Publication Information

{'id': 'https://openalex.org/W2031647568', 'doi': 'https://doi.org/10.1074/jbc.272.30.19022', 'title': 'Angiotensin Type 2 Receptor Dephosphorylates Bcl-2 by Activating Mitogen-activated Protein Kinase Phosphatase-1 and Induces Apoptosis', 'display_name': 'Angiotensin Type 2 Receptor Dephosphorylates Bcl-2 by Activating Mitogen-activated Protein Kinase Phosphatase-1 and Induces Apoptosis', 'publication_year': 1997, 'publication_date': '1997-07-01', 'ids': {'openalex': 'https://openalex.org/W2031647568', 'doi': 'https://doi.org/10.1074/jbc.272.30.19022', 'mag': '2031647568', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/9228085'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.272.30.19022', 'pdf_url': 'http://www.jbc.org/article/S0021925818390835/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S0021925818390835/pdf', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5001563356', 'display_name': 'Masatsugu Horiuchi', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I1283280774', 'display_name': "Brigham and Women's Hospital", 'ror': 'https://ror.org/04b6nzv94', 'country_code': 'US', 'type': 'healthcare', 'lineage': ['https://openalex.org/I1283280774', 'https://openalex.org/I48633490']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Masatsugu Horiuchi', 'raw_affiliation_strings': ["Department of Medicine, Harvard Medical School, Brigham & Women's Hospital, Boston, Massachusetts 02115, USA."], 'affiliations': [{'raw_affiliation_string': "Department of Medicine, Harvard Medical School, Brigham & Women's Hospital, Boston, Massachusetts 02115, USA.", 'institution_ids': ['https://openalex.org/I1283280774']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5030046654', 'display_name': 'Wataru Hayashida', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I1283280774', 'display_name': "Brigham and Women's Hospital", 'ror': 'https://ror.org/04b6nzv94', 'country_code': 'US', 'type': 'healthcare', 'lineage': ['https://openalex.org/I1283280774', 'https://openalex.org/I48633490']}, {'id': 'https://openalex.org/I136199984', 'display_name': 'Harvard University', 'ror': 'https://ror.org/03vek6s52', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I136199984']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Wataru Hayashida', 'raw_affiliation_strings': ["From the Department of Medicine, Harvard Medical School, Brigham and Women's Hospital, Boston, Massachusetts 02115"], 'affiliations': [{'raw_affiliation_string': "From the Department of Medicine, Harvard Medical School, Brigham and Women's Hospital, Boston, Massachusetts 02115", 'institution_ids': ['https://openalex.org/I1283280774', 'https://openalex.org/I136199984']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5111625347', 'display_name': 'Toshie Kambe', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I1283280774', 'display_name': "Brigham and Women's Hospital", 'ror': 'https://ror.org/04b6nzv94', 'country_code': 'US', 'type': 'healthcare', 'lineage': ['https://openalex.org/I1283280774', 'https://openalex.org/I48633490']}, {'id': 'https://openalex.org/I136199984', 'display_name': 'Harvard University', 'ror': 'https://ror.org/03vek6s52', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I136199984']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Toshie Kambe', 'raw_affiliation_strings': ["From the Department of Medicine, Harvard Medical School, Brigham and Women's Hospital, Boston, Massachusetts 02115"], 'affiliations': [{'raw_affiliation_string': "From the Department of Medicine, Harvard Medical School, Brigham and Women's Hospital, Boston, Massachusetts 02115", 'institution_ids': ['https://openalex.org/I1283280774', 'https://openalex.org/I136199984']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5106082505', 'display_name': 'Takehiko Yamada', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I1283280774', 'display_name': "Brigham and Women's Hospital", 'ror': 'https://ror.org/04b6nzv94', 'country_code': 'US', 'type': 'healthcare', 'lineage': ['https://openalex.org/I1283280774', 'https://openalex.org/I48633490']}, {'id': 'https://openalex.org/I136199984', 'display_name': 'Harvard University', 'ror': 'https://ror.org/03vek6s52', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I136199984']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Takehiko Yamada', 'raw_affiliation_strings': ["From the Department of Medicine, Harvard Medical School, Brigham and Women's Hospital, Boston, Massachusetts 02115"], 'affiliations': [{'raw_affiliation_string': "From the Department of Medicine, Harvard Medical School, Brigham and Women's Hospital, Boston, Massachusetts 02115", 'institution_ids': ['https://openalex.org/I1283280774', 'https://openalex.org/I136199984']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5090663343', 'display_name': 'Victor J. Dzau', 'orcid': 'https://orcid.org/0000-0002-8280-519X'}, 'institutions': [{'id': 'https://openalex.org/I1283280774', 'display_name': "Brigham and Women's Hospital", 'ror': 'https://ror.org/04b6nzv94', 'country_code': 'US', 'type': 'healthcare', 'lineage': ['https://openalex.org/I1283280774', 'https://openalex.org/I48633490']}, {'id': 'https://openalex.org/I136199984', 'display_name': 'Harvard University', 'ror': 'https://ror.org/03vek6s52', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I136199984']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Victor J. Dzau', 'raw_affiliation_strings': ["From the Department of Medicine, Harvard Medical School, Brigham and Women's Hospital, Boston, Massachusetts 02115"], 'affiliations': [{'raw_affiliation_string': "From the Department of Medicine, Harvard Medical School, Brigham and Women's Hospital, Boston, Massachusetts 02115", 'institution_ids': ['https://openalex.org/I1283280774', 'https://openalex.org/I136199984']}]}], 'institution_assertions': [], 'countries_distinct_count': 1, 'institutions_distinct_count': 2, 'corresponding_author_ids': [], 'corresponding_institution_ids': [], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 20.651, 'has_fulltext': True, 'fulltext_origin': 'ngrams', 'cited_by_count': 301, 'citation_normalized_percentile': {'value': 0.977722, 'is_in_top_1_percent': False, 'is_in_top_10_percent': True}, 'cited_by_percentile_year': {'min': 98, 'max': 99}, 'biblio': {'volume': '272', 'issue': '30', 'first_page': '19022', 'last_page': '19026'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T11001', 'display_name': 'Renin-Angiotensin System Studies', 'score': 0.9986, 'subfield': {'id': 'https://openalex.org/subfields/2705', 'display_name': 'Cardiology and Cardiovascular Medicine'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, 'topics': [{'id': 'https://openalex.org/T11001', 'display_name': 'Renin-Angiotensin System Studies', 'score': 0.9986, 'subfield': {'id': 'https://openalex.org/subfields/2705', 'display_name': 'Cardiology and Cardiovascular Medicine'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, {'id': 'https://openalex.org/T11839', 'display_name': 'Hormonal Regulation and Hypertension', 'score': 0.9936, 'subfield': {'id': 'https://openalex.org/subfields/2712', 'display_name': 'Endocrinology, Diabetes and Metabolism'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, {'id': 'https://openalex.org/T10211', 'display_name': 'Computational Drug Discovery Methods', 'score': 0.9919, 'subfield': {'id': 'https://openalex.org/subfields/1703', 'display_name': 'Computational Theory and Mathematics'}, 'field': {'id': 'https://openalex.org/fields/17', 'display_name': 'Computer Science'}, 'domain': {'id': 'https://openalex.org/domains/3', 'display_name': 'Physical Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/ask1', 'display_name': 'ASK1', 'score': 0.5229728}], 'concepts': [{'id': 'https://openalex.org/C178666793', 'wikidata': 'https://www.wikidata.org/wiki/Q422476', 'display_name': 'Phosphatase', 'level': 3, 'score': 0.5632527}, {'id': 'https://openalex.org/C90934575', 'wikidata': 'https://www.wikidata.org/wiki/Q6593810', 'display_name': 'Mitogen-activated protein kinase kinase', 'level': 4, 'score': 0.5279597}, {'id': 'https://openalex.org/C124160383', 'wikidata': 'https://www.wikidata.org/wiki/Q14914383', 'display_name': 'ASK1', 'level': 5, 'score': 0.5229728}, {'id': 'https://openalex.org/C97029542', 'wikidata': 'https://www.wikidata.org/wiki/Q281417', 'display_name': 'Protein kinase A', 'level': 3, 'score': 0.5117533}, {'id': 'https://openalex.org/C137361374', 'wikidata': 'https://www.wikidata.org/wiki/Q6714442', 'display_name': 'MAP kinase kinase kinase', 'level': 4, 'score': 0.50475514}, {'id': 'https://openalex.org/C185592680', 'wikidata': 'https://www.wikidata.org/wiki/Q2329', 'display_name': 'Chemistry', 'level': 0, 'score': 0.4950313}, {'id': 'https://openalex.org/C95444343', 'wikidata': 'https://www.wikidata.org/wiki/Q7141', 'display_name': 'Cell biology', 'level': 1, 'score': 0.4869674}, {'id': 'https://openalex.org/C184235292', 'wikidata': 'https://www.wikidata.org/wiki/Q421851', 'display_name': 'Kinase', 'level': 2, 'score': 0.45672}, {'id': 'https://openalex.org/C104849204', 'wikidata': 'https://www.wikidata.org/wiki/Q24778533', 'display_name': 'Angiotensin receptor', 'level': 4, 'score': 0.44938344}, {'id': 'https://openalex.org/C132149769', 'wikidata': 'https://www.wikidata.org/wiki/Q899651', 'display_name': 'Mitogen-activated protein kinase', 'level': 3, 'score': 0.4186006}, {'id': 'https://openalex.org/C2908929049', 'wikidata': 'https://www.wikidata.org/wiki/Q65963433', 'display_name': 'Angiotensin II', 'level': 3, 'score': 0.4111954}, {'id': 'https://openalex.org/C170493617', 'wikidata': 'https://www.wikidata.org/wiki/Q208467', 'display_name': 'Receptor', 'level': 2, 'score': 0.35631236}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.246355}, {'id': 'https://openalex.org/C55493867', 'wikidata': 'https://www.wikidata.org/wiki/Q7094', 'display_name': 'Biochemistry', 'level': 1, 'score': 0.19853023}, {'id': 'https://openalex.org/C11960822', 'wikidata': 'https://www.wikidata.org/wiki/Q242736', 'display_name': 'Phosphorylation', 'level': 2, 'score': 0.1504986}], 'mesh': [{'descriptor_ui': 'D017209', 'descriptor_name': 'Apoptosis', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': True}, {'descriptor_ui': 'D018797', 'descriptor_name': 'Cell Cycle Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': True}, {'descriptor_ui': 'D017874', 'descriptor_name': 'Immediate-Early Proteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D010749', 'descriptor_name': 'Phosphoprotein Phosphatases', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': True}, {'descriptor_ui': 'D017027', 'descriptor_name': 'Protein Tyrosine Phosphatases', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D019253', 'descriptor_name': 'Proto-Oncogene Proteins c-bcl-2', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D011945', 'descriptor_name': 'Receptors, Angiotensin', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D000818', 'descriptor_name': 'Animals', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D017871', 'descriptor_name': 'Calcium-Calmodulin-Dependent Protein Kinases', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D017871', 'descriptor_name': 'Calcium-Calmodulin-Dependent Protein Kinases', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D053938', 'descriptor_name': 'DNA Fragmentation', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D054638', 'descriptor_name': 'Dual Specificity Phosphatase 1', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D017874', 'descriptor_name': 'Immediate-Early Proteins', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D017874', 'descriptor_name': 'Immediate-Early Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D009414', 'descriptor_name': 'Nerve Growth Factors', 'qualifier_ui': 'Q000494', 'qualifier_name': 'pharmacology', 'is_major_topic': False}, {'descriptor_ui': 'D009414', 'descriptor_name': 'Nerve Growth Factors', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D016376', 'descriptor_name': 'Oligonucleotides, Antisense', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D016376', 'descriptor_name': 'Oligonucleotides, Antisense', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D016716', 'descriptor_name': 'PC12 Cells', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D010766', 'descriptor_name': 'Phosphorylation', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D054645', 'descriptor_name': 'Protein Phosphatase 1', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D054562', 'descriptor_name': 'Protein Tyrosine Phosphatase, Non-Receptor Type 1', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D017027', 'descriptor_name': 'Protein Tyrosine Phosphatases', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D017027', 'descriptor_name': 'Protein Tyrosine Phosphatases', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D019253', 'descriptor_name': 'Proto-Oncogene Proteins c-bcl-2', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D051381', 'descriptor_name': 'Rats', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D044139', 'descriptor_name': 'Receptor, Angiotensin, Type 2', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011945', 'descriptor_name': 'Receptors, Angiotensin', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}], 'locations_count': 2, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.272.30.19022', 'pdf_url': 'http://www.jbc.org/article/S0021925818390835/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/9228085', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.272.30.19022', 'pdf_url': 'http://www.jbc.org/article/S0021925818390835/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 37, 'referenced_works': ['https://openalex.org/W1525671373', 'https://openalex.org/W1527240164', 'https://openalex.org/W1527321128', 'https://openalex.org/W1529902870', 'https://openalex.org/W1531502369', 'https://openalex.org/W1572746674', 'https://openalex.org/W1573821584', 'https://openalex.org/W1591510379', 'https://openalex.org/W1951537243', 'https://openalex.org/W1970020870', 'https://openalex.org/W1976385326', 'https://openalex.org/W1978798502', 'https://openalex.org/W1980935930', 'https://openalex.org/W1990761820', 'https://openalex.org/W1991619717', 'https://openalex.org/W1993112793', 'https://openalex.org/W1994400879', 'https://openalex.org/W1996522179', 'https://openalex.org/W1997932090', 'https://openalex.org/W2010031713', 'https://openalex.org/W2018541556', 'https://openalex.org/W2020796092', 'https://openalex.org/W2024582476', 'https://openalex.org/W2027850428', 'https://openalex.org/W2040945511', 'https://openalex.org/W2047994580', 'https://openalex.org/W2058591356', 'https://openalex.org/W2068502127', 'https://openalex.org/W2078458079', 'https://openalex.org/W2084403011', 'https://openalex.org/W2087965346', 'https://openalex.org/W2094938518', 'https://openalex.org/W2111175065', 'https://openalex.org/W2115701574', 'https://openalex.org/W2131033837', 'https://openalex.org/W2149060182', 'https://openalex.org/W2150462979'], 'related_works': ['https://openalex.org/W2349470516', 'https://openalex.org/W2089196414', 'https://openalex.org/W2082355820', 'https://openalex.org/W2072278036', 'https://openalex.org/W2043106387', 'https://openalex.org/W2025745100', 'https://openalex.org/W1998487776', 'https://openalex.org/W1967564946', 'https://openalex.org/W1967218150', 'https://openalex.org/W1518599846'], 'abstract_inverted_index': {'We': [0, 64, 181, 245, 682, 1720, 1810, 1829, 2180, 2275, 2320, 2501, 2611, 3519, 4153], 'examined': [1, 182, 1794, 2322, 2407, 2503, 3627, 4094], 'the': [2, 44, 66, 81, 119, 132, 172, 177, 183, 225, 247, 262, 300, 313, 353, 358, 378, 427, 570, 577, 584, 688, 858, 861, 889, 913, 924, 1014, 1023, 1110, 1184, 1243, 1294, 1301, 1504, 1534, 1539, 1554, 1748, 1795, 1798, 1820, 1832, 1958, 1964, 1978, 2025, 2033, 2042, 2069, 2073, 2086, 2120, 2162, 2175, 2194, 2233, 2257, 2265, 2282, 2300, 2305, 2309, 2323, 2341, 2369, 2373, 2408, 2414, 2504, 2528, 2604, 2657, 2713, 2805, 2809, 2832, 2844, 2901, 2942, 2955, 3063, 3077, 3088, 3114, 3200, 3241, 3252, 3301, 3375, 3378, 3410, 3429, 3435, 3509, 3523, 3647, 3671, 3688, 3724, 3784, 3793, 3874, 3880, 3884, 3905, 3911, 3922, 3933, 3959, 4004, 4007, 4087, 4095, 4102, 4162, 4207], 'cellular': [3, 184, 430, 2534, 3091, 3105, 3125], 'and': [4, 61, 70, 127, 143, 176, 185, 242, 251, 308, 324, 357, 367, 398, 429, 538, 545, 552, 563, 610, 683, 801, 804, 810, 879, 1002, 1012, 1080, 1097, 1100, 1133, 1151, 1168, 1183, 1221, 1235, 1247, 1267, 1311, 1320, 1346, 1545, 1572, 1590, 1626, 1753, 1764, 1817, 1977, 1990, 1992, 2011, 2018, 2118, 2172, 2200, 2252, 2424, 2440, 2453, 2464, 2488, 2518, 2600, 2608, 2625, 2654, 2712, 2769, 2821, 2963, 3075, 3090, 3137, 3202, 3213, 3286, 3406, 3413, 3449, 3540, 3549, 3638, 3704, 3798, 3878, 3888, 3921, 3949, 3955, 3962, 4145, 4188, 4201], 'signaling': [5, 186, 373, 461, 587, 2074, 3464], 'mechanism': [6, 67, 187, 248, 390, 431, 3092, 3510], 'of': [7, 68, 112, 121, 135, 174, 179, 188, 249, 293, 302, 316, 355, 360, 364, 380, 391, 432, 572, 847, 860, 877, 916, 926, 1016, 1025, 1112, 1156, 1191, 1296, 1299, 1506, 1541, 1576, 1622, 1628, 1751, 1768, 1822, 1845, 1960, 2027, 2041, 2045, 2088, 2177, 2197, 2235, 2268, 2284, 2308, 2325, 2344, 2363, 2372, 2417, 2436, 2506, 2525, 2530, 2541, 2606, 2649, 2715, 2831, 2843, 2852, 2910, 2941, 3079, 3093, 3116, 3199, 3205, 3243, 3284, 3328, 3377, 3431, 3511, 3513, 3525, 3674, 3685, 3702, 3788, 3795, 3876, 3907, 3926, 3929, 4006, 4090, 4105, 4143, 4151, 4158, 4209], 'angiotensin': [8, 189, 483, 515], 'II': [9, 32, 54, 190, 213, 235, 487, 519, 592, 616, 1131, 1318, 1326, 1770, 1824, 1840, 1988, 2031, 2049, 2063, 2461, 2470, 3607], '(Ang': [10, 191, 593], 'II)': [11, 192, 594], 'type': [12, 33, 193, 214, 488, 520, 617, 1771, 3608], '2': [13, 194, 1065, 2239, 2273, 2294, 2318], '(AT2)': [14, 195], 'receptor-induced': [15, 196], 'apoptosis': [16, 75, 159, 197, 256, 340, 806, 856, 871, 1755, 1802, 2526, 2621, 2959, 3084, 3096, 3696, 3800, 4182], 'in': [17, 157, 171, 198, 338, 352, 400, 535, 598, 807, 854, 888, 1018, 1022, 1031, 1074, 1083, 1095, 1115, 1153, 1214, 1305, 1498, 1538, 1756, 1974, 2015, 2085, 2174, 2189, 2290, 2334, 2447, 2594, 2629, 2639, 2718, 2724, 2813, 2827, 2849, 2891, 2960, 2964, 3072, 3076, 3082, 3409, 3428, 3537, 3619, 3631, 3650, 3680, 3904, 3910, 3953, 4010, 4134, 4180, 4183, 4206], 'PC12W': [18, 199, 418, 458, 808, 1019, 1027, 1054, 1486, 1582, 1757, 1967, 2089, 2190, 2213, 2245, 2291, 2595, 2962, 3333, 3538, 3632, 4135, 4184], '(rat': [19, 200], 'pheochromocytoma': [20, 201, 419], 'cell': [21, 58, 202, 239, 365, 368, 392, 420, 536, 566, 585, 816, 862, 894, 1254, 1329, 3256, 3411, 3416, 3652, 3912], 'line)': [22, 203, 817], 'cells': [23, 204, 809, 813, 1028, 1055, 1070, 1090, 1123, 1145, 1302, 1487, 1535, 1569, 1583, 1814, 1968, 1980, 2090, 2214, 2292, 2444, 2596, 2898, 2966, 3334, 3539, 3633, 4185], 'that': [24, 150, 205, 331, 375, 394, 460, 687, 796, 844, 882, 912, 997, 1744, 1797, 1831, 2022, 2060, 2112, 2119, 2161, 2227, 2277, 2299, 2340, 2354, 2410, 2422, 2548, 2589, 2613, 2789, 2804, 2841, 2954, 3065, 3240, 3250, 3424, 3522, 3541, 3605, 3640, 3662, 3723, 3786, 3871, 3879, 3894, 4083, 4097, 4156, 4173], 'express': [25, 206, 1760], 'abundant': [26, 207, 1761, 2647, 3014], 'AT2': [27, 71, 85, 101, 136, 164, 208, 252, 266, 282, 317, 345, 627, 689, 1003, 1745, 1762, 1799, 1961, 2056, 2070, 2121, 2163, 2253, 2310, 2374, 2425, 2512, 2601, 2619, 2650, 2716, 2806, 2833, 2845, 2902, 2943, 2956, 3015, 3066, 3094, 3436, 3534, 3635, 3641, 3663, 3881, 4146, 4163, 4192], 'receptor': [28, 72, 86, 102, 137, 165, 209, 253, 267, 283, 318, 346, 623, 628, 690, 1004, 1746, 1763, 1773, 1800, 1962, 2057, 2122, 2164, 2254, 2311, 2375, 2426, 2602, 2651, 2717, 2791, 2807, 2834, 2846, 2903, 2944, 2957, 3067, 3535, 3610, 3636, 3642, 3664, 3882, 4147, 4193], 'but': [29, 130, 210, 311], 'not': [30, 211, 1836, 2428, 3098, 3517, 3645, 3655, 4139], 'Ang': [31, 53, 212, 234, 481, 486, 513, 518, 615, 1130, 1317, 1325, 1564, 1769, 1823, 1839, 1987, 2030, 2048, 2062, 2441, 2460, 2469, 3606], '1': [34, 215, 618, 1010, 1161, 1164, 1551, 1772, 2038, 3609], 'receptor.': [35, 216, 619, 2071, 3437], 'In': [36, 217, 569, 839, 1790, 2241, 2582, 3107, 3573, 3866], 'these': [37, 147, 218, 328, 1813, 3659, 4169], 'cells,': [38, 219, 459, 1020, 1758, 2246, 2586, 3109, 4136], 'nerve': [39, 220, 478, 510, 573], 'growth': [40, 221, 479, 511, 574, 3117, 3121, 3257, 3462], 'factor': [41, 83, 222, 264, 575, 864, 3463], '(NGF)': [42, 223], 'inhibited': [43, 224, 1013, 2032, 2256, 2591, 3883], 'internucleosomal': [45, 226], 'DNA': [46, 227, 1577, 1616, 1629, 2514, 2535, 2554, 2637, 2816, 2911, 4165], 'fragmentation': [47, 228, 1630, 2515, 2638], 'induced': [48, 62, 229, 243, 872, 2609, 3613, 3697, 3889], 'by': [49, 76, 98, 160, 230, 257, 279, 341, 873, 1051, 1223, 1237, 1281, 1359, 1708, 1711, 2009, 2047, 2052, 2130, 2348, 2438, 2556, 3282, 3289, 3300, 3373, 3434, 3546, 3682, 3698, 4186, 4198], 'serum': [50, 231, 1544, 1549, 2598, 2633], 'depletion,': [51, 232], 'whereas': [52, 100, 233, 281, 558, 583, 2029], 'antagonized': [55, 236, 2603], 'this': [56, 105, 237, 286, 840, 845, 1791, 2061, 2790, 2890, 3514, 3542, 3651, 3867, 3930], 'NGF': [57, 69, 106, 122, 238, 250, 287, 303, 1127, 1314, 1321, 1752, 1816, 1984, 2023, 2247, 2285, 2423, 2439, 2456, 2465, 2590, 2607, 3872, 4144], 'survival': [59, 82, 240, 263, 366, 537, 556, 578, 863, 2087, 3136, 3414, 3913], 'action': [60, 241, 3115, 3376], 'apoptosis.': [63, 144, 180, 244, 325, 361, 433, 1026, 2610, 3890, 4210], 'studied': [65, 246, 1819], 'interaction': [73, 254], 'on': [74, 80, 123, 138, 255, 261, 304, 319, 1260, 1339, 1806, 1825, 1957, 1963, 2286, 2312, 2329, 2376, 2481, 2511, 2945, 3211, 4148, 4168], 'examining': [77, 258], 'their': [78, 259, 1248], 'effects': [79, 120, 134, 260, 301, 315], 'Bcl-2.': [84, 162, 265, 343, 865, 2364, 2418, 4091, 4152, 4190], 'activation': [87, 103, 126, 268, 284, 307, 803, 2261, 2289, 2316, 2357, 2529, 3381, 3512, 3898, 4197], 'did': [88, 269, 3644, 4138], 'affect': [89, 270], 'intracellular': [90, 271], 'Bcl-2': [91, 94, 128, 141, 175, 272, 275, 309, 322, 356, 866, 883, 917, 927, 1001, 1017, 1192, 1244, 1270, 1334, 1588, 1807, 1826, 1833, 1846, 1965, 2006, 2035, 2046, 2116, 2178, 2330, 2345, 2377, 2437, 2478, 3689, 3691, 3725, 3789, 3796, 3877, 3886, 3957, 4011], 'protein': [92, 114, 273, 295, 464, 561, 1206, 1366, 1827, 2237, 3726], 'levels.': [93, 274, 1828], 'phosphorylation': [95, 129, 276, 310, 920, 1015, 1298, 1844, 2036, 2044, 2117, 2343, 2362, 2431, 2435, 3210, 3787, 3875, 3887, 3906], 'was': [96, 277, 1049, 1186, 1228, 1250, 1357, 1556, 1706, 1717, 1835, 2050, 2346, 3330, 3439, 3528, 3544], 'stimulated': [97, 278, 1312, 1812, 2024, 2454], 'NGF,': [99, 280, 477, 509, 3132], 'blocked': [104, 285, 2618, 3545, 4161], 'effect.': [107, 288], 'Pretreatment': [108, 289], 'with': [109, 290, 1039, 1102, 1126, 1148, 1188, 1205, 1230, 1269, 1313, 1333, 1348, 1406, 1490, 1561, 1815, 1838, 1971, 1983, 2005, 2210, 2217, 2455, 2477, 2490, 2795, 2889, 2900], 'antisense': [110, 291, 1494, 1580, 2182, 2211, 2220, 2229, 2279, 2302, 2327, 2350, 2508, 2615, 2641, 3420], 'oligonucleotide': [111, 292, 1495, 2183, 2230, 2328, 2351, 2509, 2616, 2642], 'mitogen-activated': [113, 294, 463, 471, 503], '(MAP)': [115, 296, 465], 'kinase': [116, 125, 152, 168, 297, 306, 333, 349, 492, 524, 562, 799, 849, 999, 1008, 1355, 1592, 2114, 2126, 2170, 2250, 2260, 2270, 2288, 2315, 2356, 3102, 3111, 3207, 3245, 3371, 3380, 3433, 3527, 3897, 3916, 3931, 4085, 4175, 4196], 'phosphatase-1': [117, 298], 'enhanced': [118, 299, 2281, 2347, 3873], 'MAP': [124, 139, 151, 167, 305, 320, 332, 348, 491, 523, 547, 798, 848, 998, 1007, 1354, 1591, 2077, 2113, 2125, 2169, 2249, 2259, 2269, 2287, 2314, 2355, 3101, 3110, 3206, 3244, 3370, 3379, 3432, 3526, 3896, 3915, 4084, 4174, 4195], 'attenuated': [131, 312, 2304, 2368], 'inhibitory': [133, 314, 2370], 'kinase,': [140, 321, 3920], 'phosphorylation,': [142, 323, 1589, 3731], 'Taken': [145, 326, 3657], 'together,': [146, 327, 3658], 'results': [148, 329, 2173, 2848, 3061, 3660, 3892, 4081], 'suggest': [149, 330, 2788, 3661, 3893, 4082], 'plays': [153, 334, 531, 850, 3068, 4176], 'a': [154, 335, 385, 532, 621, 692, 851, 874, 885, 1059, 1407, 2054, 2082, 2131, 2553, 3247, 3290, 3457, 3683, 3699, 3918, 4177], 'critical': [155, 336, 533, 2083, 3248, 4178], 'role': [156, 337, 534, 853, 2084, 3071, 4179], 'inhibiting': [158, 339], 'phosphorylating': [161, 342, 4187], 'The': [163, 344, 362, 416, 1069, 1089, 1121, 1144, 1226, 1239, 1328, 2443, 2520, 2645, 4191], 'inhibits': [166, 347, 797, 2123, 2167, 4194], 'activation,': [169, 350, 2171], 'resulting': [170, 351, 1021, 3408, 3909, 4205], 'inactivation': [173, 354, 846, 859, 3242, 3279, 3430], 'induction': [178, 359, 1024, 3673], 'processes': [363], 'death': [369, 393, 567, 586, 895], 'involve': [370], 'highly': [371, 2646], 'regulated': [372, 2129, 2811], 'pathways': [374], 'are': [376, 1603, 1698, 2549], 'currently': [377], 'subject': [379], 'intense': [381], 'investigation.': [382], 'Apoptosis': [383, 3677], 'is': [384, 422, 581, 589, 921, 1847, 2065, 2128, 2203, 2358, 2527, 2792, 3085, 3246, 3280, 3298, 3426, 3516, 3678, 3790, 3899, 3917, 3932], 'ubiquitous,': [386], 'evolutionally': [387], 'conserved,': [388], 'physiological': [389, 1851, 3253], 'regulates': [395, 1801, 3251], 'tissue': [396, 608], 'mass': [397], 'architecture': [399], 'many': [401], 'tissues': [402, 602], '(1Wyllie': [403], 'A.H.': [404], 'Cancer': [405], 'Metastasis': [406], 'Rev.': [407], '1992;': [408, 712, 2780, 3142, 3187, 3773, 3993], '11:': [409], '95-103Crossref': [410], 'PubMed': [411, 451, 653, 679, 715, 748, 769, 791, 834, 904, 950, 969, 989, 1403, 1438, 1459, 1481, 1527, 1652, 1667, 1691, 1739, 1785, 1874, 1893, 1913, 1951, 2105, 2152, 2400, 2577, 2678, 2707, 2743, 2783, 2883, 2933, 2983, 3007, 3028, 3055, 3148, 3175, 3193, 3231, 3273, 3320, 3358, 3401, 3480, 3503, 3568, 3601, 3714, 3751, 3776, 3822, 3841, 3861, 3946, 3981, 4036, 4055, 4075, 4128], 'Scopus': [412, 452, 716, 749, 770, 792, 835, 905, 970, 990, 1439, 1460, 1482, 1528, 1653, 1668, 1692, 1740, 1786, 1894, 1914, 2106, 2153, 2401, 2578, 2679, 2708, 2784, 2884, 2984, 3008, 3029, 3056, 3149, 3194, 3232, 3274, 3321, 3359, 3402, 3481, 3504, 3569, 3715, 3752, 3777, 3842, 3862, 3982, 3999, 4056, 4076, 4129], '(575)': [413], 'Google': [414, 454, 654, 680, 718, 751, 772, 794, 837, 907, 951, 972, 992, 1404, 1441, 1462, 1484, 1530, 1655, 1670, 1694, 1742, 1788, 1875, 1896, 1916, 1952, 2108, 2155, 2403, 2580, 2681, 2693, 2710, 2744, 2786, 2886, 2934, 2986, 3010, 3031, 3044, 3058, 3151, 3176, 3196, 3234, 3276, 3323, 3361, 3404, 3483, 3506, 3571, 3602, 3717, 3754, 3779, 3823, 3844, 3864, 3947, 3984, 4001, 4037, 4058, 4078, 4131], 'Scholar).': [415, 681, 838, 908, 993, 1485, 1531, 1695, 1789, 2581, 2887, 3059, 3197, 3235, 3277, 3324, 3362, 3507, 3572, 3718, 3780, 3865, 4002, 4079, 4132], 'rat': [417, 2814, 2838, 3620], 'line': [421, 3653], 'widely': [423], 'used': [424, 468, 500, 1586], 'to': [425, 1242, 1362, 1503, 1558, 1574, 2080, 2159, 2184, 2193, 2361, 3365, 3455, 3460, 3732, 3902], 'examine': [426], 'molecular': [428, 3089], 'Xia': [434], 'et': [435, 1508, 3576], 'al.': [436, 1509, 2914, 3577], '(2Xia': [437, 2091], 'Z.': [438, 2092], 'Dickens': [439, 2093], 'M.': [440, 633, 635, 637, 707, 721, 725, 733, 756, 777, 821, 1393, 1411, 1415, 1423, 1446, 1467, 1639, 1673, 1726, 1941, 2094, 2559, 2669, 2700, 2734, 2736, 2773, 2856, 2860, 2868, 2916, 2918, 2920, 2970, 2989, 3555, 3965], 'Raingeard': [441, 2095], 'J.': [442, 644, 670, 780, 898, 941, 978, 1394, 1470, 1516, 1661, 1680, 1865, 1902, 1942, 2096, 2566, 2672, 2688, 2737, 2749, 2763, 2927, 2996, 3166, 3185, 3220, 3347, 3592, 3708, 3813, 3850, 3937, 3991, 4027, 4064], 'Davis': [443, 2097], 'R.J.': [444, 2098, 3936], 'Greenberg': [445, 2099], 'M.E.': [446, 2100], 'Science.': [447, 2101], '1995;': [448, 745, 966, 1435, 1519, 1890, 2102, 2740, 2880, 2930, 3223, 3350, 3838, 4052], '270:': [449, 1520, 2103, 3224, 3351], '1326-1331Crossref': [450, 2104], '(5019)': [453, 2107], 'Scholar)': [455, 795, 1405, 1743, 2787, 2935, 3405, 3603, 3948], 'demonstrate,': [456], 'using': [457, 1287, 2826], 'through': [462, 2076], '1The': [466, 498], 'abbreviations': [467, 499], 'are:': [469, 501], 'MAP,': [470, 502], 'protein;': [472, 504], 'ERK,': [473, 505], 'extracellular': [474, 506], 'signal-regulated': [475, 507, 541], 'kinase;': [476, 508], 'factor;': [480, 512], 'II,': [482, 514], 'II;': [484, 516], 'AT2,': [485, 517], '2;': [489, 521], 'MKP,': [490, 522], 'phosphatase;': [493, 525], 'PAGE,': [494, 526], 'polyacrylamide': [495, 527], 'gel': [496, 528, 1227, 1624], 'electrophoresis.': [497, 529], 'kinases': [530, 542, 548, 2078], 'death.': [539, 3417], 'Extracellular': [540], '(ERK)': [543], '(p42': [544], 'p44': [546, 3203], 'known': [549, 625, 2134, 3294], 'as': [550, 555, 626, 919, 1367, 1595, 1604, 1633, 1700, 2135, 2262, 2264, 2552, 2723, 3127, 3129, 3295, 3441], 'p42MAPK/ERK2': [551], 'p44MAPK/ERK1)': [553, 802], 'act': [554], 'signals,': [557], 'c-JUN': [559], 'NH2-terminal': [560], 'p38': [564], 'exert': [565], 'signaling.': [568], 'presence': [571, 1540], '(NGF),': [576], 'signal': [579], 'pathway': [580, 588, 892, 2075], 'activated,': [582], 'suppressed.': [590], 'Angiotensin': [591], 'exerts': [595, 4109], 'various': [596, 3366], 'actions': [597], 'its': [599, 1360, 1804, 1850], 'diverse': [600], 'target': [601, 2206], 'controlling': [603], 'vascular': [604, 2895, 3621], 'tone,': [605], 'hormone': [606], 'secretion,': [607], 'growth,': [609, 2656, 2796], 'neuronal': [611, 3108, 3135], 'activities': [612], 'primarily': [613], 'via': [614, 857, 1803, 2068], 'Recently,': [620, 3325], 'second': [622], 'subtype': [624], 'has': [629, 3097, 3237, 3720, 4012], 'been': [630, 3099, 3238, 3453, 3721, 4013], 'cloned': [631], '(3Mukoyama': [632], 'Nakajima': [634], 'Horiuchi': [636, 732, 755, 776, 820, 1422, 1445, 1466, 1638, 1725, 2867, 2969, 3554], 'Sasamura': [638], 'H.': [639, 665, 723, 1375, 1413, 1923, 2138, 2386, 2730, 2757, 2858, 3259, 3306, 3342, 3386, 3466, 3488, 4114], 'Pratt': [640, 734, 1424, 2869], 'R.E.': [641, 735, 1425, 2870], 'Dzau': [642, 736, 757, 778, 822, 1426, 1447, 1468, 1640, 1678, 1727, 2564, 2871, 2971, 2994, 3556], 'V.J.': [643, 737, 758, 779, 823, 1427, 1448, 1469, 1641, 1679, 1728, 2565, 2872, 2972, 2995, 3557], 'Biol.': [645, 671, 781, 900, 942, 979, 1395, 1471, 1517, 1681, 1866, 1903, 1943, 2567, 2997, 3167, 3221, 3348, 3593, 3710, 3814, 3851, 3938, 4028, 4065], 'Chem.': [646, 672, 782, 943, 980, 1396, 1472, 1518, 1682, 1867, 1904, 1944, 2568, 2998, 3168, 3222, 3349, 3594, 3815, 3852, 3939, 4029, 4066], '1993;': [647, 673, 1664, 2146, 2394, 3052, 3169, 3267, 3314, 3398, 3474, 3500, 3595, 3745, 3940, 4122], '268:': [648, 674, 3170, 3596, 3941], '24539-24542Abstract': [649], 'Full': [650, 676, 786, 788, 947, 984, 986, 1400, 1476, 1478, 1522, 1524, 1686, 1688, 1871, 1908, 1910, 1948, 2149, 2397, 2572, 2574, 3002, 3004, 3145, 3172, 3190, 3226, 3228, 3270, 3317, 3353, 3355, 3477, 3598, 3748, 3819, 3856, 3858, 3943, 3978, 3996, 4033, 4070, 4072, 4125], 'Text': [651, 677, 787, 789, 948, 985, 987, 1401, 1477, 1479, 1523, 1525, 1687, 1689, 1872, 1909, 1911, 1949, 2150, 2398, 2573, 2575, 3003, 3005, 3146, 3173, 3191, 3227, 3229, 3271, 3318, 3354, 3356, 3478, 3599, 3749, 3820, 3857, 3859, 3944, 3979, 3997, 4034, 4071, 4073, 4126], 'PDF': [652, 678, 790, 949, 988, 1402, 1480, 1526, 1690, 1873, 1912, 1950, 2151, 2399, 2576, 3006, 3147, 3174, 3192, 3230, 3272, 3319, 3357, 3479, 3600, 3750, 3821, 3860, 3945, 3980, 3998, 4035, 4074, 4127], 'Scholar,': [655, 719, 752, 773, 952, 973, 1442, 1463, 1656, 1671, 1876, 1897, 1917, 2682, 2694, 2987, 3032, 3045, 3152, 3177, 3484, 3755, 3824, 3845, 3985, 4038, 4059], '4Kambayashi': [656], 'Y.': [657, 1385, 1389, 1391, 1933, 1937, 1939, 2728, 3971], 'Bardhan': [658], 'S.': [659, 663, 700, 743, 764, 829, 954, 964, 1433, 1454, 1647, 1734, 1878, 1888, 2732, 2878, 2978, 3396, 3498, 3563, 3739, 3771, 3826, 3836, 4040, 4050], 'Takahashi': [660], 'K.': [661, 1371, 1377, 1379, 1383, 1919, 1925, 1927, 1931, 2684, 2696], 'Tsuzuki': [662], 'Inui': [664], 'Hamakubo': [666], 'T.': [667, 669, 754, 819, 934, 1373, 1444, 1637, 1675, 1724, 1858, 1921, 2561, 2926, 2968, 2991, 3553, 3737, 3806, 4020], 'Inagami': [668], '24543-24546Abstract': [675], 'others': [684], 'have': [685, 2802, 2823, 2952, 3452], 'demonstrated': [686, 996, 1722, 2276, 2803, 2953, 3423, 3870], 'stimulates': [691, 3124], 'tyrosine': [693, 1297, 2382, 2415, 2430, 4103, 4110, 4149], 'phosphatase': [694, 1009, 2133, 2383, 3293, 3515, 3668, 4111], '(5Bottari': [695], 'S.P.': [696, 2922], 'King': [697], 'I.N.': [698], 'Reichlin': [699], 'Dahlstroem': [701], 'I.': [702], 'Lydon': [703], 'N.': [704, 956, 1880, 3828, 4042], 'de': [705], 'Gasparo': [706], 'Biochem.': [708, 1778, 3021], 'Biophys.': [709, 1779, 3022], 'Res.': [710, 1780, 3023], 'Commun.': [711, 1781, 3024], '183:': [713], '206-211Crossref': [714], '(234)': [717], '6Nakajima': [720], 'Hutchinson': [722, 1412, 2857], 'Fujinaga': [724, 1414, 2859], 'Hayashida': [726, 1416, 1676, 2562, 2861, 2992], 'W.': [727, 775, 1417, 1465, 1677, 2563, 2862, 2993], 'Morishita': [728, 1418, 2863], 'R.': [729, 1419, 2864, 2924], 'Zhang': [730, 1420, 2865], 'L.': [731, 1421, 2866], 'Proc.': [738, 759, 824, 959, 1428, 1449, 1642, 1729, 1883, 2873, 2973, 3391, 3493, 3558, 3766, 3831, 4045], 'Natl.': [739, 760, 825, 960, 1429, 1450, 1643, 1730, 1884, 2874, 2974, 3392, 3494, 3559, 3767, 3832, 4046], 'Acad.': [740, 761, 826, 961, 1430, 1451, 1644, 1731, 1885, 2875, 2975, 3393, 3495, 3560, 3768, 3833, 4047], 'Sci.': [741, 762, 827, 1431, 1452, 1645, 1732, 2876, 2976, 3394, 3496, 3561, 3769], 'U.': [742, 763, 828, 963, 1432, 1453, 1646, 1733, 1887, 2877, 2977, 3395, 3497, 3562, 3770, 3835, 4049], 'A.': [744, 765, 830, 965, 1434, 1455, 1648, 1735, 1889, 2879, 2979, 3338, 3397, 3499, 3564, 3772, 3837, 4051], '92:': [746, 967, 1436, 1891, 2881, 3839, 4053], '10663-10667Crossref': [747, 1437, 2882], '(641)': [750, 1440, 2885], '7Yamada': [753, 1443], '1996;': [766, 783, 831, 981, 1456, 1473, 1649, 1736, 1905, 2980, 3565, 3853, 4067], '93:': [767, 832, 1457, 1650, 1737, 2981, 3566], '156-160Crossref': [768, 833, 1458, 1651, 1738, 2982, 3567], '(663)': [771, 836, 1461, 1654, 1741, 2985, 3570], '8Hayashida': [774, 1464], '271:': [784, 982, 1474, 1906, 3854, 4068], '21985-21992Abstract': [785, 1475], '(101)': [793, 1483], '(p42MAPK/ERK2': [800], 'induces': [805, 1754, 2636, 2958], 'confluent': [811], 'R3T3': [812, 2965], '(mouse': [814], 'fibroblast': [815], '(7Yamada': [818, 1636, 1723, 2967, 3552], 'study,': [841, 1792, 3868], 'we': [842, 995, 1793, 1954, 2020, 2110, 2225, 2297, 2338, 2405, 2587, 2801, 2822, 2951, 3422, 3626, 3869, 4093, 4137, 4171], 'hypothesize': [843, 2160], 'pivotal': [852], 'mediating': [855], 'can': [867, 3692], 'prevent': [868, 3693], 'or': [869, 1272, 1562, 2221, 2545, 3415, 3694], 'delay': [870, 3695], 'wide': [875, 3700], 'variety': [876, 3701], 'stimuli': [878, 3367, 3703], 'insults,': [880], 'suggesting': [881, 2059, 2353], 'controls': [884], 'distal': [886], 'step': [887], 'final': [890], 'common': [891], 'for': [893, 923, 1086, 1118, 1141, 1180, 1200, 1218, 1308, 1550, 1587, 1849, 1998, 2208, 2450, 3255, 3792], '(9Reed': [896, 3706], 'J.C.': [897, 3707], 'Cell': [899, 1047, 1172, 2001, 2473, 3709], '1994;': [901, 944, 1868, 2765, 3711, 3816, 4030], '124:': [902, 3712], '1-6Crossref': [903, 3713], '(2384)': [906, 3716], 'Recent': [909, 3781], 'data': [910, 2420, 3782], 'support': [911, 3062, 3783], 'post-translational': [914, 3728], 'modification': [915, 1409], 'such': [918, 2722], 'important': [922, 3070, 3791], 'regulation': [925, 3794], 'function': [928, 1852, 3797], '(10May': [929, 1853, 3801, 4015], 'W.S.': [930, 1854, 3802, 4016], 'Tyler': [931, 1855, 3803, 4017], 'P.G.': [932, 1856, 3804, 4018], 'Ito': [933, 1857, 3805, 4019], 'Armstromg': [935, 1859, 3807, 4021], 'D.K.': [936, 1860, 3808, 4022], 'Qatsha': [937, 1861, 3809, 4023], 'K.A.': [938, 1862, 3810, 4024], 'Davidson': [939, 1863, 3811, 4025], 'N.E.': [940, 1864, 3812, 4026], '269:': [945, 1869, 3817, 4031], '26865-26870Abstract': [946, 1870, 3818, 4032], '11Halder': [953, 1877, 3825, 4039], 'Jena': [955, 1879, 3827, 4041], 'Groce': [957, 1881, 3829, 4043], 'C.M.': [958, 1882, 3763, 3830, 3973, 4044], 'Sci,': [962, 1886, 3834, 4048], '4507-4511Crossref': [968, 1892, 3840, 4054], '(743)': [971, 1895, 3843, 4057], '12Chen': [974, 1898, 3846, 4060], 'C.Y.': [975, 1899, 3847, 4061], 'Faller': [976, 1900, 3848, 4062], 'D.V.': [977, 1901, 3849, 4063], '2376-2379Abstract': [983, 1907, 3855, 4069], '(130)': [991, 1915, 3863, 4077], 'Here,': [994], 'phosphorylated': [1000], 'stimulation': [1005, 2255, 3536, 3611, 3637, 3643, 3665], 'activated': [1006], '(MKP-1)': [1011], 'were': [1029, 1056, 1071, 1091, 1124, 1146, 1174, 1212, 1245, 1258, 1279, 1303, 1331, 1488, 1536, 1570, 1584, 1631, 1969, 1981, 2003, 2215, 2445, 2475], 'grown': [1030, 1073, 1304, 2446], "Dulbecco's": [1032, 1076], 'modified': [1033, 1077], "Eagle's": [1034, 1078], 'medium': [1035, 1079, 1085, 1099, 1117, 1307, 1555, 1560, 2449], '(Life': [1036, 1500], 'Technologies,': [1037], 'Inc.)': [1038, 1108], '10%': [1040, 1542], 'horse': [1041, 1282, 1543], 'serum,': [1042], '5%': [1043, 1546], 'fetal': [1044, 1547, 3073], 'bovine': [1045, 1548], 'serum.': [1046], 'number': [1048], 'counted': [1050], 'Coulter': [1052], 'counter.': [1053], 'seeded': [1057], 'onto': [1058, 1264, 1343, 2485], '10-cm': [1060], 'dish': [1061], '(Becton': [1062], 'Dickinson)': [1063], 'at': [1064, 1109, 1138, 1176, 1197, 1995, 2818, 3958], '×': [1066, 1178], '10−6': [1067], 'cells/dish.': [1068], 'first': [1072, 1811], 'serum-fed': [1075], 'then': [1081, 1818, 1955], 'kept': [1082], 'serum-free': [1084, 1096, 1306, 1559, 2448], '12': [1087, 1119, 1201, 1309, 2451], 'h.': [1088, 1120, 1202], 'washed': [1092, 1147], 'three': [1093], 'times': [1094], 'phosphate-free': [1098, 1116, 1975], 'equilibrated': [1101, 1970], '[32P]orthophosphoric': [1103, 1972], 'acid': [1104, 1973], '(Amersham': [1105], 'Life': [1106], 'Science,': [1107], 'concentration': [1111], '100': [1113], 'μCi/ml': [1114], 'radiolabeled': [1122, 1979], 'treated': [1125, 1982, 2643], '(20': [1128, 1315, 1322, 1600, 1985, 2457, 2466], 'ng/ml),': [1129, 1316, 1986], '(10−8': [1132, 1989], '10−7m),': [1134, 1991], 'and/or': [1135, 2798], 'PD123319': [1136, 1993], '(10−5m)': [1137, 1994], '37': [1139, 1996], '°C': [1140, 1199, 1997], '30': [1142, 1999], 'min.': [1143, 2000], 'HEPES-buffered': [1149], 'saline': [1150], 'lysed': [1152], '0.5': [1154], 'ml': [1155], 'radioimmune': [1157], 'precipitation': [1158, 1204], 'buffer': [1159, 1217], 'containing': [1160], 'mmphenylmethylsulfonyl': [1162], 'fluoride,': [1163], 'mm': [1165], 'sodium': [1166, 3547], 'orthovanadate,': [1167], '10': [1169, 1189], 'μg/ml': [1170], 'aprotinin.': [1171], 'lysates': [1173, 1255, 1330, 2002, 2474], 'centrifuged': [1175], '8,500': [1177], 'g': [1179], '20': [1181], 'min,': [1182], 'supernatant': [1185], 'incubated': [1187], 'μg': [1190], 'antibody': [1193, 1271, 1274, 1286, 1335, 1350], '(Santa': [1194, 1208, 1275], 'Cruz': [1195, 1209, 1276], 'Biotechnology)': [1196], '4': [1198], 'After': [1203, 1532], 'A/G-agarose': [1207], 'Biotechnology),': [1210], 'samples': [1211], 'boiled': [1213], 'Laemmli': [1215], 'loading': [1216], '3': [1219], 'min': [1220, 3532, 3617], 'resolved': [1222, 1338, 2480], '12%': [1224, 1261, 1340, 2482], 'SDS-PAGE.': [1225], 'stained': [1229], 'Coomassie': [1231], 'Brilliant': [1232], 'Blue,': [1233], 'dried,': [1234], 'analyzed': [1236, 2008], 'autoradiography.': [1238], 'bands': [1240], 'corresponding': [1241], 'cut,': [1246], 'radioactivity': [1249], 'measured.': [1251], 'For': [1252, 1293], 'immunoblotting,': [1253], '(100': [1256], 'μg)': [1257], 'run': [1259], 'SDS-PAGE,': [1262, 1341, 2010, 2483], 'electroblotted': [1263, 1342, 2484], 'nitrocellulose': [1265, 1344, 2486], 'membrane,': [1266, 1345, 2487], 'immunoblotted': [1268, 1347, 2489], 'MKP-1': [1273, 1606, 1611, 2136, 2187, 2198, 2202, 2228, 2236, 2242, 2278, 2301, 2326, 2349, 2366, 2380, 2411, 2507, 2583, 2614, 2640, 3329, 3419, 3425, 3438, 3614, 3628, 3648, 3667, 3675, 4098, 4108, 4159, 4200], 'Biotechnology).': [1277], 'Antibodies': [1278], 'detected': [1280, 2551], 'radish': [1283], 'peroxidase-linked': [1284], 'secondary': [1285], 'ECL': [1288], '(enhanced': [1289], 'chemiluminescence)': [1290], 'system': [1291], '(Amersham).': [1292], 'assay': [1295], 'Bcl-2,': [1300, 2028, 3908, 4106, 4204], 'h': [1310, 2452], '(10−7m),': [1319], 'ng/ml)': [1323, 2458, 2467], 'plus': [1324, 2468], '(10−7m).': [1327], 'immunoprecipitated': [1332, 2004, 2476], '(10': [1336], 'μg),': [1337], 'anti-phosphotyrosine': [1349, 2491], '(Upstate': [1351], 'Biotechnology,': [1352], 'Inc.).': [1353], 'activity': [1356, 1593, 2127, 2251, 2271, 2384, 3112, 3372, 3669, 4112], 'assayed': [1358], 'ability': [1361], 'phosphorylate': [1363], 'myelin': [1364], 'basic': [1365], 'described': [1368, 1596, 1634], 'previously': [1369, 1635, 3520], '(13Tobe': [1370], 'Kadowaki': [1372, 1920], 'Tamemoto': [1374, 1922], 'Ueki': [1376, 1924], 'Hara': [1378, 1926], 'Koshio': [1380, 1928], 'O.': [1381, 1929], 'Momomura': [1382, 1930], 'Gotoh': [1384, 1932], 'Nishida': [1386, 1934], 'E.': [1387, 1935, 3165, 3967], 'Akanuma': [1388, 1936], 'Yazaki': [1390, 1938], 'Kasuga': [1392, 1940], '1991;': [1397, 1945, 2675, 2690, 2704, 3041], '266:': [1398, 1946], '24793-24803Abstract': [1399, 1947], 'slight': [1408], '(6Nakajima': [1410, 2855], 'transfected': [1489, 1581, 2216, 2899], '300': [1491, 2218], 'nm': [1492], 'anti-MKP-1': [1493], '(phosphorothioate': [1496], 'modified)': [1497], 'Lipofectin': [1499], 'Technologies)': [1501], 'according': [1502], 'approach': [1505], 'Duff': [1507, 3575], '(14Duff': [1510], 'J.L.': [1511, 1658, 3579], 'Monia': [1512], 'B.P.': [1513], 'Berk': [1514, 3590], 'B.C.': [1515, 3591], '7161-7166Abstract': [1521], '(176)': [1529], 'transfection,': [1533], 'maintained': [1537], 'day.': [1552], 'Then': [1553], 'changed': [1557, 1837], 'without': [1563, 3670], 'II.': [1565, 2442], 'Two': [1566], 'days': [1567], 'later,': [1568], 'harvested': [1571], 'subjected': [1573], 'analysis': [1575], 'fragmentation.': [1578, 4166], 'Anti-MKP-1': [1579], 'also': [1585, 2406, 2824, 2906, 2936, 4154], 'determinations': [1594], 'above.': [1597], 'Oligonucleotide': [1598], 'sequences': [1599], 'base': [1601, 2543], 'pairs)': [1602], 'follows:': [1605], 'antisense,': [1607], '5′': [1608, 1613], 'GGAACTCAGTGGAACTCAGG': [1609], '3′;': [1610], 'sense,': [1612], 'CCTGAGTTCCACTGAGTTCC': [1614], '3′.': [1615], 'extraction,': [1617], 'subsequent': [1618, 3450], '3′': [1619], 'end': [1620], 'labeling': [1621], 'DNA,': [1623], 'electrophoresis,': [1625], 'quantitation': [1627], 'performed': [1632], '15Tilly': [1657], 'Hsueh': [1659], 'A.J.W.': [1660], 'Cell.': [1662, 2145, 2393, 3141, 3186, 3266, 3313, 3473, 3744, 3974, 3992, 4121], 'Physiol.': [1663, 2689, 2764], '154:': [1665], '519-526Crossref': [1666], '(323)': [1669], '16Horiuchi': [1672, 2988], 'Yamada': [1674, 2560, 2990], '1997;': [1683, 2569, 2999], '272:': [1684, 2570, 3000], '11952-11958Abstract': [1685, 2571, 3001], '(79)': [1693, 2579, 3009], 'All': [1696], 'values': [1697], 'expressed': [1699], 'mean': [1701], '±': [1702], 'S.D.': [1703, 3989], 'Statistical': [1704], 'significance': [1705], 'assessed': [1707], 'ANOVA': [1709], 'followed': [1710], "Scheffe's": [1712], 'test.': [1713], 'p': [1714], '<': [1715], '0.05': [1716], 'considered': [1718], 'significant.': [1719], 'recently': [1721], 'antagonizes': [1747], 'anti-apoptotic': [1749], 'effect': [1750, 1821, 1959, 2064, 2283, 2307, 2324, 2371, 2505, 2605, 3543, 4142], 'which': [1759, 2532, 3083, 3123, 3133, 3297], 'very': [1765], 'low': [1766], 'levels': [1767], '(17Speth': [1774, 3017], 'R.C,.': [1775, 3018], 'Kim': [1776, 3019], 'K.H.': [1777, 3020], '1990;': [1782, 3025], '169:': [1783, 3026], '997-1006Crossref': [1784, 3027], '(178)': [1787, 3030], 'possibility': [1796, 2409, 4096], 'influence': [1805, 2429, 2940], '(Fig.': [1808, 2037, 2238, 2272, 2293, 2317, 2432, 2622], '1).': [1809], 'observed': [1830, 2021, 2226, 2298, 2339, 2588, 2612, 3529, 3639, 4155], 'level': [1834, 2234, 2267], '(Fig.1': [1841], 'B).': [1842, 2039, 2274, 2295, 2319, 2519, 2626], 'Since': [1843, 2072, 2379], 'essential': [1848], '13Tobe': [1918], 'Scholar),': [1953, 2109, 2156, 2404, 2711, 2745, 2768, 3011], 'focused': [1956], 'phosphorylation.': [1966, 2179, 2331, 2378], 'medium,': [1976], 'antibody,': [2007, 2479], 'autoradiographed.': [2012], 'As': [2013, 2332, 2627], 'shown': [2014, 2333, 2628], 'Fig.1,': [2016], 'A': [2017, 2517, 2624], 'C,': [2019, 2632], 'phophorylation': [2026, 4005, 4150], 'NGF-induced': [2034], 'Inhibition': [2040], 'NGF-mediated': [2043, 2168, 2258, 2313, 2342, 3885, 3895], 'restored': [2051], 'PD123319,': [2053], 'specific': [2055], 'antagonist,': [2058], 'exerted': [2066], 'specifically': [2067, 3730], 'appears': [2079], 'play': [2081], 'postulated': [2111], 'enhances': [2115], 'this.': [2124], 'dual-specificity': [2132], '(18Sun': [2137, 2385, 3258, 3305, 3465, 4113], 'Charles': [2139, 2387, 3260, 3307, 3467, 3584, 4115], 'C.H.': [2140, 2388, 3261, 3308, 3384, 3468, 3486, 3585, 4116], 'Lau': [2141, 2389, 3262, 3309, 3387, 3469, 3489, 3586, 4117], 'L.F.': [2142, 2390, 3263, 3310, 3388, 3470, 3490, 3587, 4118], 'Tonks': [2143, 2391, 3264, 3311, 3389, 3471, 3491, 4119], 'N.K.': [2144, 2392, 3265, 3312, 3390, 3472, 3492, 4120], '75:': [2147, 2395, 3268, 3315, 3475, 4123], '487-493Abstract': [2148, 2396, 3269, 3316, 3476, 4124], '(1020)': [2154, 2402, 3275, 3322, 3482, 4130], 'leading': [2157], 'us': [2158], 'activates': [2165, 3666], 'MKP-1,': [2166, 3296], 'inhibition': [2176, 4157], 'applied': [2181], 'block': [2185], 'basal': [2186, 2266], 'expression': [2188, 2648, 2904, 3630, 4160], 'cells.': [2191, 2644, 2949, 3624], 'Due': [2192], 'short': [2195], 'half-life': [2196], 'mRNA': [2199, 3615, 3629, 3649], 'protein,': [2201], 'an': [2204, 2850, 2938, 3069, 3326, 3442], 'ideal': [2205], 'molecule': [2207], 'studies': [2209], 'inhibition.': [2212], 'nmanti-MKP-1': [2219], 'sense': [2222, 2243, 2584], 'oligonucleotides.': [2223], 'Indeed,': [2224, 2800, 4003], 'treatment': [2231], 'reduced': [2232], 'A).': [2240], 'oligonucleotide-pretreated': [2244], 'increased': [2248], 'well': [2263, 3128], 'pretreatment': [2280, 2303, 2510, 2617], 'Moreover,': [2296, 2365, 2950, 4092], 'antagonistic': [2306], 'next': [2321, 2502], 'Fig.': [2335, 2630], '3,': [2336], 'A–C,': [2337], 'pretreatment,': [2352], 'closely': [2359, 2793, 3900], 'linked': [2360, 3901], 'blockade': [2367], 'possesses': [2381], 'directly': [2412, 4100], 'dephosphorylates': [2413, 4203], 'residue': [2416, 4009, 4089, 4104], 'Our': [2419, 3891], 'showed': [2421], 'does': [2427], '4).Figure': [2433], '4Tyrosine': [2434], '(A),': [2459], '(10−7m)': [2462, 2471], '(B),': [2463], '(C).': [2472], 'antibody.View': [2492], 'Large': [2493], 'Image': [2494], 'Figure': [2495], 'ViewerDownload': [2496], 'Hi-res': [2497], 'image': [2498], 'Download': [2499], '(PPT)': [2500], 'receptor-mediated': [2513, 2620, 3095, 4164], '(Fig.5': [2516], 'most': [2521], 'striking': [2522], 'biochemical': [2523], 'feature': [2524], 'endonuclease,': [2531], 'cleaves': [2533], 'between': [2536], 'regularly': [2537], 'spaced': [2538], 'nucleosomal': [2539], 'units': [2540], '180': [2542], 'pairs': [2544], 'multiples': [2546], 'thereof': [2547], 'readily': [2550], 'ladder': [2555], 'electrophoresis': [2557], '(16Horiuchi': [2558], 'oligonucleotide-treated': [2585], 'apoptotic': [2592], 'changes': [2593], 'after': [2597, 2660, 3533, 3634], 'depletion': [2599], '5,': [2623], '5': [2631, 3531], 'deprivation': [2634], 'alone': [2635], 'during': [2652], 'embryonic': [2653], 'neonatal': [2655], 'rapid': [2658, 3447], 'disappearance': [2659], 'birth': [2661], '(19Grady': [2662], 'E.F.': [2663], 'Sechi': [2664], 'L.A.': [2665], 'Griffin': [2666], 'C.A.': [2667], 'Schambelan': [2668], 'Kalinyak': [2670], 'J.E.': [2671], 'Clin.': [2673, 2738, 2928], 'Invest.': [2674, 2739, 2929], '88:': [2676], '921-933Crossref': [2677], '(495)': [2680], '20Tsutsumi': [2683], 'Saavedra': [2685, 2701, 2774], 'J.M.': [2686, 2702, 2775], 'Am.': [2687, 2762], '261:': [2691], 'H667-H670PubMed': [2692], '21Tsutsumi': [2695], 'Stromberg': [2697], 'C.': [2698, 3158, 3181, 3969], 'Viswanathan': [2699], 'Endocrinology.': [2703], '129:': [2705], '1075-1082Crossref': [2706], '(134)': [2709], 'up-regulation': [2714], 'some': [2719, 3080], 'diseased': [2720], 'states': [2721], 'myocardial': [2725], 'infarction': [2726], '(22Nio': [2727], 'Matsubara': [2729], 'Murasawa': [2731], 'Kanasaki': [2733], 'Inada': [2735], '95:': [2741, 2931], '46-54Crossref': [2742], 'cardiac': [2746], 'hypertrophy': [2747], '(23Lopez': [2748], 'Lorell': [2750], 'B.H.': [2751], 'Ingelfinger': [2752], 'J.R.': [2753], 'Weinberg': [2754], 'E.O.': [2755], 'Schunkert': [2756], 'Diamant': [2758], 'D.': [2759], 'Tang': [2760], 'S.-H.': [2761], '36:': [2766], 'H844-H852Google': [2767], 'skin': [2770], 'wounds': [2771], '(24Viswanathan': [2772], 'Peptides': [2776], '(': [2777], 'Tarryt': [2778], ').': [2779], '13:': [2781], '783-786Crossref': [2782], '(162)': [2785], 'involved': [2794, 3427], 'development,': [2797], 'differentiation.': [2799], 'mediates': [2808, 3103, 3113], 'developmentally': [2810], 'decrease': [2812], 'aortic': [2815], 'synthesis': [2817], 'late': [2819], 'gestation,': [2820], 'demonstrated,': [2825], 'vivo': [2828, 2892], 'gene': [2829, 3303, 3445], 'transfer': [2830], 'cDNA': [2835], 'into': [2836], 'injured': [2837], 'carotid': [2839], 'artery,': [2840], 'overexpression': [2842], 'transgene': [2847], 'attenuation': [2851], 'neointimal': [2853], 'hyperplasia': [2854], 'Consistent': [2888], 'observation,': [2893], 'cultured': [2894, 2946, 2961], 'smooth': [2896, 3622], 'muscle': [2897, 3623], 'vector': [2905], 'exhibit': [2907], 'decreased': [2908], 'rates': [2909], 'synthesis.': [2912], 'Stollet': [2913], '(25Stoll': [2915], 'Steckelings': [2917], 'Paul': [2919], 'Bottari': [2921], 'Metzger': [2923], 'Unger': [2925], '651-657Crossref': [2932], 'report': [2937, 3604], 'antiproliferative': [2939], 'coronary': [2947], 'endothelial': [2948], 'both': [3012], 'expressing': [3013], 'receptors': [3016], '26Dudley': [3033], 'D.T.': [3034, 3047], 'Hubbell': [3035], 'S.E.': [3036], 'Summerfelt': [3037, 3048], 'R.M.': [3038, 3049], 'Mol.': [3039], 'Pharmacol.': [3040], '40:': [3042], '360-367PubMed': [3043], '27Dudley': [3046], 'Regul.': [3050], 'Pept.': [3051], '44:': [3053], '199-206Crossref': [3054], '(70)': [3057], 'These': [3060, 4080], 'notion': [3064, 3785], 'development': [3074, 4208], 'pathogenesis': [3078], 'diseases': [3081], 'involved.': [3086], 'However,': [3087, 3508, 4133], 'defined.': [3100], 'multiple': [3104], 'pathways.': [3106], 'factors': [3118, 3130], 'like': [3119, 3131], 'epidermal': [3120], 'factor,': [3122], 'proliferation,': [3126], 'maintains': [3134], 'differentiation': [3138, 3412], '(28Chao': [3139], 'M.V.': [3140], '68:': [3143, 3188], '995-997Abstract': [3144], '(267)': [3150], '29Nguyen': [3153], 'T.T.': [3154], 'Scimeca': [3155], 'J.-C.': [3156], 'Filloux': [3157], 'Peraldi': [3159], 'P.': [3160], 'Carpentier': [3161], 'J.-L.': [3162], 'Van': [3163], 'Obberghen': [3164], '9803-9810Abstract': [3171], '30Wood': [3178], 'K.W.': [3179], 'Sarnecki': [3180], 'Roberts': [3182], 'T.M.': [3183], 'Blenis': [3184], '1041-1050Abstract': [3189], '(656)': [3195], 'Activation': [3198], 'p42': [3201], 'isoforms': [3204], 'requires': [3208, 3727], 'dual': [3209], 'Thr-183': [3212, 3285], 'Tyr-185': [3214, 3287], 'residues': [3215, 3288], '(31Cobb': [3216], 'M.H.': [3217], 'Goldsmith': [3218], 'E.J.': [3219], '14843-14846Abstract': [3225], '(1653)': [3233], 'It': [3236, 3719], 'suggested': [3239, 3454], 'event': [3249], 'response': [3254, 3364], 'This': [3278], 'mediated': [3281], 'dephosphorylation': [3283, 3524], '"dual': [3291], 'specificity"': [3292], 'encoded': [3299], 'mitogen-inducible': [3302], '3CH134': [3304], 'isoform': [3327], 'isolated': [3331], 'from': [3332], 'named': [3335], 'MKP-2': [3336], '(32Misra-Press': [3337], 'Rim': [3339], 'C.S.': [3340], 'Yao': [3341], 'Robertson': [3343, 3758], 'M.S.': [3344], 'Stork': [3345], 'P.J.S.': [3346], '14587-14596Abstract': [3352], '(219)': [3360], 'Cellular': [3363], 'may': [3368], 'regulate': [3369], 'coordinating': [3374], 'cascade': [3382], '(33Charles': [3383], 'Sun': [3385, 3487], '90:': [3399, 3501], '5292-5296Crossref': [3400, 3502], '(183)': [3403, 3505], 'MKPs,': [3407], 'Using': [3418], 'strategy,': [3421], 'discovered': [3440], 'immediate': [3443], 'early': [3444], 'whose': [3446], 'transcription': [3448], 'translation': [3451], 'provide': [3456], 'feedback': [3458], 'loop': [3459], 'terminate': [3461], '33Charles': [3485], 'known.': [3518], 'reported': [3521, 3722, 4014], 'within': [3530], 'vanadate': [3548], 'pertussis': [3550], 'toxin': [3551], 'contrast,': [3574], '(34Duff': [3578], 'Marrero': [3580], 'M.B.': [3581], 'Paxton': [3582], 'W.G.': [3583], 'Bernstein': [3588], 'K.E.': [3589], '26037-26040Abstract': [3597], 'rapidly': [3612], '(30': [3616], 'maximum)': [3618], 'Therefore,': [3625], 'increase': [3646], '(data': [3654], 'shown).': [3656], 'apparent': [3672], 'expression.': [3676], 'controlled': [3679], 'part': [3681], 'family': [3684], 'cytoplasmic': [3686], 'proteins,': [3687], 'family.': [3690], 'insults': [3705], 'modification,': [3729], 'be': [3733], 'functionally': [3734], 'active': [3735], '(35Allsopp': [3736], 'Wyatt': [3738], 'Paterson': [3740], 'H.F.': [3741], 'Davies': [3742], 'A.M.': [3743], '73:': [3746], '295-307Abstract': [3747], '(560)': [3753], '36Alnemri': [3756], 'E.S.': [3757], 'N.M.': [3759], 'Fernandes': [3760], 'T.F.': [3761], 'Croce': [3762, 3972], 'Litwack': [3764], 'G.': [3765], '89:': [3774], '7295-7299Crossref': [3775], '(150)': [3778], 'thereby': [3799], 'increases': [3903], 'signal.': [3914], 'serine/threonine': [3919], 'minimal': [3923], 'consensus': [3924], 'sequence': [3925], 'substrate': [3927], 'specificity': [3928], '(Ser/Thr)-Pro': [3934], '(37Davis': [3935], '14553-14556Abstract': [3942], 'Ser/Pro': [3950], 'sequence,': [3951], 'conserved': [3952], 'murine': [3954], 'human': [3956], 'positions': [3960], '70': [3961], '71': [3963], '(38Negrini': [3964], 'Silini': [3966], 'Kozak': [3968], 'Tsujimoto': [3970], '1987;': [3975], '49:': [3976], '455-463Abstract': [3977], '(187)': [3983], '39Clearly': [3986], 'M.L.': [3987], 'Smith': [3988], 'Sklar': [3990], '47:': [3994], '19-28Abstract': [3995], '(1068)': [4000], 'serine': [4008, 4088], 'phosphorylates': [4086], 'could': [4099], 'dephosphorylate': [4101], 'since': [4107], 'observe': [4140], 'any': [4141], 'Based': [4167], 'results,': [4170], 'propose': [4172], 'suppressing': [4181], 'activating': [4189, 4199], 'subsequently': [4202]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W2031647568', 'counts_by_year': [{'year': 2023, 'cited_by_count': 2}, {'year': 2022, 'cited_by_count': 4}, {'year': 2021, 'cited_by_count': 4}, {'year': 2020, 'cited_by_count': 1}, {'year': 2019, 'cited_by_count': 3}, {'year': 2018, 'cited_by_count': 6}, {'year': 2017, 'cited_by_count': 1}, {'year': 2016, 'cited_by_count': 3}, {'year': 2015, 'cited_by_count': 9}, {'year': 2014, 'cited_by_count': 7}, {'year': 2013, 'cited_by_count': 5}, {'year': 2012, 'cited_by_count': 15}], 'updated_date': '2024-12-14T01:43:10.400130', 'created_date': '2016-06-24'}