235], 'ng': [2540, 3370], 'evaluated,': [2545], 'above,': [2547], 'l-Arg': [2549], '(at': [2551, 3959], '0.1,': [2552], '1,': [2553], '10,': [2554], '100,': [2555], '1000': [2557], 'μm)': [2558], 'after': [2559, 3284], '24': [2560], 'h,': [2561], 'buffer': [2564, 2602, 2742, 3069], 'Na+.Biosynthetic': [2566], 'Labeling': [2567, 3052], 'Oocyte': [2569], 'Proteins': [2570], 'Immunoprecipitation—Non-injected': [2572], 'cRNA-injected': [2574], 'incubated': [2577, 3181], 'ND96': [2579, 2597], 'mCi·ml–1': [2583], '[35S]methionine': [2584], '48': [2586], 'h': [2587, 2656, 3170, 3199], '16': [2589, 2655], '°C.': [2590, 2631, 2645, 3072], 'Oocytes': [2591], 'then': [2593, 3076, 3084, 3180], 'washed': [2594, 2696], 'twice': [2595], 'lysed': [2599], '50': [2604, 3369], 'Tris/HCl,': [2606, 2702, 2723], 'pH': [2607, 2703, 2724], '8.0,': [2608], '120': [2609], 'NaCl,': [2611, 2707, 2728], '0.5%': [2612, 2714, 2732], 'Nonidet': [2613, 2715, 2733], 'P-40;': [2614, 2716], 'protease': [2616], 'inhibitors.': [2617], 'Extracts': [2618], 'vortexed': [2620], 'centrifuged': [2622], 'min': [2625, 2751, 3131, 3145], '12,000': [2627], 'rpm': [2628], 'supernatant': [2633], 'separated': [2635], 'pelleted': [2638], 'yolk': [2639], 'granules': [2640], 'stored': [2642], '–70': [2644], 'Aliquots': [2646], '×': [2649], '106': [2650], 'cpm': [2651], 'rotated': [2653], '°C': [2659], 'μg': [2662, 2829, 3341], 'anti-SPRM1lc': [2664], 'antibody': [2665, 2965], 'prebound': [2688], 'G/protein': [2691], 'A-agarose.': [2692], 'beads': [2694], 'five': [2697, 2718], 'times': [2698, 2719], '20': [2700, 2721], '8.0;': [2704, 2725], 'EDTA,': [2710, 2731], '500': [2711, 2805], 'LiCl,': [2713], 'P-40.': [2734], 'resulting': [2736], 'immunoprecipitates': [2737], 'heated': [2739], 'SDS-sample': [2741], '(with': [2743], 'without': [2745], 'agent': [2747], '(β-mercaptoethanol))': [2748], '3': [2750, 3652, 4114], '95': [2753], '°C.Anti-SPRM1hc': [2754], 'Antibody': [2755], 'Production—The': [2756], 'peptide': [2758, 2798, 2831], 'residues': [2763, 3674, 4176], '615–633': [2764], 'synthesized:': [2766], 'NH2-IDQPVGSQRVYLKSDGQPM-COOH': [2767], 'Genemed': [2769], 'Synthesis,': [2770], 'Inc.': [2771], 'San': [2772], 'Francisco.': [2773], 'indicated': [2777, 4161], 'bold': [2779], 'script': [2780], 'Fig.': [2782, 3621, 3749, 3917, 3966, 3974, 4041], '1B.': [2783, 3750], 'cysteine': [2785, 3970, 4092, 4175], 'residue': [2786, 3971, 4093], 'added': [2788], 'terminus': [2792], 'conjugation': [2795], 'bovine': [2800], 'serum': [2801, 2847, 3303], 'albumin': [2802], '(BSA).': [2803], 'Approximately': [2804], 'μgofthe': [2806], 'peptide-BSA': [2807], 'conjugate': [2808, 2862], "Freund's": [2810, 2835], 'Complete': [2811], 'Adjuvant': [2812, 2836], 'immunize': [2816], 'New': [2818], 'Zealand': [2819], 'White': [2820, 3091], 'rabbits': [2821, 2824], 'subcutaneously.': [2822], 'boosted': [2826], 'alone': [2832], 'Incomplete': [2834], '20,': [2837], '40,': [2838], '60': [2840], 'days': [2841, 2844, 3288], 'later.': [2842], 'Ten': [2843], 'this,': [2846], 'rabbits,': [2852], 'pooled': [2853], 'anti-SPRM1hc': [2855, 2956, 3021], 'antibodies': [2856, 2957, 3165, 3185], 'affinity-purified': [2858], 'peptide-ovalbumin': [2861], 'dialyzed': [2864], 'against': [2865], 'saline,': [2867], '(15Skelly': [2871, 2932], 'Scholar).Membrane': [2889], 'Preparation': [2890], 'Gel': [2892], 'Electrophoresis—Membrane': [2893], 'preparations': [2894], 'different': [2896, 3249], 'stages': [2899, 3252, 3269], 'prepared,': [2901], 'aliquots': [2902], 'preparation': [2905], 'resolved': [2907], '4–15%': [2909], 'gradient': [2910], 'SDS-PAGE.': [2911], 'gel': [2913, 2922], 'stained': [2915, 3218], 'Coomassie': [2917], 'Blue': [2918], 'blotted': [2924], 'polyvinylidene': [2926], 'difluoride': [2927], 'membrane,': [2928, 3991], 'outlined': [2931], 'Blots': [2951], '(1': [2958], 'mg/ml)': [2959], '1:300': [2961], 'dilution': [2962], 'bound': [2964], 'horseradish': [2970], 'peroxidase-labeled': [2971], 'anti-rabbit': [2972, 3026, 3192], 'IgG': [2973, 3027, 3193], '(1:5000,': [2974], 'Amersham': [2975, 3195], 'Biosciences)': [2976, 3196], 'TMB': [2979], 'Membrane': [2980], 'Peroxidase': [2981], 'system': [2982], 'Kirkegaard': [2984], 'Perry': [2986], 'Laboratories': [2987], 'Inc,': [2988], "manufacturer's": [2991, 3337], 'instructions.': [2992, 3338], 'Blot': [2993], 'images': [2994], 'captured': [2996], 'Kodak': [2999], 'Image': [3000, 4193], 'Station': [3001], '2000RT.Immunolocalization—Immunofluorescent': [3002], 'detection': [3003, 3448], '7-μm': [3007], 'thick,': [3008], 'cold': [3009], 'acetone': [3010], 'fixed,': [3011], 'sections': [3014, 3105], 'affinity-purified,': [3019], 'rabbit': [3020], 'antiserum': [3022], 'fluorescein-conjugated': [3024], 'goat': [3025, 3191], '(Sigma),': [3028], 'essentially': [3029], '(28Skelly': [3033], 'Dougan': [3035], 'P.M.': [3036], 'Maule': [3037], 'Day': [3039], 'T.A.': [3040], '123:': [3045], '277-284Crossref': [3046], '(13)': [3049], 'Scholar).Immunogold': [3051], 'Electron': [3054], 'Microscopy—Freshly': [3055], 'perfused': [3056], 'fixed': [3060], 'overnight': [3061], '2%': [3063], 'glutaraldehyde': [3064], '0.1': [3066], 'm': [3067], 'cacodylate': [3068], 'samples': [3074, 3455], 'dehydrated': [3077], 'graded': [3080], 'series': [3081], 'ethanol,': [3083], 'infiltrated': [3085], 'embedded': [3087], 'acrylic': [3092], 'resin.': [3093], 'Ultramicrotomy': [3094], 'performed': [3096, 3364], 'Leica': [3099], 'Ultracut': [3100], 'R': [3101], 'ultramicrotome': [3102], 'collected': [3106], 'gold': [3108], 'grids.': [3109], 'Grids': [3110], 'immunolabeled': [3112], 'step': [3116], 'method': [3117, 3333, 3479], 'according': [3118], 'procedure;': [3122], 'grids': [3124, 3159, 3210], 'conditioned': [3126], 'PBS': [3128, 3178], '5': [3130], '×3': [3132], 'room': [3134, 3147, 3172, 3201], 'temperature,': [3135, 3173, 3202], 'followed': [3136, 3174], 'blocking': [3139], 'nonspecific': [3141], 'labeling': [3142], '30': [3144], 'temperature': [3148], 'nonfat': [3151], 'dry': [3152], 'milk': [3153], 'PBS.': [3155], 'After': [3156], 'rinsing,': [3157], 'diluted': [3166, 3186], '1:30': [3167, 3187], 'washing': [3176], 'secondary': [3184], '(10': [3188], 'nm': [3189], 'gold-labeled': [3190], '(H&L,': [3194], 'finally': [3204], 'rinsed': [3205], 'thoroughly': [3206], 'water.': [3208], 'osmium': [3214], 'vapor': [3215], 'and/or': [3216], 'lightly': [3217], 'lead': [3220], 'citrate': [3221], 'improve': [3223], 'contrast': [3224], 'photographed': [3229], 'Philips': [3232], 'CM': [3233], 'microscope': [3236], '80': [3238, 3798], 'KV.Developmental': [3239], 'qRT-PCR—Relative': [3244], 'measured': [3257], 'TaqMan': [3259], 'Assay': [3262], '(Applied': [3263], 'Biosystems).': [3264], 'examined:': [3271], 'eggs,': [3272], 'females.': [3279], 'schistosomula': [3281], 'culture': [3285], 'Hepes,': [3296], 'total': [3323, 3343, 3372], 'RNA': [3324, 3373, 4237, 4242], 'extracted': [3326], 'TRIzol': [3332], '(Invitrogen),': [3334], 'RNA,': [3344], 'pre-treated': [3345], 'TurboDNase': [3347], '(Ambion,': [3348], 'TX),': [3349], 'reverse-transcribed': [3351], 'random': [3355], 'hexamers': [3356], 'Superscript': [3358], 'reverse': [3359], 'transcriptase': [3360], '(Invitrogen).': [3361], 'qRT-PCR': [3362], 'derived': [3367], 'primer': [3375], 'sets/reporter': [3376], 'probes': [3377], 'labeled': [3378], '6-carboxyfluorescein': [3380], '(FAM),': [3381], 'custom': [3382], 'Applied': [3385], 'Biosystems': [3386], '(Foster': [3387], 'City,': [3388], 'CA).': [3389], 'primers': [3394, 3422], 'probe': [3396, 3424], 'used:': [3398, 3426], 'SPRM1HC3PM-HCP3F,': [3399], '5′-GCTTTGGCTTCCACGTTTCTG-3′': [3400], 'SPRM1HC3PM-HCP3R,': [3402], '5′-CGTTTCCTCATTTAACTCCGAACCA-3′': [3403], 'FAM-labeled': [3406, 3434], 'probe,': [3407, 3435], 'SPRM1HC3PM-HCP3M1,': [3408], '5′-FAM-CTTCCAGGCACTTCTC-3′;': [3409], 'control': [3413], 'triosephosphate': [3416, 3892], 'isomerase': [3417, 3893], '(SmTPI)': [3418], 'SMTPI-TPI3F,': [3427], '5′-CATACTTGGACATTCTGAGCGTAGA-3′': [3428], 'SMTPI-TPI3R,': [3430], '5′-ACCTTCAGCAAGTGCATGTTGA-3′': [3431], 'SMTPI-TPI3M2,': [3436], '5′-FAM-CAATAAGTTCATCAGATTCAC-3′.': [3437], 'Probe': [3438], 'positions': [3439, 3902], 'designed': [3441], 'exon/exon': [3444], 'boundaries': [3445], 'minimize': [3447], 'any': [3450], 'contaminating': [3451], 'run': [3457], 'triplicate': [3459], 'underwent': [3461], '45': [3462], 'amplification': [3463], 'cycles': [3464], '7500': [3467], 'ABI': [3468], 'PRISM®': [3469], 'Sequence': [3470, 3924], 'Detection': [3471], 'System': [3472], 'Instrument.': [3473], 'relative': [3475, 3771], 'quantification,': [3476], 'ΔΔCt': [3478], 'employed': [3481], '(29Livak': [3482], 'K.J.': [3483], 'Schmittgen': [3484], 'T.D.': [3485], 'Methods.': [3486], '25:': [3488, 3938], '402-408Crossref': [3489], '(118788)': [3492], 'Scholar).RESULTSThe': [3494], 'cDNA—Prior': [3498], 'studies': [3499], 'showed': [3500], 'glycoprotein': [3511, 3526], '(gpaATs)': [3518], 'requires': [3520], 'association': [3521], 'belonging': [3527], 'ESTs': [3538], 'nearly': [3541], 'extensively': [3551], 'searched': [3552], 'rBAT,': [3558, 3846], 'representing': [3559], 'classes': [3562], 'known': [3569], 'gpaATs.': [3573], 'putative': [3577, 4165, 4174], 'named': [3585], '(schistosome': [3587], 'chain).': [3591], 'mRNA': [3602], 'RT-PCR,': [3604], 'permitted': [3606], 'structure.': [3611], 'map': [3613], 'shown': [3619, 3747, 3915, 4039], '1A.': [3622], '6.56': [3626], 'kb,': [3627], 'one-third': [3629], 'possesses': [3636], '9': [3637], 'introns': [3638, 3645, 3660], 'exons.': [3641], 'small': [3647], '(32–42': [3648], 'bp);': [3649], 'remaining': [3651], 'vary': [3653], '1.02': [3655], '1.95': [3657], 'kb.': [3658], 'conventional': [3662], 'GT:AG': [3663], 'intron': [3664], 'donor:': [3665], 'acceptor': [3666], 'sites': [3667, 4159], 'composed': [3670], '∼65%': [3672], 'A+T': [3673], '(range': [3675, 3686], '60–75%).': [3676], 'Exon': [3677], 'size': [3678], 'varies': [3679], '120–370': [3681], 'bp': [3682], '∼58%': [3684], 'AT': [3685], '54–63%).': [3687], 'Searching': [3688], 'databases': [3693], 'additional': [3695], 'unsuccessful.': [3700], 'GenBank™': [3702, 3766, 3829], 'reported': [3711], 'here': [3712], 'EF204542.The': [3714], '640': [3719], 'long,': [3722], '71,645': [3728], 'daltons': [3729], 'pI': [3732], '5.05.': [3734], 'other': [3744, 3820], 'species': [3745], '(and': [3763], 'SjPRM1hc,': [3765], 'EF204543)': [3769], 'base': [3778], 'entry': [3779], 'AAW26021.1),': [3783], 'polymorphisms': [3786], 'errors': [3789], '(not': [3790], 'shown).': [3791], 'SmPRM1hc': [3792], 'nucleotide': [3793], '79%': [3800], 'identical': [3801], 'respectively.': [3804], 'Not': [3805], 'surprisingly,': [3806], 'considerably': [3807], 'lower': [3808], 'evident': [3812], 'organisms': [3821], 'e.g.': [3822], 'humans': [3823], 'Caenorhabditis': [3825], 'elegans': [3826], '(all': [3827], '∼20%).': [3828], 'numbers': [3831], 'compared': [3839], 'follows:': [3845], 'AAH93626;': [3847], 'h4F2hc,': [3848], 'NP': [3849], '001013269;': [3850], 'Ce': [3851], 'BAT': [3852], '(ATG1)': [3853], 'CAB02316.All': [3854], '(TM)': [3867], 'domain.': [3868], 'addition,': [3870], 'display': [3878], 'what': [3879], 'TIM': [3883, 3895, 3911], 'barrel': [3884, 4148], '(because': [3885], 'domain': [3887, 3912, 4054, 4154], 'enzymes).': [3894], 'barrels': [3896], 'assume': [3897], 'conformation.': [3900], 'α-helices': [3905], 'β-sheet': [3907], 'motifs': [3908], '1B': [3918], 'Network': [3922], 'Protein': [3923], '(30Combet': [3926], 'Blanchet': [3928], 'Geourjon': [3930], 'Deleage': [3932], 'G.': [3933], 'Trends': [3934], '147-150Abstract': [3939], '(1409)': [3947], 'triad': [3958], 'position': [3960], 'Asp278,': [3961], 'Glu332,': [3962], 'Asp408,': [3964], 'arrows': [3965], '2).': [3967], 'conserved': [3969], '(Cys89,': [3972], 'arrowhead,': [3973], '1B)': [3975], 'cross-link': [3979], 'partner': [3986], '(SPRM1lc)': [3987], 'demonstrated': [3994], 'topology': [4023, 4055, 4140], 'model': [4024, 4044, 4141], 'complexed': [4027], '(collectively': [4035], 'SPRM1),': [4037], '2.': [4042], 'SPRM1hc/SPRM1lc': [4047, 4144], 'based': [4050], '12-transmembrane': [4053], 'proposed': [4056], 'TMpred': [4058], 'fact': [4088], 'extracellular': [4091], 'involved': [4094, 4177], 'bridge': [4098], '4F2hc': [4101], 'heterologous': [4102], 'located': [4106], 'loop': [4109], 'helices': [4113], 'Scholar).FIGURE': [4138], '2Membrane': [4139], 'heterodimer.': [4145], 'gray': [4147], 'represents': [4149], 'Potential': [4157], 'N-glycosylation': [4158], 'forks.': [4163], 'domains': [4167], 'numbered': [4171], '1–12.': [4172], 'linkage': [4180], 'circled.': [4182], 'OUT': [4183], 'indicates': [4184], 'exterior': [4186], 'cell;': [4189], 'IN': [4190], 'interior.View': [4191], 'Large': [4192], 'Figure': [4194], 'ViewerDownload': [4195], 'Hi-res': [4196], 'image': [4197], 'Download': [4198], '(PPT)Expression': [4199], 'Functional': [4201], 'Characterization': [4202], 'Oocytes—Amino': [4207], 'characteristics': [4210], 'studied': [4212], 'combination': [4219], '(Fig.': [4228], '3A).': [4229], 'It': [4230], 'clear': [4232]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W2035425520', 'counts_by_year': [{'year': 2024, 'cited_by_count': 2}, {'year': 2023, 'cited_by_count': 2}, {'year': 2022, 'cited_by_count': 3}, {'year': 2021, 'cited_by_count': 5}, {'year': 2020, 'cited_by_count': 1}, {'year': 2019, 'cited_by_count': 4}, {'year': 2017, 'cited_by_count': 1}, {'year': 2016, 'cited_by_count': 3}, {'year': 2014, 'cited_by_count': 4}, {'year': 2013, 'cited_by_count': 4}, {'year': 2012, 'cited_by_count': 4}], 'updated_date': '2025-01-20T17:14:52.526155', 'created_date': '2016-06-24'}