Publication Information

{'id': 'https://openalex.org/W2032981041', 'doi': 'https://doi.org/10.1074/jbc.m513094200', 'title': 'c-Met Expression Is Regulated by Mitf in the Melanocyte Lineage', 'display_name': 'c-Met Expression Is Regulated by Mitf in the Melanocyte Lineage', 'publication_year': 2006, 'publication_date': '2006-02-03', 'ids': {'openalex': 'https://openalex.org/W2032981041', 'doi': 'https://doi.org/10.1074/jbc.m513094200', 'mag': '2032981041', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/16455654'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m513094200', 'pdf_url': 'http://www.jbc.org/article/S002192581956389X/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S002192581956389X/pdf', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5080088481', 'display_name': 'Gaël McGill', 'orcid': 'https://orcid.org/0000-0003-2264-0132'}, 'institutions': [{'id': 'https://openalex.org/I4210117453', 'display_name': 'Dana-Farber Cancer Institute', 'ror': 'https://ror.org/02jzgtq86', 'country_code': 'US', 'type': 'facility', 'lineage': ['https://openalex.org/I4210117453']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Gaël G. McGill', 'raw_affiliation_strings': ['Department of Pediatric Oncology, Dana Farber Cancer Institute, Boston, Massachusetts 02115'], 'affiliations': [{'raw_affiliation_string': 'Department of Pediatric Oncology, Dana Farber Cancer Institute, Boston, Massachusetts 02115', 'institution_ids': ['https://openalex.org/I4210117453']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5091053901', 'display_name': 'Rizwan Haq', 'orcid': 'https://orcid.org/0000-0002-1290-9276'}, 'institutions': [{'id': 'https://openalex.org/I4210150714', 'display_name': 'Johns Hopkins Hospital', 'ror': 'https://ror.org/05cb1k848', 'country_code': 'US', 'type': 'healthcare', 'lineage': ['https://openalex.org/I2799853436', 'https://openalex.org/I4210150714']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Rizwan Haq', 'raw_affiliation_strings': ['Department of Internal Medicine, Johns Hopkins Hospital, Baltimore, Maryland 21205'], 'affiliations': [{'raw_affiliation_string': 'Department of Internal Medicine, Johns Hopkins Hospital, Baltimore, Maryland 21205', 'institution_ids': ['https://openalex.org/I4210150714']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5017288867', 'display_name': 'Emi K. Nishimura', 'orcid': 'https://orcid.org/0000-0002-5767-8045'}, 'institutions': [{'id': 'https://openalex.org/I205349734', 'display_name': 'Hokkaido University', 'ror': 'https://ror.org/02e16g702', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I205349734']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Emi K. Nishimura', 'raw_affiliation_strings': ['Department of Dermatology and Creative Research Institute Sousei, Hokkaido University Graduate School of Medicine, N15, W7, Kita-ku Sapporo 060-8638, Japan'], 'affiliations': [{'raw_affiliation_string': 'Department of Dermatology and Creative Research Institute Sousei, Hokkaido University Graduate School of Medicine, N15, W7, Kita-ku Sapporo 060-8638, Japan', 'institution_ids': ['https://openalex.org/I205349734']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5078874539', 'display_name': 'David E. Fisher', 'orcid': 'https://orcid.org/0000-0002-5506-0575'}, 'institutions': [{'id': 'https://openalex.org/I4210117453', 'display_name': 'Dana-Farber Cancer Institute', 'ror': 'https://ror.org/02jzgtq86', 'country_code': 'US', 'type': 'facility', 'lineage': ['https://openalex.org/I4210117453']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'David E. Fisher', 'raw_affiliation_strings': ['Department of Pediatric Oncology, Dana Farber Cancer Institute, Boston, Massachusetts 02115'], 'affiliations': [{'raw_affiliation_string': 'Department of Pediatric Oncology, Dana Farber Cancer Institute, Boston, Massachusetts 02115', 'institution_ids': ['https://openalex.org/I4210117453']}]}], 'institution_assertions': [], 'countries_distinct_count': 2, 'institutions_distinct_count': 3, 'corresponding_author_ids': [], 'corresponding_institution_ids': [], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 7.636, 'has_fulltext': True, 'fulltext_origin': 'ngrams', 'cited_by_count': 169, 'citation_normalized_percentile': {'value': 0.999759, 'is_in_top_1_percent': True, 'is_in_top_10_percent': True}, 'cited_by_percentile_year': {'min': 98, 'max': 99}, 'biblio': {'volume': '281', 'issue': '15', 'first_page': '10365', 'last_page': '10373'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T10966', 'display_name': 'Liver physiology and pathology', 'score': 0.9996, 'subfield': {'id': 'https://openalex.org/subfields/2721', 'display_name': 'Hepatology'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, 'topics': [{'id': 'https://openalex.org/T10966', 'display_name': 'Liver physiology and pathology', 'score': 0.9996, 'subfield': {'id': 'https://openalex.org/subfields/2721', 'display_name': 'Hepatology'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, {'id': 'https://openalex.org/T10580', 'display_name': 'Immunotherapy and Immune Responses', 'score': 0.9971, 'subfield': {'id': 'https://openalex.org/subfields/2403', 'display_name': 'Immunology'}, 'field': {'id': 'https://openalex.org/fields/24', 'display_name': 'Immunology and Microbiology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T10952', 'display_name': 'PI3K/AKT/mTOR signaling in cancer', 'score': 0.9966, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/microphthalmia-associated-transcription-factor', 'display_name': 'Microphthalmia-associated transcription factor', 'score': 0.9887943}, {'id': 'https://openalex.org/keywords/melanocyte', 'display_name': 'Melanocyte', 'score': 0.68682885}, {'id': 'https://openalex.org/keywords/chromatin-immunoprecipitation', 'display_name': 'Chromatin immunoprecipitation', 'score': 0.46302903}], 'concepts': [{'id': 'https://openalex.org/C177504595', 'wikidata': 'https://www.wikidata.org/wiki/Q336500', 'display_name': 'Microphthalmia-associated transcription factor', 'level': 4, 'score': 0.9887943}, {'id': 'https://openalex.org/C2776996007', 'wikidata': 'https://www.wikidata.org/wiki/Q2399112', 'display_name': 'Hepatocyte growth factor', 'level': 3, 'score': 0.6970874}, {'id': 'https://openalex.org/C2779769559', 'wikidata': 'https://www.wikidata.org/wiki/Q247101', 'display_name': 'Melanocyte', 'level': 3, 'score': 0.68682885}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.62510026}, {'id': 'https://openalex.org/C2777658100', 'wikidata': 'https://www.wikidata.org/wiki/Q180614', 'display_name': 'Melanoma', 'level': 2, 'score': 0.6193155}, {'id': 'https://openalex.org/C95444343', 'wikidata': 'https://www.wikidata.org/wiki/Q7141', 'display_name': 'Cell biology', 'level': 1, 'score': 0.52007407}, {'id': 'https://openalex.org/C502942594', 'wikidata': 'https://www.wikidata.org/wiki/Q3421914', 'display_name': 'Cancer research', 'level': 1, 'score': 0.5165064}, {'id': 'https://openalex.org/C134320426', 'wikidata': 'https://www.wikidata.org/wiki/Q901026', 'display_name': 'Chromatin immunoprecipitation', 'level': 5, 'score': 0.46302903}, {'id': 'https://openalex.org/C16613235', 'wikidata': 'https://www.wikidata.org/wiki/Q285982', 'display_name': 'Endogeny', 'level': 2, 'score': 0.42626423}, {'id': 'https://openalex.org/C62478195', 'wikidata': 'https://www.wikidata.org/wiki/Q828130', 'display_name': 'Signal transduction', 'level': 2, 'score': 0.42066562}, {'id': 'https://openalex.org/C170493617', 'wikidata': 'https://www.wikidata.org/wiki/Q208467', 'display_name': 'Receptor', 'level': 2, 'score': 0.40354368}, {'id': 'https://openalex.org/C86339819', 'wikidata': 'https://www.wikidata.org/wiki/Q407384', 'display_name': 'Transcription factor', 'level': 3, 'score': 0.34372327}, {'id': 'https://openalex.org/C150194340', 'wikidata': 'https://www.wikidata.org/wiki/Q26972', 'display_name': 'Gene expression', 'level': 3, 'score': 0.22152975}, {'id': 'https://openalex.org/C134018914', 'wikidata': 'https://www.wikidata.org/wiki/Q162606', 'display_name': 'Endocrinology', 'level': 1, 'score': 0.20087975}, {'id': 'https://openalex.org/C104317684', 'wikidata': 'https://www.wikidata.org/wiki/Q7187', 'display_name': 'Gene', 'level': 2, 'score': 0.1444785}, {'id': 'https://openalex.org/C54355233', 'wikidata': 'https://www.wikidata.org/wiki/Q7162', 'display_name': 'Genetics', 'level': 1, 'score': 0.12486744}, {'id': 'https://openalex.org/C101762097', 'wikidata': 'https://www.wikidata.org/wiki/Q224093', 'display_name': 'Promoter', 'level': 4, 'score': 0.10123736}], 'mesh': [{'descriptor_ui': 'D008544', 'descriptor_name': 'Melanocytes', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D051739', 'descriptor_name': 'Microphthalmia-Associated Transcription Factor', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D019859', 'descriptor_name': 'Proto-Oncogene Proteins c-met', 'qualifier_ui': 'Q000737', 'qualifier_name': 'chemistry', 'is_major_topic': True}, {'descriptor_ui': 'D000256', 'descriptor_name': 'Adenoviridae', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D000256', 'descriptor_name': 'Adenoviridae', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D000256', 'descriptor_name': 'Adenoviridae', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D015153', 'descriptor_name': 'Blotting, Western', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D045744', 'descriptor_name': 'Cell Line, Tumor', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D019070', 'descriptor_name': 'Cell Lineage', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002467', 'descriptor_name': 'Cell Nucleus', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002467', 'descriptor_name': 'Cell Nucleus', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D002478', 'descriptor_name': 'Cells, Cultured', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D047369', 'descriptor_name': 'Chromatin Immunoprecipitation', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D017931', 'descriptor_name': 'DNA Primers', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D017931', 'descriptor_name': 'DNA Primers', 'qualifier_ui': 'Q000737', 'qualifier_name': 'chemistry', 'is_major_topic': False}, {'descriptor_ui': 'D005786', 'descriptor_name': 'Gene Expression Regulation', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D005799', 'descriptor_name': 'Genes, Dominant', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D017228', 'descriptor_name': 'Hepatocyte Growth Factor', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D017228', 'descriptor_name': 'Hepatocyte Growth Factor', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D006801', 'descriptor_name': 'Humans', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D015151', 'descriptor_name': 'Immunoblotting', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D007700', 'descriptor_name': 'Kinetics', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D020935', 'descriptor_name': 'MAP Kinase Signaling System', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008544', 'descriptor_name': 'Melanocytes', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008545', 'descriptor_name': 'Melanoma', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008545', 'descriptor_name': 'Melanoma', 'qualifier_ui': 'Q000473', 'qualifier_name': 'pathology', 'is_major_topic': False}, {'descriptor_ui': 'D008545', 'descriptor_name': 'Melanoma', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D051739', 'descriptor_name': 'Microphthalmia-Associated Transcription Factor', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008957', 'descriptor_name': 'Models, Genetic', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D009362', 'descriptor_name': 'Neoplasm Metastasis', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D010766', 'descriptor_name': 'Phosphorylation', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011485', 'descriptor_name': 'Protein Binding', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D019859', 'descriptor_name': 'Proto-Oncogene Proteins c-met', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D019859', 'descriptor_name': 'Proto-Oncogene Proteins c-met', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D020133', 'descriptor_name': 'Reverse Transcriptase Polymerase Chain Reaction', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D013997', 'descriptor_name': 'Time Factors', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D014158', 'descriptor_name': 'Transcription, Genetic', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D015854', 'descriptor_name': 'Up-Regulation', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}], 'locations_count': 2, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m513094200', 'pdf_url': 'http://www.jbc.org/article/S002192581956389X/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/16455654', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m513094200', 'pdf_url': 'http://www.jbc.org/article/S002192581956389X/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 57, 'referenced_works': ['https://openalex.org/W1487917997', 'https://openalex.org/W1493098692', 'https://openalex.org/W1502227906', 'https://openalex.org/W1533729577', 'https://openalex.org/W1545126968', 'https://openalex.org/W1585473102', 'https://openalex.org/W1645372843', 'https://openalex.org/W1883936019', 'https://openalex.org/W1902464118', 'https://openalex.org/W1909795006', 'https://openalex.org/W1966467063', 'https://openalex.org/W1972607682', 'https://openalex.org/W1978514461', 'https://openalex.org/W1985737377', 'https://openalex.org/W1987090963', 'https://openalex.org/W1988407228', 'https://openalex.org/W1990244564', 'https://openalex.org/W1993781672', 'https://openalex.org/W1994108115', 'https://openalex.org/W2002918515', 'https://openalex.org/W2004266019', 'https://openalex.org/W2006623494', 'https://openalex.org/W2010980929', 'https://openalex.org/W2012792646', 'https://openalex.org/W2015009944', 'https://openalex.org/W2015721987', 'https://openalex.org/W2033182545', 'https://openalex.org/W2036347938', 'https://openalex.org/W2037968180', 'https://openalex.org/W2041226742', 'https://openalex.org/W2050274692', 'https://openalex.org/W2050983091', 'https://openalex.org/W2051390386', 'https://openalex.org/W2051718122', 'https://openalex.org/W2055972315', 'https://openalex.org/W2067611598', 'https://openalex.org/W2075650416', 'https://openalex.org/W2087352606', 'https://openalex.org/W2095107795', 'https://openalex.org/W2111624152', 'https://openalex.org/W2116459577', 'https://openalex.org/W2121571446', 'https://openalex.org/W2122711551', 'https://openalex.org/W2124214914', 'https://openalex.org/W2127672664', 'https://openalex.org/W2133608451', 'https://openalex.org/W2134230637', 'https://openalex.org/W2136390065', 'https://openalex.org/W2145297890', 'https://openalex.org/W2159299286', 'https://openalex.org/W2170256288', 'https://openalex.org/W2239909057', 'https://openalex.org/W2333824332', 'https://openalex.org/W2403016536', 'https://openalex.org/W2419439415', 'https://openalex.org/W2469774111', 'https://openalex.org/W4285719527'], 'related_works': ['https://openalex.org/W4281715147', 'https://openalex.org/W3080678070', 'https://openalex.org/W2774364465', 'https://openalex.org/W2377541619', 'https://openalex.org/W2290255184', 'https://openalex.org/W2230525423', 'https://openalex.org/W2124173513', 'https://openalex.org/W2104467529', 'https://openalex.org/W2051718122', 'https://openalex.org/W1552053194'], 'abstract_inverted_index': {'Hepatocyte': [0, 137], 'growth': [1, 138, 356, 398, 407, 416, 447, 2009, 2256], 'factor': [2, 139, 408, 1948, 2210], '(HGF)/c-Met': [3, 140], 'signaling': [4, 141, 277, 862, 1046, 1125, 1152, 1285, 1933, 4131], 'is': [5, 47, 142, 184, 494, 543, 769, 785, 793, 972, 1132, 1140, 1408, 1609, 1655, 1696, 1755, 1801, 1867, 3663, 4306], 'thought': [6, 143], 'to': [7, 26, 33, 76, 121, 144, 163, 170, 213, 258, 396, 439, 536, 557, 751, 766, 772, 974, 1111, 1119, 1287, 1652, 1707, 1731, 1739, 1950, 2006, 2178, 2197, 2244, 2398, 2581, 2595, 2709, 2733, 2775, 2817, 2854, 2918, 2942, 2992, 3129, 3171, 3185, 3323, 3434, 3630, 3647, 3659, 3665, 3702, 3821, 3893, 3912, 3938, 3969, 3976, 3982, 4053, 4198, 4348], 'be': [8, 145, 935, 1154, 2019, 2818, 3385, 3703], 'a': [9, 48, 126, 146, 185, 263, 441, 495, 504, 650, 1042, 1277, 1321, 1328, 1684, 1690, 1871, 1987, 2029, 2038, 2188, 2666, 2773, 2871, 2895, 2916, 2919, 2936, 2988, 3279, 3299, 3404, 3467, 3579, 3678, 3728, 3832, 3901, 3913, 4062, 4076, 4224, 4286], 'key': [10, 147, 340, 442, 1133, 1334, 1720], 'pathway': [11, 131, 148, 268, 654, 757, 2815, 2852, 3011, 4297], 'in': [12, 82, 90, 113, 132, 149, 219, 227, 250, 269, 282, 325, 346, 354, 446, 450, 503, 508, 540, 545, 623, 629, 635, 641, 655, 758, 764, 776, 787, 796, 838, 863, 873, 886, 926, 968, 986, 1148, 1156, 1406, 1418, 1425, 1434, 1548, 1594, 1687, 1701, 1713, 1753, 1757, 1764, 1805, 1870, 1965, 1983, 2016, 2037, 2062, 2110, 2131, 2226, 2287, 2359, 2441, 2566, 2630, 2648, 2680, 2704, 2721, 2796, 2802, 2877, 2898, 3040, 3156, 3161, 3178, 3193, 3260, 3382, 3394, 3437, 3463, 3537, 3549, 3560, 3669, 3693, 3814, 3838, 3906, 3910, 4043, 4100, 4107, 4179, 4298, 4329, 4339], 'both': [13, 150, 2974, 3536, 3705, 3781, 4340], 'melanocyte': [14, 151, 289, 308, 326, 1721, 2821, 3756], 'development': [15, 134, 152, 271, 284, 627, 760], 'and': [16, 94, 118, 135, 153, 231, 255, 272, 285, 316, 349, 399, 402, 424, 501, 516, 552, 628, 791, 821, 921, 1053, 1063, 1066, 1144, 1341, 1553, 1645, 1698, 1728, 1943, 1968, 2013, 2048, 2094, 2120, 2125, 2142, 2176, 2216, 2258, 2272, 2285, 2337, 2407, 2420, 2447, 2456, 2469, 2551, 2556, 2575, 2587, 2611, 2643, 2682, 2770, 2783, 2809, 2884, 2928, 2971, 2976, 3026, 3030, 3159, 3248, 3326, 3397, 3542, 3597, 3617, 3710, 3783, 3816, 3828, 3837, 3925, 3932, 3995, 4001, 4021, 4038, 4060, 4113, 4139, 4150, 4153, 4155, 4160, 4312], 'melanoma': [17, 119, 154, 256, 1649, 1944, 2014, 2035, 2106, 2127, 2219, 2283, 2354, 2907, 3158, 3263, 3268, 3426, 3613, 3829, 3898, 3917, 4140, 4203], 'metastasis.': [18, 155, 1688], 'Here,': [19, 156, 1922], 'HGF': [20, 39, 99, 157, 176, 236, 553, 639, 723, 768, 792, 880, 890, 938, 970, 1033, 1547, 1552, 1663, 1989, 2005, 2435, 2732, 2805, 2869, 2933, 3140, 3181, 3253, 3277, 3307, 3320, 3428, 3894, 3941, 4024, 4122, 4143, 4168], 'stimulation': [21, 158, 1939, 2265, 2436, 3254, 3321, 3429, 4136, 4354], 'of': [22, 52, 61, 72, 85, 110, 116, 159, 189, 198, 209, 222, 247, 253, 276, 287, 302, 338, 357, 426, 454, 498, 506, 512, 520, 532, 550, 618, 621, 644, 761, 818, 867, 888, 923, 1044, 1051, 1068, 1116, 1123, 1272, 1279, 1281, 1291, 1319, 1323, 1546, 1597, 1603, 1648, 1693, 1719, 1744, 1751, 1761, 1799, 1808, 1874, 1930, 1940, 1992, 2004, 2011, 2023, 2207, 2239, 2347, 2402, 2501, 2724, 2731, 2737, 2745, 2788, 2836, 2839, 2857, 2863, 2873, 2880, 2946, 2963, 2985, 3017, 3050, 3111, 3125, 3136, 3143, 3166, 3281, 3312, 3339, 3390, 3417, 3430, 3466, 3531, 3540, 3552, 3564, 3584, 3639, 3727, 3731, 3750, 3770, 3807, 3826, 3834, 3887, 3915, 3953, 3986, 3997, 4040, 4057, 4064, 4098, 4111, 4119, 4129, 4137, 4202, 4294, 4332, 4355], 'melanocytes': [23, 117, 160, 254, 359, 394, 868, 885, 995, 1702, 1754, 1763, 1942, 2012, 2044, 2215, 2866, 2900, 2959, 3261, 3273, 3432, 3827, 3890, 3955, 4112, 4138], 'was': [24, 55, 161, 192, 2250, 2323, 2356, 2392, 2462, 2545, 2655, 2749, 2923, 3452, 3460, 3569, 3634, 3682, 3700, 3778, 3979], 'seen': [25, 162, 3991], 'up-regulate': [27, 164], 'c-Met': [28, 46, 64, 79, 92, 165, 183, 201, 216, 229, 401, 490, 521, 551, 622, 682, 783, 1038, 1052, 1404, 1429, 1555, 1560, 1614, 1654, 1695, 1970, 1980, 1995, 2882, 3032, 3146, 3150, 3174, 3187, 3258, 3287, 3328, 3383, 3399, 3438, 3459, 3545, 3577, 3595, 3667, 3679, 3800, 3943, 4120, 4124, 4158, 4170, 4181, 4192, 4305, 4322], 'expression.': [29, 166, 2584, 3600], 'In': [30, 167, 1316, 4285], 'an': [31, 168, 460, 752, 984, 2569, 2890, 3038, 3435, 3692], 'effort': [32, 169], 'decipher': [34, 171], 'the': [35, 62, 70, 172, 199, 207, 283, 288, 292, 300, 314, 392, 451, 489, 517, 537, 546, 619, 630, 759, 819, 839, 864, 919, 975, 978, 1029, 1057, 1113, 1120, 1129, 1136, 1288, 1292, 1317, 1324, 1401, 1420, 1607, 1734, 1758, 1864, 1954, 1966, 2002, 2198, 2205, 2208, 2248, 2261, 2320, 2328, 2399, 2411, 2465, 2512, 2548, 2719, 2735, 2743, 2746, 2760, 2789, 2813, 2834, 2850, 2881, 2943, 3000, 3007, 3018, 3022, 3117, 3123, 3126, 3131, 3162, 3190, 3340, 3379, 3391, 3395, 3418, 3464, 3525, 3538, 3550, 3593, 3621, 3631, 3637, 3649, 3666, 3674, 3707, 3712, 3715, 3718, 3732, 3771, 3823, 3884, 3987, 3993, 4033, 4036, 4054, 4058, 4092, 4130, 4165, 4295, 4330], 'mechanism': [36, 173, 1031, 3302], 'by': [37, 69, 174, 206, 1612, 1975, 2054, 2252, 2427, 2471, 2684, 3122, 3775, 3992, 4148, 4308], 'which': [38, 175, 541, 969, 1977, 3306], 'up-regulates': [40, 177], 'its': [41, 101, 178, 238, 403, 533, 1423, 1931, 1993, 2823, 3313, 3599, 4117], 'receptor,': [42, 179], 'we': [43, 180, 1923, 1999, 2847, 2956, 3169, 3250, 3284, 3376, 3752, 3881, 3920, 3947, 4133, 4301], 'found': [44, 181, 786, 1937, 2860, 2972], 'that': [45, 98, 182, 235, 306, 685, 720, 831, 1332, 1403, 1601, 1678, 1938, 1972, 2001, 2756, 2861, 2951, 2973, 2997, 3286, 3298, 3319, 3334, 3883, 3927, 3999, 4048, 4091, 4167, 4226, 4304, 4338, 4353], 'direct': [49, 186, 2267], 'transcriptional': [50, 187, 3191, 3341, 3419, 3450, 4291], 'target': [51, 188], 'Mitf.': [53, 106, 190, 243, 1935, 1997, 2025, 2388, 2858, 3388, 3958, 4172], 'This': [54, 191, 2026, 3113, 3295, 3698, 3908], 'confirmed': [56, 193, 2996, 3031], 'with': [57, 194, 633, 937, 1150, 1265, 1410, 1558, 1946, 2021, 2034, 2115, 2137, 2223, 2230, 2327, 2598, 2625, 2645, 2662, 2665, 2867, 2889, 2939, 2960, 3275, 3291, 3331, 3425, 3521, 3592, 3758, 4014, 4023, 4032, 4142, 4164, 4205, 4320], 'chromatin': [58, 195, 3689], 'immunoprecipitation': [59, 196, 2346, 3019, 3035, 3654], 'experiments': [60, 197, 634, 679, 2799, 3655], 'human': [63, 200, 979, 1435, 1810, 1967, 2043, 2105, 2182, 2214, 2218, 2282, 2348, 2353, 2403, 2412, 2864, 3157, 3267, 3272, 3396, 3755, 3889], 'promoter,': [65, 202], 'as': [66, 68, 203, 205, 459, 579, 581, 990, 992, 1276, 1606, 1706, 1724, 2200, 2291, 2358, 2480, 2482, 2845, 2903, 2905, 3006, 3045, 3120, 3990, 4319], 'well': [67, 204, 580, 991, 2481, 2904], 'ability': [71, 208, 2003, 3124, 3638], 'adenovirally': [73, 210], 'expressed': [74, 211, 544, 795, 1697], 'Mitf': [75, 86, 111, 212, 223, 248, 1738, 1752, 1800, 1865, 1951, 1961, 2807, 2837, 2893, 2912, 2952, 2978, 2986, 3005, 3024, 3052, 3105, 3137, 3324, 3335, 3408, 3456, 3532, 3557, 3567, 3589, 3615, 3623, 3662, 3675, 3685, 3725, 3744, 3773, 3810, 3965, 4019, 4106, 4151, 4177, 4229, 4346], 'modulate': [77, 214, 3747], 'endogenous': [78, 91, 215, 228, 1554, 2024, 3594, 3748, 3799], 'protein': [80, 95, 217, 232, 420, 2191, 2589, 2965, 3288, 3329, 3526, 3546, 3801], 'levels': [81, 104, 218, 241, 1982, 1991, 2578, 2979, 3151, 3175, 3188, 3289, 3311, 3330, 3441, 3749, 3802, 3944, 4193], 'melanocytes.': [83, 220, 1426, 1985], 'Disruption': [84, 221], 'blocked': [87, 224, 2624], 'HGF-dependent': [88, 122, 225, 259, 3102, 3380, 3812, 3903, 3950], 'increases': [89, 226, 3327], 'message': [93, 230, 2544, 2577, 3440, 4159], 'levels,': [96, 233], 'indicating': [97, 234], 'regulates': [100, 237, 1979, 1990, 3598, 3942, 4169], 'own': [102, 239, 3314], 'receptor': [103, 240, 491, 1268, 1293, 1339, 1710, 1994, 2840, 2883, 3033, 3439], 'via': [105, 242, 1953, 2811, 3116, 3147, 3533, 3945, 4126, 4171], 'Finally,': [107, 244, 1998, 3044], 'dominant-negative': [108, 245, 3514, 3543, 3556, 3784, 3961, 3988, 4018, 4333], 'inhibition': [109, 246, 2027], 'resulted': [112, 249], 'profound': [114, 251], 'resistance': [115, 252], 'cells': [120, 257, 1650, 1659, 1945, 2015, 2107, 2220, 2284, 2355, 2438, 2714, 2755, 2765, 2908, 3269, 3561, 3830, 3899, 3998, 4012, 4042, 4059, 4141, 4204], 'matrix': [123, 260, 4109], 'invasion,': [124, 261], 'suggesting': [125, 262, 1677, 2935, 3691], 'physiologic': [127, 264], 'role': [128, 265, 443, 620, 651, 754, 859, 1686, 1750], 'for': [129, 266, 312, 351, 652, 755, 824, 860, 1134, 1142, 2032, 2234, 2260, 2444, 2491, 2508, 2539, 2659, 2677, 2701, 2820, 3106, 3706, 3711, 3780, 4175, 4187], 'this': [130, 267, 455, 653, 756, 1709, 3449, 4188], 'melanocytic': [133, 270, 1796], 'melanoma.': [136, 273], 'A': [274, 858, 964, 1717], 'number': [275, 505, 922, 1043, 1718, 2736, 3833, 3914, 3994], 'pathways': [278, 341, 393, 1071, 1118, 1147, 1274, 1722, 2843], 'have': [279, 342, 436, 528, 614, 3152, 4194], 'been': [280, 344, 437, 871, 1432, 3154, 3183, 3819, 4196], 'implicated': [281, 3160], 'survival': [286, 920], 'lineage.': [290, 456], 'For': [291], 'most': [293, 1266, 2793], 'part,': [294], 'these': [295, 339, 647, 932, 1117, 1145, 1273, 1658, 3167, 3179, 3565, 4049, 4342], 'were': [296, 2060, 2108, 2129, 2146, 2221, 2278, 2381, 2425, 2439, 2489, 2506, 2564, 2579, 2593, 2616, 2699, 2715, 2766, 2781, 3519, 3605, 3656, 3928, 3966, 4051, 4095], 'initially': [297], 'uncovered': [298], 'through': [299, 1037, 1934, 1996, 3305, 3387, 3636, 4116], 'analysis': [301], 'coat': [303], 'color': [304], 'mutants': [305, 1766], 'affect': [307, 3257], 'viability.': [309, 4069], 'These': [310, 3517, 4103], 'include,': [311], 'example,': [313, 825], 'Steel/c-Kit': [315], 'Edn3/ENDRB': [317], 'mutant': [318, 683, 2338, 3989], 'mice': [319, 523, 882, 1549, 1665], 'whose': [320], 'phenotypes': [321], 'share': [322], 'severe': [323], 'defects': [324], 'numbers': [327], '(1Goding': [328], 'C.R.': [329], 'Genes': [330, 807, 1078, 2309, 2369, 3070, 3867], 'Dev.': [331, 808, 1019, 1079, 2310, 2370, 3071, 3868], '2000;': [332, 1020, 2311, 3072, 3094, 3240], '14:': [333, 2312, 3073], '1712-1728PubMed': [334], 'Google': [335, 389, 487, 577, 612, 676, 715, 748, 815, 856, 916, 962, 1026, 1086, 1108, 1175, 1201, 1228, 1262, 1314, 1372, 1397, 1461, 1487, 1499, 1517, 1538, 1591, 1640, 1675, 1791, 1833, 1861, 1920, 2174, 2314, 2377, 3075, 3100, 3217, 3231, 3246, 3374, 3512, 3859, 3875, 4222, 4253, 4283], 'Scholar).': [336, 390, 677, 816, 857, 917, 963, 1027, 1109, 1263, 1315, 1398, 1592, 1641, 1792, 1921, 2315, 3876, 4284], 'Many': [337], 'now': [343], 'studied': [345], 'molecular': [347], 'detail': [348], 'tested': [350, 3921], 'their': [352, 1745, 2725], 'importance': [353], 'supporting': [355], 'primary': [358, 1809, 1941, 1984, 2213, 2899, 3271, 3431, 3754, 3888, 3954, 4034, 4299], 'under': [360, 2204, 2511], 'tissue': [361, 2691, 3835], 'culture': [362, 2017, 2692, 3836], 'conditions': [363], '(2Halaban': [364], 'R.': [365, 700, 1245, 1454, 1475, 1567, 1633, 1813, 1836, 1890, 3226, 3238, 4243], 'Rubin': [366, 1881], 'J.S.': [367], 'Funasaka': [368], 'Y.': [369, 1526, 1667], 'Cobb': [370], 'M.': [371, 463, 465, 469, 730, 846, 898, 1007, 1186, 1375, 1450, 1471, 1530, 1573, 1629, 1844, 2154, 2294, 2368, 3055, 3473], 'Boulton': [372], 'T.': [373, 999, 1003, 1015, 1569, 3349], 'Faletto': [374], 'D.': [375, 563, 1163, 1490, 4208, 4313], 'Rosen': [376], 'E.': [377, 661, 694, 1093, 1235, 1299, 1774, 1842, 3844, 4314], 'Chan': [378], 'A.': [379, 567, 592, 605, 696, 741, 909, 942, 1159, 1206, 1221, 1239, 1346, 1357, 1383, 1385, 1473, 1584, 1772, 2167, 2364], 'Yoko': [380], 'K.': [381, 594, 1502, 1524, 1528, 2366, 4237], 'White': [382], 'W.': [383, 952, 1091, 1297, 1387, 3078, 3487], 'et': [384], 'al.Oncogene.': [385], '1992;': [386], '7:': [387], '2195-2206PubMed': [388], 'Among': [391], 'employ': [395], 'maintain': [397], 'survival,': [400], 'ligand': [404], 'Scatter': [405], 'Factor/hepatocyte': [406], '(HGF)': [409], '3The': [410], 'abbreviations': [411], 'used': [412, 2286, 2490, 3709], 'are:': [413], 'HGF,': [414, 4321], 'hepatocyte': [415], 'factor;': [417], 'MAPK,': [418, 2955], 'mitogen-activated': [419, 2964], 'kinase;': [421], 'STAT,': [422], 'transducers': [423, 1065], 'activators': [425, 1067], 'transcription;': [427], 'GFP,': [428], 'green': [429, 2189], 'fluorescent': [430], 'protein;': [431], 'SCF,': [432], 'stem': [433, 3008], 'cell': [434, 656, 799, 2591, 3009, 3195, 3918, 4101], 'factor.': [435], 'observed': [438, 1433, 2000, 2924, 3285, 3882, 4094, 4134, 4303], 'play': [440, 1683], 'not': [444, 1802, 3461, 3555, 3644, 3687, 3723, 3739, 3793, 3963, 3980, 4061, 4086, 4096, 4327], 'only': [445, 1803, 2753, 3548], 'but': [448, 1863, 3554, 3792], 'specifically': [449], 'migratory': [452, 1035], 'behavior': [453, 3905, 4056], 'Originally': [457], 'discovered': [458], 'oncogene': [461], '(3Park': [462], 'Dean': [464], 'Cooper': [466], 'C.S.': [467], 'Schmidt': [468], "O'Brien": [470], 'S.J.': [471, 3495], 'Blair': [472], 'D.G.': [473], 'Woude': [474, 1094, 1300], 'G.F.': [475, 1095, 1301], 'Vande': [476, 1096, 1302], 'Cell.': [477, 703, 1362, 1781, 3500], '1986;': [478], '45:': [479], '895-904Abstract': [480], 'Full': [481, 668, 670, 707, 709, 1193, 1195, 1254, 1256, 1366, 1785, 1853, 1855, 3213, 3366, 3368, 3504, 3506, 3851, 3853, 4275, 4277], 'Text': [482, 669, 671, 708, 710, 1194, 1196, 1255, 1257, 1367, 1786, 1854, 1856, 3214, 3367, 3369, 3505, 3507, 3852, 3854, 4276, 4278], 'PDF': [483, 672, 711, 1197, 1258, 1368, 1787, 1857, 3215, 3370, 3508, 3855, 4279], 'PubMed': [484, 574, 609, 673, 712, 745, 812, 853, 913, 959, 1023, 1083, 1105, 1172, 1198, 1225, 1259, 1311, 1369, 1394, 1484, 1514, 1535, 1588, 1788, 1830, 1858, 1917, 2171, 2374, 3097, 3216, 3243, 3371, 3509, 3856, 3872, 4221, 4250, 4280], 'Scopus': [485, 575, 610, 674, 713, 746, 813, 854, 914, 960, 1024, 1084, 1106, 1173, 1199, 1226, 1260, 1312, 1370, 1395, 1485, 1515, 1536, 1589, 1789, 1831, 1859, 1918, 2172, 2375, 3098, 3244, 3372, 3510, 3857, 3873, 4251, 4281], '(454)': [486], 'Scholar),': [488, 1676, 1862, 3101, 3247, 3375, 4223], 'tyrosine': [492, 1269, 1335, 2841], 'kinase': [493, 2842, 2968, 2969], 'multifaceted': [496], 'regulator': [497, 1737], 'growth,': [499], 'motility,': [500], 'invasion': [502, 3879, 3904, 3952, 3972, 4029, 4110], 'lineages': [507, 539, 625, 763], 'vivo.': [509], 'Its': [510, 3144], 'pattern': [511, 3029], 'expression': [513, 784, 891, 971, 1424, 1430, 1798, 1981, 3259, 3563], 'during': [514, 626, 780], 'gestation': [515], 'resulting': [518], 'lethality': [519], 'null': [522, 554, 1765], 'around': [524], 'embryonic': [525, 987], 'day': [526], '11.5': [527, 559], 'complicated': [529], 'our': [530, 616, 2830, 3317], 'understanding': [531, 617, 1692], 'specific': [534, 2397, 3704, 4052], 'contributions': [535, 1115], 'various': [538], 'it': [542], 'adult.': [547, 631], 'Nevertheless,': [548], 'characterization': [549], 'animals': [555, 586, 684, 719, 933], 'prior': [556, 2708, 2786], 'E': [558], '(4Bladt': [560], 'F.': [561, 690, 692, 946, 1237, 1350, 3204], 'Riethmacher': [562], 'Isenmann': [564], 'S.': [565, 604, 740, 908, 1005, 1204, 1210, 1220, 1243, 1355, 1583, 1888, 2166, 2362, 3351, 3485], 'Aguzzi': [566], 'Birchmeier': [568, 1090, 1296, 1386], 'C.': [569, 659, 702, 948, 1089, 1212, 1231, 1295, 1344, 1898, 1902, 3198, 3353, 3842, 4231], 'Nature.': [570, 1913], '1995;': [571, 1496], '376:': [572], '768-771Crossref': [573], '(1105)': [576], 'Scholar)': [578, 613, 716, 749, 2175, 3513], 'studies': [582, 648, 2832, 3049], 'using': [583, 977, 2325, 2383, 2395, 2464, 2547, 2987, 3442, 3607, 3831, 4075], 'conditional': [584], 'knock-out': [585], '(5Huh': [587], 'C.G.': [588], 'Factor': [589], 'V.M.': [590], 'Sanchez': [591], 'Uchida': [593], 'Conner': [595], 'E.A.': [596, 1440, 1619], 'Thorgeirsson': [597], 'S.S.': [598], 'Proc.': [599, 735, 903, 1215, 1578, 2161], 'Natl.': [600, 736, 904, 1216, 1579, 2162], 'Acad.': [601, 737, 905, 1217, 1580, 2163], 'Sci.': [602, 738, 906, 1218, 1581, 2164, 4215], 'U.': [603, 739, 907, 1013, 1219, 1582, 2165], '2004;': [606], '101:': [607], '4477-4482Crossref': [608], '(638)': [611], 'furthered': [615], 'several': [624, 874], 'Combined': [632], 'chick': [636], 'where': [637, 3562], 'ectopic': [638, 722, 884], 'results': [640, 2876, 4084, 4104], 'aberrant': [642], 'migration': [643], 'muscle': [645], 'precursors,': [646], 'suggest': [649, 1126], 'motility': [657], '(6Birchmeier': [658, 3841], 'Gherardi': [660, 1092, 1298, 3843], 'Trends': [662, 3845], 'Cell': [663, 954, 1100, 1306, 1389, 2041, 3092, 3846, 4214, 4245], 'Biol.': [664, 1101, 1188, 1249, 1307, 1390, 3208, 3361, 3847, 4246, 4270], '1998;': [665, 809, 1080, 1458, 1637, 3363, 3848, 3869, 4247, 4272], '8:': [666, 3849], '404-410Abstract': [667, 3850], '(511)': [675, 3858], 'Indeed,': [678, 782, 1427, 3014], 'employing': [680], 'hypomorphic': [681], 'survive': [686], 'until': [687, 2264], 'birth': [688, 997], '(7Maina': [689], 'Casagranda': [691], 'Audero': [693, 1234], 'Simeone': [695], 'Comoglio': [697, 1166, 1213, 1246, 1360, 1476, 3205], 'P.M.': [698, 1167, 1214, 1361, 1477, 3206], 'Klein': [699], 'Ponzetto': [701, 947, 1211], '1996;': [704, 742, 910, 1190, 1251, 1391], '87:': [705], '531-542Abstract': [706], '(271)': [714], 'or': [717, 2187, 2266, 2409, 3262, 3270, 3309, 3765, 3796, 3935, 4017, 4068], 'transgenic': [718, 875, 881, 1544, 1664], 'produce': [721, 883], '(8Takayama': [724, 892], 'H.': [725, 893, 944, 1001, 1009, 1011, 1504, 1522, 1563, 1780], 'La': [726, 894], 'Rochelle': [727, 895], 'W.J.': [728, 896, 1565], 'Anver': [729, 897, 1572], 'Bockman': [731, 899], 'D.E.': [732, 900, 1822, 1846, 1910, 2160, 2308, 3069, 3359, 3499, 4239, 4268], 'Merlino': [733, 803, 901, 949, 1074, 1576, 1668, 3863], 'G.': [734, 804, 902, 950, 1075, 1359, 1520, 1577, 1669, 1840, 1884, 2150, 3200, 3202, 3479, 3864], '93:': [743, 911], '5866-5871Crossref': [744, 912], '(178)': [747, 915, 1486], 'point': [750], 'expanded': [753], 'numerous': [762, 788], 'addition': [765], 'muscle.': [767], 'also': [770, 870, 1550, 1682, 1868, 1978, 2995, 3153, 3657, 4195, 4227, 4302], 'known': [771], 'mediate': [773, 1740], 'epithelial-mesenchymal': [774, 836], 'transitions': [775], 'many': [777], 'organ': [778], 'types': [779, 3196], 'development.': [781], 'epithelial': [789], 'tissues,': [790], 'often': [794], 'neighboring': [797], 'mesenchymal': [798], 'compartments': [800], '(9Chin': [801, 1072], 'L.': [802, 940, 1073, 3080, 3862], 'DePinho': [805, 1076, 3865], 'R.A.': [806, 1077, 3866], '12:': [810, 957, 1081, 3870], '3467-3481Crossref': [811, 1082, 3871], '(162)': [814, 1085, 3874], 'Melanocytes': [817, 3815, 3959], 'skin': [820, 988], 'inner': [822], 'ear,': [823], 'derive': [826], 'from': [827, 931, 1543, 2050, 2242, 2280, 2351, 2590, 2915, 3047, 3611, 3684], 'neural': [828, 841, 927], 'crest': [829, 928], 'precursors': [830], 'migrate': [832], 'dorso-ventrally': [833], 'after': [834, 996, 2932], 'undergoing': [835], 'transition': [837], 'dorsal': [840], 'tube': [842], '(10Knecht': [843], 'A.K.': [844], 'Bronner-Fraser': [845], 'Nat.': [847, 1097, 1303], 'Rev.': [848, 1098, 1304], 'Genet.': [849], '2002;': [850, 1672, 3501], '3:': [851], '453-461Crossref': [852], '(86)': [855], 'HGF/c-Met': [861, 1124, 1926, 2814, 2851, 2998], 'developmental': [865, 1749], 'regulation': [866, 2824, 2835, 4118], 'has': [869, 1414, 1431, 3182, 3818], 'suggested': [872], 'mouse': [876, 1595, 1969, 3398], 'models.': [877], 'Metallothionein': [878], 'promoter-driven': [879], 'regions': [887, 3402], 'abnormal': [889], 'Interestingly,': [918], 'differentiating': [924], 'melanoblasts': [925, 989], 'explant': [929], 'cultures': [930, 2592, 3757], 'can': [934, 3745], 'increased': [936, 1411, 1613, 3290, 3547, 3798, 4157], '(11Kos': [939], 'Aronzon': [941], 'Takayama': [943], 'Maina': [945, 1236, 1349], 'Pavan': [951], 'Pigment': [953], 'Res.': [955, 1671, 3093], '1999;': [956, 1850, 4216], '13-21Crossref': [958], '(75)': [961], 'more': [965, 3930], 'recent': [966], 'study': [967], 'restricted': [973], 'epidermis': [976], 'cytokeratin': [980], 'K14': [981], 'promoter': [982, 2400, 3401, 3596, 3668], 'shows': [983], 'increase': [985, 3039, 3381, 3436, 4199], 'mature': [993], 'dermal': [994], '(12Kunisada': [998], 'Yamazaki': [1000], 'Hirobe': [1002], 'Kamei': [1004], 'Omoteno': [1006], 'Tagaya': [1008], 'Hemmi': [1010], 'Koshimizu': [1012], 'Nakamura': [1014], 'Hayashi': [1016], 'S.I.': [1017], 'Mech.': [1018], '94:': [1021, 1223, 1586], '67-78Crossref': [1022], '(93)': [1025], 'Although': [1028, 3528], 'exact': [1030], 'whereby': [1032], 'transduces': [1034], 'signals': [1036], 'remains': [1039, 2825], 'incompletely': [1040], 'understood,': [1041], 'common': [1045, 1795], 'events': [1047, 4132], 'are': [1048, 1660, 1973, 2800, 3176, 4162], 'induced': [1049, 3462, 4307], 'downstream': [1050, 1932, 2838, 3729, 4293], 'include': [1054], 'among': [1055], 'others': [1056], 'Ras/MAPK,': [1058], 'phosphatidylinositol': [1059, 1137], '3-kinase,': [1060], 'phospholipase': [1061], 'c-γ,': [1062], 'signal': [1064], 'transcription': [1069, 2494], '(STAT)': [1070], 'Scholar,': [1087, 1176, 1202, 1229, 1373, 1462, 1488, 1500, 1518, 1834, 3076, 3218, 3232, 3860, 4254], '13Birchmeier': [1088], 'Mol.': [1099, 1305], '2003;': [1102, 1308], '4:': [1103, 1309], '915-925Crossref': [1104, 1310], '(2269)': [1107, 1313], 'Attempts': [1110], 'dissect': [1112], 'respective': [1114, 2646, 2726], 'different': [1121, 3805], 'aspects': [1122], 'that,': [1127], 'whereas': [1128, 3015], 'Ras': [1130], 'arm': [1131, 1139], 'proliferation,': [1135], '3-kinase': [1138], 'required': [1141, 2954], 'scattering,': [1143], 'two': [1146, 3804], 'combination': [1149], 'STAT': [1151], 'may': [1153, 1681, 1927, 3303], 'important': [1155], 'morphogenesis': [1157], '(14Bardelli': [1158], 'Longati': [1160], 'P.': [1161, 1247, 1353, 1492, 1571, 4210, 4233], 'Gramaglia': [1162], 'Stella': [1164], 'M.C.': [1165, 1820], 'Oncogene.': [1168, 1495, 1531, 3239], '1997;': [1169, 1222, 1585, 2371, 3228], '15:': [1170], '3103-3111Crossref': [1171], '(119)': [1174], '15Fixman': [1177], 'E.D.': [1178], 'Fournier': [1179], 'T.M.': [1180], 'Kamikura': [1181], 'D.M.': [1182], 'Naujokas': [1183], 'M.A.': [1184, 1882, 2300, 3061, 4258], 'Park': [1185], 'J.': [1187, 1248, 1388, 1452, 1456, 1479, 1509, 1631, 1635, 1824, 1848, 1896, 3086, 3207, 3360, 3477, 4213, 4244, 4269], 'Chem.': [1189, 1250, 3209, 3362, 4271], '271:': [1191, 1252], '13116-13122Abstract': [1192], '(108)': [1200], '16Giordano': [1203], 'Bardelli': [1205, 1238, 1345], 'Zhen': [1207, 1232, 1347], 'Z.': [1208, 1233, 1348], 'Menard': [1209], '13868-13872Crossref': [1224], '(84)': [1227], '17Ponzetto': [1230], 'Basile': [1240], 'M.L.': [1241, 1908], 'Giordano': [1242, 1354], 'Narsimhan': [1244], '14119-14123Abstract': [1253], '(144)': [1261], 'As': [1264, 1986, 2772, 3424, 4031], 'other': [1267, 1794, 3194, 3916], 'kinases,': [1270], 'activation': [1271], 'occurs': [1275], 'result': [1278, 4063], 'recruitment': [1280, 3338], 'Src': [1282], 'homology': [1283], '2-containing': [1284], 'intermediates': [1286], 'cytoplasmic': [1289], 'region': [1290, 1322, 2401, 2416, 3730], '(13Birchmeier': [1294], 'case': [1318], 'c-Met,': [1320, 3751], 'C': [1325], 'terminus': [1326], 'comprises': [1327], 'multifunctional': [1329], 'docking': [1330], 'site': [1331, 3003, 3421, 3625, 3713], 'contains': [1333], 'residues': [1336], 'phosphorylated': [1337], 'following': [1338, 2329, 2459, 2513, 4135, 4200, 4324], 'dimerization': [1340], 'autophosphorylation': [1342], '(18Ponzetto': [1343], 'dalla': [1351], 'Zonca': [1352], 'Graziani': [1356], 'Panayotou': [1358], '1994;': [1363, 1511, 3210], '77:': [1364], '261-271Abstract': [1365], '(907)': [1371], '19Sachs': [1374], 'Weidner': [1376], 'K.M.': [1377], 'Brinkmann': [1378], 'V.': [1379], 'Walther': [1380], 'I.': [1381], 'Obermeier': [1382], 'Ullrich': [1384], '133:': [1392], '1095-1107Crossref': [1393], '(90)': [1396], 'More': [1399], 'recently': [1400], 'finding': [1402], 'activity': [1405, 1561, 1615], 'melanomas': [1407, 1436, 1811, 1876, 4115], 'linked': [1409], 'metastatic': [1412, 1715, 3164], 'potential': [1413, 2010, 2030, 3165, 3825, 3886], 'sparked': [1415], 'particular': [1416], 'interest': [1417], 'deciphering': [1419], 'mechanisms': [1421, 1680], 'governing': [1422], 'robust': [1428], '(20Hendrix': [1437, 1616], 'M.J.': [1438, 1617], 'Seftor': [1439, 1441, 1618, 1620], 'R.E.': [1442, 1621], 'Kirschmann': [1443, 1622], 'D.A.': [1444, 1623, 1892], 'Gardner': [1445, 1624], 'L.M.': [1446, 1625], 'Boldt': [1447, 1626], 'H.C.': [1448, 1627], 'Meyer': [1449, 1628], "Pe'er": [1451, 1630], 'Folberg': [1453, 1632], 'Am.': [1455, 1634, 1823, 1847], 'Pathol.': [1457, 1510, 1636, 1826, 1849], '152:': [1459, 1638], '855-863PubMed': [1460, 1639], '21Natali': [1463], 'P.G.': [1464, 1508], 'Nicotra': [1465], 'M.R.': [1466], 'Di': [1467], 'Renzo': [1468], 'M.F.': [1469], 'Prat': [1470], 'Bigotti': [1472], 'Cavaliere': [1474], 'Br.': [1478], 'Cancer.': [1480], '1993;': [1481, 1782], '68:': [1482], '746-750Crossref': [1483], '22Rusciano': [1489], 'Lorenzoni': [1491, 4209], 'Burger': [1493, 4211], 'M.M.': [1494, 3082, 4212], '11:': [1497, 2372], '1979-1987PubMed': [1498], '23Saitoh': [1501], 'Takahashi': [1503], 'Sawada': [1505], 'N.': [1506], 'Parsons': [1507], '174:': [1512], '191-199Crossref': [1513], '(49)': [1516], '24Li': [1519], 'Schaider': [1521], 'Satyamoorthy': [1523], 'Hanakawa': [1525], 'Hashimoto': [1527], 'Herlyn': [1529], '2001;': [1532, 1827, 2168], '20:': [1533], '8125-8135Crossref': [1534], '(169)': [1537], 'Scholar);': [1539], 'such': [1540, 1605, 1723, 2844], 'tumors': [1541], 'arising': [1542], 'overexpression': [1545, 1556], 'display': [1551], 'along': [1557], 'enhanced': [1559, 1611], '(25Takayama': [1562], 'LaRochelle': [1564], 'Sharp': [1566], 'Otsuka': [1568], 'Kriebel': [1570], 'Aaronson': [1574], 'S.A.': [1575, 3491], '701-706Crossref': [1587], '(378)': [1590], 'Experiments': [1593], 'models': [1596, 3840], 'tumor': [1598], 'metastasis': [1599, 1647, 2036], 'demonstrate': [1600], 'colonization': [1602], 'organs': [1604], 'liver': [1608, 1646], 'significantly': [1610], 'Of': [1642, 4190], 'note,': [1643, 4191], 'lung': [1644], 'engineered': [1651, 2177], 'overexpress': [1653, 2179], 'stimulated': [1656, 4022], 'when': [1657], 'introduced': [1661], 'into': [1662], '(26Yu': [1666], 'Cancer': [1670], '62:': [1673], '2951-2956PubMed': [1674], 'non-autocrine': [1679], 'significant': [1685, 1872], 'Therefore,': [1689], 'better': [1691], 'how': [1694, 1708, 3173], 'normally': [1699], 'regulated': [1700, 3177], 'might': [1703, 3255, 3384, 3956], 'provide': [1704], 'clues': [1705], 'becomes': [1711], 'overactive': [1712], 'widely': [1714], 'melanomas.': [1716], 'c-Kit,': [1725], 'α-MSH,': [1726], 'Wnt,': [1727], 'endothelin': [1729], 'appear': [1730], 'converge': [1732], 'on': [1733, 2568, 2618, 2718, 2829, 2833, 3004, 3714, 4003], 'master': [1735], 'lineage': [1736], 'at': [1741, 2237, 2450, 2651, 2925, 3189, 3413, 3524, 3803, 4290], 'least': [1742], 'part': [1743], 'function.': [1746], 'The': [1747, 2316, 2792, 2911, 4070, 4173, 4351], 'critical': [1748, 2819], 'apparent': [1756], 'complete': [1759], 'lack': [1760], 'viable': [1762], '(27Hodgkinson': [1767], 'C.A.': [1768], 'Moore': [1769], 'K.J.': [1770], 'Nakayama': [1771], 'Steingrimsson': [1773], 'Copeland': [1775], 'N.G.': [1776], 'Jenkins': [1777], 'N.A.': [1778], 'Arnheiter': [1779], '74:': [1783], '395-404Abstract': [1784], '(959)': [1790], 'Unlike': [1793], 'markers,': [1797], 'retained': [1804], 'nearly': [1806], '100%': [1807], '(28King': [1812], 'Googe': [1814], 'P.B.': [1815], 'Weilbaecher': [1816, 1837, 2151, 4261], 'K.N.': [1817, 1838, 2152, 4262], 'Mihm': [1818, 1843], 'Jr.,': [1819], 'Fisher': [1821, 1845, 1909, 2157, 2159, 2305, 2307, 3066, 3068, 3358, 3498, 4238, 4267], 'Surg.': [1825], '25:': [1828], '51-57Crossref': [1829], '(147)': [1832], '29King': [1835], 'McGill': [1839], 'Cooley': [1841], '155:': [1851], '731-738Abstract': [1852], '(219)': [1860], 'gene': [1866, 3737], 'amplified': [1869, 3683], 'fraction': [1873], 'malignant': [1875], '(30Garraway': [1877], 'L.A.': [1878], 'Widlund': [1879, 3474], 'H.R.': [1880, 3475], 'Getz': [1883], 'Berger': [1885], 'A.J.': [1886], 'Ramaswamy': [1887, 3484], 'Beroukhim': [1889], 'Milner': [1891], 'Granter': [1893], 'S.R.': [1894], 'Du': [1895, 3476], 'Lee': [1897], 'Wagner': [1899], 'S.N.': [1900], 'Li': [1901], 'Golub': [1903, 3496], 'T.R.': [1904, 3497], 'Rimm': [1905], 'D.L.': [1906], 'Meyerson': [1907], 'Sellers': [1911], 'W.R.': [1912], '2005;': [1914], '436:': [1915], '117-122Crossref': [1916], '(1213)': [1919], 'examined': [1924], 'whether': [1925, 2849, 3252, 3378, 3588, 3661, 3743, 3949], 'transduce': [1928], 'some': [1929], 'We': [1936, 2859], 'HGF/scatter': [1947], 'leads': [1949, 2853, 3322], 'phosphorylation': [1952, 2953, 3002, 3103, 3325, 3336, 3530, 4152], 'MAPK': [1955, 2885, 3534, 4149], 'pathway.': [1956], 'Genomic': [1957], 'analyses': [1958], 'identified': [1959], 'conserved': [1960, 3405], 'binding': [1962, 3411, 3624, 3629], 'consensus': [1963, 2322, 3409, 3676], 'sequences': [1964, 2350, 3393], 'promoters': [1971], 'bound': [1974, 3664], 'Mitf,': [1976, 2183, 3544, 3791, 3946, 4334], 'result,': [1988], 'stimulate': [2007, 3822], 'invasive': [2008, 2738, 2754, 3824, 3885, 3931, 4055], 'could': [2018], 'abolished': [2020], 'suppression': [2022], 'suggests': [2028, 3297], 'means': [2031], 'interfering': [2033], 'lineage-restricted': [2039], 'manner.': [2040], 'Culture—Primary': [2042], 'between': [2045], 'passages': [2046], '2': [2047, 3109], '5': [2049, 2711], 'neonatal': [2051, 2865], 'foreskins': [2052], '(provided': [2053], 'Dr.': [2055], 'Ruth': [2056], 'Halaban,': [2057], 'Yale': [2058], 'University)': [2059], 'established': [2061], 'TICVA': [2063], 'medium': [2064, 2068, 2113, 2135, 2249, 2257], 'containing': [2065, 2498], "Ham's": [2066, 2111, 2442, 2706], 'F10': [2067, 2228], '(Invitrogen),': [2069, 2075], '7%': [2070], 'fetal': [2071, 2117, 2139], 'bovine': [2072, 2118, 2140], 'serum,': [2073], 'penicillin/streptomycin/glutamine': [2074], '1': [2076, 2091, 2095, 2537], '×': [2077, 2096, 2712], '10-4': [2078], 'm': [2079, 2098], '3-isobutyl-1-methyl': [2080], 'xanthine': [2081], '(IBMX;': [2082], 'Sigma),': [2083, 2090], '50': [2084, 2729], 'ng': [2085, 2500], 'ml-1': [2086], '12-O-tetradecanoyl': [2087], 'phorbol-13-acetate': [2088], '(TPA;': [2089], 'μm': [2092], 'Na3VO4,': [2093], '10-3': [2097], 'N6,2′-O-dibutyryladenosine': [2099], '3:5-cyclic': [2100], 'monophosphate': [2101], '(dbcAMP;': [2102], 'Sigma).': [2103], '501mel': [2104, 2217, 2281, 2352, 2906, 3266, 3612, 3897, 4011, 4077], 'grown': [2109, 2130], 'F-10': [2112, 2443, 2707], 'supplemented': [2114, 2136, 2229, 2255], '10%': [2116, 2138], 'serum': [2119, 2141], 'penicillin/streptomycin/l-glutamine.': [2121, 2143], 'A375,': [2122], 'M14,': [2123, 3923], 'SKMEL-2,': [2124, 3924], 'SKMEL-28': [2126], 'lines': [2128, 3919], "Dulbecco's": [2132], 'modified': [2133], "Eagle's": [2134], 'Adenoviral': [2144], 'Infections—Adenoviruses': [2145], 'previously': [2147, 3468], 'described': [2148, 2292, 3155, 3469], '(31Motyckova': [2149], 'Horstmann': [2153, 2299, 3060, 3472, 4257, 4311], 'Rieman': [2155], 'D.J.': [2156], 'D.Z.': [2158, 2306, 3067], '98:': [2169], '5798-5803Crossref': [2170], '(197)': [2173], 'either': [2180, 3762], 'wild-type': [2181, 3541, 3553, 3642, 3782], 'R215del': [2184], '(dominant-negative': [2185], 'Mitf),': [2186], 'fluorescence': [2190], '(GFP)/wee1-truncation': [2192], 'hybrid': [2193], '(which': [2194], 'targets': [2195, 2999, 4292], 'GFP': [2196, 3766, 3794], 'nucleus': [2199], 'vector': [2201], 'control),': [2202], 'all': [2203], 'control': [2206, 2774, 3767, 3795, 4004, 4044], 'elongation': [2209], 'α-promoter.': [2211], 'Subconfluent': [2212], 'incubated': [2222], 'concentrated': [2224], 'adenoviruses': [2225], 'serum-free': [2227], '10': [2231, 2525, 2635], 'mm': [2232, 2633, 2636], 'MgCl2': [2233], '30': [2235, 2519, 2678, 2926], 'min': [2236, 2538, 2661, 2679, 2927], 'multiplicities': [2238, 3806], 'infection': [2240, 3808], 'ranging': [2241], '200': [2243], '1000.': [2245], 'After': [2246, 2740], 'infection,': [2247], 'replaced': [2251], 'fresh,': [2253], 'fully': [2254], 'cultured': [2259], 'indicated': [2262, 4047], 'times': [2263, 2658, 2676], 'harvest.': [2268], 'Melanoma': [2269], 'Nuclear': [2270, 2379], 'Extracts': [2271], 'Electrophoretic': [2273, 3601], 'Mobility': [2274], 'Shift': [2275], 'Assay—Nuclear': [2276], 'extracts': [2277, 2380, 3609], 'prepared': [2279, 2324, 3610], 'gel': [2288, 2430], 'shift': [2289, 2897, 2914, 3028, 3603], 'reactions': [2290, 2563], '(32Wu': [2293, 3054], 'Hemesath': [2295, 3056, 3356, 4234], 'T.J.': [2296, 3057, 3357, 4235], 'Takemoto': [2297, 3058, 3352, 4263], 'C.M.': [2298, 3059, 4264], 'Wells': [2301, 3062, 4259], 'A.G.': [2302, 3063, 4260], 'Price': [2303, 3064], 'E.R.': [2304, 3065, 3345, 4256], '301-312PubMed': [2313, 3074], 'c-met-specific': [2317], 'probe': [2318, 2558, 3619, 3646], 'spanning': [2319, 2410, 3673], 'E-box': [2321, 2331, 3632], 'oligos': [2326], 'sequences:': [2330], 'probe:': [2332, 2339], 'GGCAGACAGACACGTGCTGGGGCGGG': [2333], '(FWD),': [2334, 2341], 'CCCGCCCCAGCACGTGTCTGTCTGCC': [2335], '(REV),': [2336], 'GGCAGACAGAGAGGTGCTGGGGCGGG': [2340], 'CCCGCCCCAGCACCTCTCTGTCTGCC': [2342], '(REV).': [2343], 'Chromatin': [2344, 3653], 'Immunoprecipitation—Chromatin': [2345], 'c-met': [2349, 2404, 2413, 2543, 2576, 3736], 'performed': [2357, 3606, 3658], 'Ref.': [2360], '33Strahl-Bolsinger': [2361], 'Hecht': [2363], 'Luo': [2365], 'Grunstein': [2367], '83-93Crossref': [2373], '(594)': [2376], 'Scholar.': [2378], 'immunoprecipitated': [2382], 'purified': [2384], 'rabbit': [2385], 'antibody': [2386, 2670, 2891, 2990, 3708, 3721], 'against': [2387, 2892], 'PCR': [2389, 2423, 2495, 3445], '(iCycler;': [2390], 'Bio-Rad)': [2391], 'carried': [2393, 4073], 'out': [2394, 4074], 'primers': [2396, 2554, 3672], '(FWD:': [2405, 2418], '5′-TTCTGCGGTGCCCAAATCTCT-3′': [2406], 'REV:5′-TGTCTGTCTGCCTCGCGTGCTGTC-3′)': [2408], 'coding': [2414], 'region/3′-untranslated': [2415], 'boundary': [2417], '5′-GAACGTAAAATGTGTCGCTC-3′': [2419], 'REV:': [2421], '5′-CTCTGTCAGATAAGAAATTCCTTAG-3′).': [2422], 'products': [2424], 'resolved': [2426], '1.5%': [2428], 'agarose': [2429], 'electrophoresis.': [2431], 'Quantitative': [2432], 'Reverse': [2433], 'Transcription-PCR/TaqMan—For': [2434], 'experiments,': [2437], 'starved': [2440], '16': [2445], 'h': [2446, 2458, 2703, 2875, 2931, 3110], 'subsequently': [2448, 2716, 2767], 'harvested': [2449], '0,': [2451], '0.5,': [2452], '1,': [2453, 2516], '2,': [2454, 2522], '4,': [2455, 2534], '6': [2457, 2874, 3282], 'stimulation.': [2460, 3112], 'RNA': [2461], 'isolated': [2463], 'Ambion': [2466], 'RNAqueous': [2467], 'kit': [2468], 'quantitated': [2470], 'spectrophotometry': [2472], '(Beckman).': [2473], 'TaqMan': [2474, 2557], 'One-Step': [2475], 'RT-PCR': [2476], 'Master': [2477], 'Mix': [2478], 'reagent': [2479], 'GAPDH': [2483], 'Control': [2484], 'Reagents': [2485], '(Applied': [2486, 2560, 2573], 'Biosystems,': [2487], 'CA)': [2488], 'quantitative': [2492], 'reverse': [2493, 2552], 'reactions,': [2496], 'each': [2497], '100': [2499], 'total': [2502], 'sample': [2503], 'RNA.': [2504], 'Reactions': [2505], 'run': [2507, 2565, 2617], '40': [2509, 2540], 'cycles': [2510], 'conditions:': [2514], 'stage': [2515, 2521, 2527, 2533], '48': [2517], '°C,': [2518, 2524, 2530, 2536], 'min;': [2520, 2526], '95': [2523], '3,': [2528], '94': [2529], '20': [2531], 's;': [2532], '62': [2535], 'cycles.': [2541], 'Human': [2542], 'detected': [2546], 'forward': [2549], '5′-AATGCTGGCACCCTAAAGC-3′': [2550], '5′-AAGATCGCTGATATCCGGG-3′': [2553], '(IDT)': [2555], '6FAM-CGCCCATCCTTTTCTGAACTGGTG-TAMRA': [2559], 'Biosystems).': [2561], 'All': [2562], 'triplicate': [2567], 'ABI-PRISM': [2570], '7700': [2571], 'instrument': [2572], 'Biosystems),': [2574], 'normalized': [2580], 'glyceraldehyde-3-phosphate': [2582], 'dehydrogenase': [2583], 'Gel': [2585], 'Electrophoresis': [2586], 'Immunoblotting—Total': [2588], 'subjected': [2594], 'Western': [2596, 3776], 'blotting': [2597, 3777], 'anti-Met': [2599], '(Upstate),': [2600], 'anti-phospho-Met': [2601], '(Cell': [2602, 2608], 'Signaling': [2603, 2609], 'Technologies),': [2604, 2610], 'anti-Mitf': [2605, 3720], '(NeoMarkers),': [2606], 'anti-phospho-MAPK': [2607], 'anti-tubulin': [2612], '(Sigma)': [2613], 'antibodies.': [2614], 'Samples': [2615], 'SDS-PAGE': [2619], 'gels,': [2620], 'transferred': [2621], 'onto': [2622], 'nitrocellulose,': [2623], '5%': [2626], 'nonfat': [2627], 'dry': [2628], 'milk': [2629], 'TBST': [2631, 2649], '(150': [2632], 'NaCl,': [2634], 'Tris': [2637], 'pH': [2638], '8.0,': [2639], '0.05%': [2640], 'Tween': [2641], '20),': [2642], 'probed': [2644, 2664], 'antibodies': [2647], 'overnight': [2650], '4': [2652], '°C.': [2653], 'Membranes': [2654], 'washed': [2656, 2674], 'three': [2657, 2675, 2797], '15': [2660], 'TBST,': [2663, 2681], 'secondary': [2667], 'goat': [2668], 'anti-mouse': [2669], '(ICN': [2671], 'Biomedicals': [2672], 'Inc.),': [2673], 'developed': [2683], 'ECL': [2685], '(Amersham': [2686], 'Biosciences).': [2687], 'Matrigel': [2688, 2695, 2747, 2762, 2790, 3878, 3951, 3971, 3978, 4005, 4028, 4045], 'Invasion': [2689, 3813], 'Assays—24-well': [2690], 'plate': [2693], 'BioCoat': [2694], 'inserts': [2696, 2720, 2748, 2780, 4006, 4046], '(Becton': [2697], 'Dickinson)': [2698], 'rehydrated': [2700], '3': [2702], '37°C': [2705], 'use.': [2710], '105': [2713], 'plated': [2717], '0.5': [2722], 'ml': [2723], 'media': [2727], '±': [2728], 'ng/ml': [2730], 'assess': [2734, 2776, 3660, 3742], 'cells.': [2739, 3180, 3264, 3670], '24': [2741], 'h,': [2742, 3283], 'surface': [2744], 'gently': [2750], 'scraped,': [2751], 'leaving': [2752], 'had': [2757], 'migrated': [2758], 'inside': [2759], 'protective': [2761], 'layer.': [2763], 'Remaining': [2764], 'fixed,': [2768], 'stained,': [2769], 'counted.': [2771], 'plating': [2777, 4066], 'efficiency,': [2778], 'duplicate': [2779], 'fixed': [2782], 'stained': [2784], 'without': [2785], 'scraping': [2787], 'surface.': [2791], 'representative': [2794], 'data': [2795], 'independent': [2798], 'shown': [2801, 3701, 3820, 4197], 'Fig.': [2803], '4.': [2804], 'Induces': [2806], 'Phosphorylation': [2808], 'Degradation': [2810], 'MAPK—Although': [2812], 'appears': [2816], 'development,': [2822], 'poorly': [2826], 'understood.': [2827], 'Based': [2828], 'previous': [2831, 3332], 'SCF/c-Kit,': [2846], 'investigated': [2848], 'post-translational': [2855, 2937], 'modification': [2856, 2938], 'treatment': [2862, 4201], 'recombinant': [2868, 3276], 'over': [2870, 3278], 'period': [2872, 3280], 'rapid': [2878, 2944], 'stimulation/phosphorylation': [2879], '(Fig.': [2886, 2901, 2909, 2982, 3012, 3138, 3293, 3422, 3446, 3558, 3571, 3626, 3696, 3786, 3895, 3973, 4007], '1A).': [2887], 'Blotting': [2888], 'revealed': [2894, 3121, 3403], 'mobility': [2896, 3133, 3602], '1A)': [2902], '1B).': [2910], 'band': [2913, 2922, 3027], 'doublet': [2917, 3025], 'single': [2920], 'upper': [2921, 3132], 'persisted': [2929], '2-4': [2930], 'stimulation,': [2934], 'kinetics': [2940, 3523, 4128], 'similar': [2941, 3522, 3570, 3779, 3902, 4026, 4083], 'induction': [2945, 3451, 4182, 4323], 'phospho-p42/44': [2947], 'MAPK.': [2948], 'To': [2949, 3741], 'confirm': [2950], 'pretreated': [2957], 'HGF-stimulated': [2958], 'increasing': [2961], 'concentrations': [2962], 'kinase/extracellular': [2966], 'signal-regulated': [2967], 'inhibitor': [2970, 3127], 'phospho-MAPK': [2975], 'shifted': [2977], 'decreased': [2980], 'accordingly': [2981], '1C).': [2983], 'Immunoprecipitation': [2984], 'phospho-specific': [2989], 'targeted': [2991, 3104], 'serine': [2993, 3041], '73': [2994], 'same': [3001, 3023, 3719, 3733], 'factor/c-Kit': [3010], '1D).': [3013], 'immunoblots': [3016], 'supernatants': [3020], 'recapitulated': [3021, 3520], 'activation,': [3034], 'pellets': [3036], 'showed': [3037, 4025, 4082], '73-specific': [3042], 'phosphorylation.': [3043], 'predicted': [3046], 'earlier': [3048], 'cytokine-dependent': [3051], 'degradation': [3053, 3107, 3114], '34Xu': [3077], 'Gong': [3079], 'Haddad': [3081], 'Bischof': [3083], 'O.': [3084], 'Campisi': [3085], 'Yeh': [3087], 'E.T.': [3088], 'Medrano': [3089], 'E.E.': [3090], 'Exp.': [3091], '255:': [3095], '135-143Crossref': [3096], '(214)': [3099], 'within': [3108], 'occurred': [3115, 3535], 'proteasome': [3118], 'pathway,': [3119], 'MG-132': [3128], 'stabilize': [3130], '(phosphor-ser73)': [3134], 'isoform': [3135], '1E).': [3139], 'Regulates': [3141, 4123], 'Levels': [3142, 4125], 'Receptor': [3145], 'Mitf—Because': [3148], 'elevated': [3149], 'aggressive': [3163], 'tumors,': [3168], 'wanted': [3170], 'understand': [3172], 'reported': [3184], 'induce': [3186, 4349], 'level': [3192], '(35Boccaccio': [3197], 'Gaudino': [3199], 'Gambarotta': [3201], 'Galimi': [3203], '269:': [3211], '12846-12851Abstract': [3212], '36Chen': [3219], 'Q.': [3220, 3236], 'Seol': [3221], 'D.W.': [3222, 3234], 'Carr': [3223], 'B.': [3224], 'Zarnegar': [3225, 3237], 'Hepatology.': [3227], '26:': [3229], '59-66PubMed': [3230], '37Seol': [3233], 'Chen': [3235], '19:': [3241], '1132-1137Crossref': [3242], '(69)': [3245], 'therefore': [3249], 'wondered': [3251], 'similarly': [3256], 'Using': [3265, 3671, 3877], 'treated': [3274], 'time': [3292], '2A).': [3294], 'observation': [3296, 4352], 'homeostatic': [3300], 'regulatory': [3301], 'exist': [3304], 'modulates': [3308], 'replenishes': [3310], 'receptor.': [3315], 'Combining': [3316], 'observations': [3318, 3518, 4050], 'knowledge': [3333], 'triggers': [3337], 'coactivator': [3342], 'p300': [3343], '(38Price': [3344], 'Ding': [3346, 3488], 'H.F.': [3347], 'Badalian': [3348], 'Bhattacharya': [3350], 'Yao': [3354], 'T.P.': [3355], '273:': [3364, 4273], '17983-17986Abstract': [3365], '(172)': [3373], 'asked': [3377, 3587, 3948], 'mediated': [3386], 'Examination': [3389], 'genomic': [3392], 'proximal': [3400], 'high': [3406], 'affinity': [3407], 'DNA': [3410], 'element': [3412, 3633], '∼300': [3414], 'bp': [3415], 'upstream': [3416], 'start': [3420], '2B).': [3423], 'cells,': [3427, 3614], 'led': [3433], 'Taqman': [3443], 'real-time': [3444], '2C).': [3447], 'However,': [3448, 4318], 'completely': [3453, 3967], 'dependent': [3454], 'upon': [3455], 'function': [3457, 4178, 4347], 'because': [3458, 3717, 4097], 'presence': [3465, 3539, 3551, 4331], '(39McGill': [3470], 'G.G.': [3471], 'Motyckova': [3478], 'Nishimura': [3480], 'E.K.': [3481], 'Lin': [3482], 'Y-L.': [3483], 'Avery': [3486], 'H-F.': [3489], 'Jordan': [3490], 'Jackson': [3492], 'I.J.': [3493], 'Korsmeyer': [3494], '109:': [3502], '707-718Abstract': [3503], '(612)': [3511], 'Mitf-expressing': [3515], 'adenovirus.': [3516], 'level.': [3527], 'HGF-induced': [3529, 3970, 4180], '2D)': [3559], 'exogenous': [3566, 3772], 'proteins': [3568, 3774], '3C,': [3572, 3787], 'middle': [3573, 3788], 'panel,': [3574], '500': [3575], 'M.O.I.).': [3576], 'Is': [3578], 'Direct': [3580], 'Transcriptional': [3581], 'Target': [3582], 'Gene': [3583], 'Mitf—We': [3585], 'next': [3586], 'directly': [3590, 3746], 'interacts': [3591], 'assays': [3604], 'nuclear': [3608], 'antibody,': [3616], '32P-labeled': [3618], 'covering': [3620], 'putative': [3622], '3A).': [3627], 'Specific': [3628], 'demonstrated': [3635], 'excess': [3640], 'unlabeled': [3641], '(but': [3643, 3686, 3962], 'mutant)': [3645], 'compete': [3648], 'supershifted': [3650], 'Mitf-DNA': [3651], 'complex.': [3652], 'element,': [3677], 'promoter-specific': [3680], 'product': [3681], 'control)': [3688], 'immunoprecipitates,': [3690], 'vivo': [3694, 3839], 'interaction': [3695, 3699], '3B).': [3697], 'chromatin,': [3716], 'did': [3722, 4326], 'reveal': [3724], 'occupancy': [3726], 'transcriptionally': [3734], 'active': [3735], '(data': [3738, 4085], 'shown).': [3740], 'infected': [3753, 4013, 4041], 'adenoviral': [3759], 'constructs': [3760, 3785], 'encoding': [3761], 'wild-type,': [3763, 4016], 'dominant-negative,': [3764, 3797], 'proteins.': [3768], 'Expression': [3769], 'panel).': [3789], 'Wild-type': [3790], '(M.O.I.).': [3809], 'Modulates': [3811], 'Melanoma—HGF': [3817], '9Chin': [3861], 'assays,': [3880], 'strongly': [3891], 'responds': [3892], '4A).': [3896], 'displayed': [3900, 3933], 'Matrigel.': [3907], 'stands': [3909], 'contrast': [3911], '(A375,': [3922], 'SKMEL-28)': [3926], 'inherently': [3929], 'minimal': [3934], 'no': [3936], 'response': [3937], 'HGF.': [3939], 'Because': [3940], 'require': [3957, 4345], 'expressing': [3960], 'wild-type)': [3964], 'resistant': [3968], '4B).': [3974], 'Failure': [3975], 'invade': [3977], 'due': [3981], 'nonspecific': [3983], 'toxic': [3984], 'effects': [3985, 4093], 'morphology': [3996, 4037], 'adhered': [4000], 'grew': [4002], '4B,': [4008], 'Adhesion': [4009], 'Control).': [4010], 'control,': [4015], 'adenovirus': [4020], 'Mitf-dependent': [4027], 'behavior.': [4030], 'melanocytes,': [4035, 4300], 'adhesion': [4039], 'differing': [4065], 'efficiency': [4067], 'identical': [4071], 'experiment': [4072], 'line': [4078], 'stably': [4079], 'overexpressing': [4080], 'Bcl-2': [4081], 'shown),': [4087], 'providing': [4088, 4335], 'further': [4089, 4184], 'assurance': [4090], 'differences': [4099], 'survival.': [4102], 'implicate': [4105], 'modulating': [4108], 'HGF-responsive': [4114], 'levels.': [4121], 'Mitf—The': [4127], '(namely,': [4144], 'phospho-Met': [4145], 'induction,': [4146], 'followed': [4147], 'degradation,': [4154], 'finally': [4156], 'protein)': [4161], 'consistent': [4163], 'notion': [4166], 'requirement': [4174], 'intact': [4176], 'provides': [4183], 'mechanistic': [4185], 'evidence': [4186, 4337], 'possibility.': [4189], 'α-MSH': [4206, 4296, 4325], '(40Rusciano': [4207], '112': [4217], '(Pt.': [4218], '5):': [4219], '623-630Crossref': [4220], 'hormone': [4225], 'induces': [4228], '(41Bertolotto': [4230], 'Abbe': [4232], 'Bille': [4236], 'Ortonne': [4240], 'J.P.': [4241], 'Ballotti': [4242], '142:': [4248], '827-835Crossref': [4249], '(422)': [4252], '42Price': [4255], 'Landis': [4265], 'M.W.': [4266], '33042-33047Abstract': [4274], '(202)': [4282], 'microarray': [4287], 'screen': [4288], 'looking': [4289], 'α-MSH.': [4309], '4M.': [4310], 'Fisher,': [4315], 'unpublished': [4316], 'data.': [4317], 'occur': [4328], 'strong': [4336], 'cases': [4341], 'extracellular': [4343], 'ligands': [4344], 'c-Met.': [4350], 'pr': [4356]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W2032981041', 'counts_by_year': [{'year': 2024, 'cited_by_count': 6}, {'year': 2023, 'cited_by_count': 10}, {'year': 2022, 'cited_by_count': 4}, {'year': 2021, 'cited_by_count': 7}, {'year': 2020, 'cited_by_count': 7}, {'year': 2019, 'cited_by_count': 4}, {'year': 2018, 'cited_by_count': 5}, {'year': 2017, 'cited_by_count': 9}, {'year': 2016, 'cited_by_count': 7}, {'year': 2015, 'cited_by_count': 12}, {'year': 2014, 'cited_by_count': 12}, {'year': 2013, 'cited_by_count': 9}, {'year': 2012, 'cited_by_count': 7}], 'updated_date': '2025-01-07T23:24:32.999087', 'created_date': '2016-06-24'}