Publication Information

{'id': 'https://openalex.org/W2030749742', 'doi': 'https://doi.org/10.1074/jbc.m409673200', 'title': 'p125 Is Localized in Endoplasmic Reticulum Exit Sites and Involved in Their Organization', 'display_name': 'p125 Is Localized in Endoplasmic Reticulum Exit Sites and Involved in Their Organization', 'publication_year': 2004, 'publication_date': '2004-12-29', 'ids': {'openalex': 'https://openalex.org/W2030749742', 'doi': 'https://doi.org/10.1074/jbc.m409673200', 'mag': '2030749742', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/15623529'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m409673200', 'pdf_url': 'http://www.jbc.org/article/S0021925819304107/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S0021925819304107/pdf', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5057261777', 'display_name': 'Wakako Shimoi', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I74801974', 'display_name': 'The University of Tokyo', 'ror': 'https://ror.org/057zh3y96', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I74801974']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Wakako Shimoi', 'raw_affiliation_strings': ['‡‡School of Life Science, Tokyo University of Pharmacy and Life Science, Hachioji, Tokyo 192-0392, Japan'], 'affiliations': [{'raw_affiliation_string': '‡‡School of Life Science, Tokyo University of Pharmacy and Life Science, Hachioji, Tokyo 192-0392, Japan', 'institution_ids': ['https://openalex.org/I74801974']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5075027396', 'display_name': 'Ichiko Ezawa', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I74801974', 'display_name': 'The University of Tokyo', 'ror': 'https://ror.org/057zh3y96', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I74801974']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Ichiko Ezawa', 'raw_affiliation_strings': ['‡‡School of Life Science, Tokyo University of Pharmacy and Life Science, Hachioji, Tokyo 192-0392, Japan'], 'affiliations': [{'raw_affiliation_string': '‡‡School of Life Science, Tokyo University of Pharmacy and Life Science, Hachioji, Tokyo 192-0392, Japan', 'institution_ids': ['https://openalex.org/I74801974']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5088213599', 'display_name': 'Koji Nakamoto', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I74801974', 'display_name': 'The University of Tokyo', 'ror': 'https://ror.org/057zh3y96', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I74801974']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Koji Nakamoto', 'raw_affiliation_strings': ['‡‡School of Life Science, Tokyo University of Pharmacy and Life Science, Hachioji, Tokyo 192-0392, Japan'], 'affiliations': [{'raw_affiliation_string': '‡‡School of Life Science, Tokyo University of Pharmacy and Life Science, Hachioji, Tokyo 192-0392, Japan', 'institution_ids': ['https://openalex.org/I74801974']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5004297588', 'display_name': 'Shihoko Uesaki', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I74801974', 'display_name': 'The University of Tokyo', 'ror': 'https://ror.org/057zh3y96', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I74801974']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Shihoko Uesaki', 'raw_affiliation_strings': ['‡‡School of Life Science, Tokyo University of Pharmacy and Life Science, Hachioji, Tokyo 192-0392, Japan'], 'affiliations': [{'raw_affiliation_string': '‡‡School of Life Science, Tokyo University of Pharmacy and Life Science, Hachioji, Tokyo 192-0392, Japan', 'institution_ids': ['https://openalex.org/I74801974']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5052521875', 'display_name': 'Gavin Gabreski', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I170201317', 'display_name': 'University of Pittsburgh', 'ror': 'https://ror.org/01an3r305', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I170201317']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Gavin Gabreski', 'raw_affiliation_strings': ['Department of Cell Biology and Physiology, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15261'], 'affiliations': [{'raw_affiliation_string': 'Department of Cell Biology and Physiology, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15261', 'institution_ids': ['https://openalex.org/I170201317']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5001216483', 'display_name': 'Meir Aridor', 'orcid': 'https://orcid.org/0000-0003-4119-6233'}, 'institutions': [{'id': 'https://openalex.org/I170201317', 'display_name': 'University of Pittsburgh', 'ror': 'https://ror.org/01an3r305', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I170201317']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Meir Aridor', 'raw_affiliation_strings': ['Department of Cell Biology and Physiology, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15261'], 'affiliations': [{'raw_affiliation_string': 'Department of Cell Biology and Physiology, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15261', 'institution_ids': ['https://openalex.org/I170201317']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5102179572', 'display_name': 'Akitsugu Yamamoto', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I194335595', 'display_name': 'Nagahama Institute of Bio-Science and Technology', 'ror': 'https://ror.org/03m5fme96', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I194335595']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Akitsugu Yamamoto', 'raw_affiliation_strings': ['Department of Cell Biology, Nagahama Institute of Bio-Science and Technology, Nagahama, Shiga 526-0829, Japan;'], 'affiliations': [{'raw_affiliation_string': 'Department of Cell Biology, Nagahama Institute of Bio-Science and Technology, Nagahama, Shiga 526-0829, Japan;', 'institution_ids': ['https://openalex.org/I194335595']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5109048469', 'display_name': 'Masami Nagahama', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I74801974', 'display_name': 'The University of Tokyo', 'ror': 'https://ror.org/057zh3y96', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I74801974']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Masami Nagahama', 'raw_affiliation_strings': ['‡‡School of Life Science, Tokyo University of Pharmacy and Life Science, Hachioji, Tokyo 192-0392, Japan'], 'affiliations': [{'raw_affiliation_string': '‡‡School of Life Science, Tokyo University of Pharmacy and Life Science, Hachioji, Tokyo 192-0392, Japan', 'institution_ids': ['https://openalex.org/I74801974']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5027831160', 'display_name': 'Mitsuo Tagaya', 'orcid': 'https://orcid.org/0000-0001-9137-7142'}, 'institutions': [{'id': 'https://openalex.org/I74801974', 'display_name': 'The University of Tokyo', 'ror': 'https://ror.org/057zh3y96', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I74801974']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Mitsuo Tagaya', 'raw_affiliation_strings': ['‡‡School of Life Science, Tokyo University of Pharmacy and Life Science, Hachioji, Tokyo 192-0392, Japan'], 'affiliations': [{'raw_affiliation_string': '‡‡School of Life Science, Tokyo University of Pharmacy and Life Science, Hachioji, Tokyo 192-0392, Japan', 'institution_ids': ['https://openalex.org/I74801974']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5100987928', 'display_name': 'Katsuko Tani', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I74801974', 'display_name': 'The University of Tokyo', 'ror': 'https://ror.org/057zh3y96', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I74801974']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Katsuko Tani', 'raw_affiliation_strings': ['‡‡School of Life Science, Tokyo University of Pharmacy and Life Science, Hachioji, Tokyo 192-0392, Japan'], 'affiliations': [{'raw_affiliation_string': '‡‡School of Life Science, Tokyo University of Pharmacy and Life Science, Hachioji, Tokyo 192-0392, Japan', 'institution_ids': ['https://openalex.org/I74801974']}]}], 'institution_assertions': [], 'countries_distinct_count': 2, 'institutions_distinct_count': 3, 'corresponding_author_ids': [], 'corresponding_institution_ids': [], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 2.639, 'has_fulltext': True, 'fulltext_origin': 'ngrams', 'cited_by_count': 100, 'citation_normalized_percentile': {'value': 0.915152, 'is_in_top_1_percent': False, 'is_in_top_10_percent': True}, 'cited_by_percentile_year': {'min': 96, 'max': 97}, 'biblio': {'volume': '280', 'issue': '11', 'first_page': '10141', 'last_page': '10148'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T10617', 'display_name': 'Cellular transport and secretion', 'score': 0.9999, 'subfield': {'id': 'https://openalex.org/subfields/1307', 'display_name': 'Cell Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, 'topics': [{'id': 'https://openalex.org/T10617', 'display_name': 'Cellular transport and secretion', 'score': 0.9999, 'subfield': {'id': 'https://openalex.org/subfields/1307', 'display_name': 'Cell Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T11150', 'display_name': 'Endoplasmic Reticulum Stress and Disease', 'score': 0.9994, 'subfield': {'id': 'https://openalex.org/subfields/1307', 'display_name': 'Cell Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T10945', 'display_name': 'Lysosomal Storage Disorders Research', 'score': 0.9963, 'subfield': {'id': 'https://openalex.org/subfields/2737', 'display_name': 'Physiology'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/copii', 'display_name': 'COPII', 'score': 0.9575653}, {'id': 'https://openalex.org/keywords/copi', 'display_name': 'COPI', 'score': 0.76789427}, {'id': 'https://openalex.org/keywords/vesicular-transport-proteins', 'display_name': 'Vesicular Transport Proteins', 'score': 0.6038778}], 'concepts': [{'id': 'https://openalex.org/C46617944', 'wikidata': 'https://www.wikidata.org/wiki/Q410907', 'display_name': 'COPII', 'level': 5, 'score': 0.9575653}, {'id': 'https://openalex.org/C158617107', 'wikidata': 'https://www.wikidata.org/wiki/Q79927', 'display_name': 'Endoplasmic reticulum', 'level': 2, 'score': 0.8760961}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.8035507}, {'id': 'https://openalex.org/C206912223', 'wikidata': 'https://www.wikidata.org/wiki/Q21111963', 'display_name': 'COPI', 'level': 5, 'score': 0.76789427}, {'id': 'https://openalex.org/C119062480', 'wikidata': 'https://www.wikidata.org/wiki/Q83181', 'display_name': 'Golgi apparatus', 'level': 3, 'score': 0.71644807}, {'id': 'https://openalex.org/C2910636507', 'wikidata': 'https://www.wikidata.org/wiki/Q4082043', 'display_name': 'Vesicular Transport Proteins', 'level': 5, 'score': 0.6038778}, {'id': 'https://openalex.org/C130316041', 'wikidata': 'https://www.wikidata.org/wiki/Q189206', 'display_name': 'Vesicle', 'level': 3, 'score': 0.5180485}, {'id': 'https://openalex.org/C6492254', 'wikidata': 'https://www.wikidata.org/wiki/Q84230', 'display_name': 'Secretory pathway', 'level': 4, 'score': 0.4752947}, {'id': 'https://openalex.org/C95444343', 'wikidata': 'https://www.wikidata.org/wiki/Q7141', 'display_name': 'Cell biology', 'level': 1, 'score': 0.4327389}, {'id': 'https://openalex.org/C54355233', 'wikidata': 'https://www.wikidata.org/wiki/Q7162', 'display_name': 'Genetics', 'level': 1, 'score': 0.29904783}, {'id': 'https://openalex.org/C167625842', 'wikidata': 'https://www.wikidata.org/wiki/Q899763', 'display_name': 'Peptide sequence', 'level': 3, 'score': 0.20024747}, {'id': 'https://openalex.org/C104317684', 'wikidata': 'https://www.wikidata.org/wiki/Q7187', 'display_name': 'Gene', 'level': 2, 'score': 0.18227622}, {'id': 'https://openalex.org/C14053116', 'wikidata': 'https://www.wikidata.org/wiki/Q284398', 'display_name': 'N-terminus', 'level': 4, 'score': 0.17670336}, {'id': 'https://openalex.org/C41625074', 'wikidata': 'https://www.wikidata.org/wiki/Q176088', 'display_name': 'Membrane', 'level': 2, 'score': 0.0}], 'mesh': [{'descriptor_ui': 'D002352', 'descriptor_name': 'Carrier Proteins', 'qualifier_ui': 'Q000502', 'qualifier_name': 'physiology', 'is_major_topic': True}, {'descriptor_ui': 'D002352', 'descriptor_name': 'Carrier Proteins', 'qualifier_ui': 'Q000096', 'qualifier_name': 'biosynthesis', 'is_major_topic': True}, {'descriptor_ui': 'D004721', 'descriptor_name': 'Endoplasmic Reticulum', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D000818', 'descriptor_name': 'Animals', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D001665', 'descriptor_name': 'Binding Sites', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D001692', 'descriptor_name': 'Biological Transport', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002352', 'descriptor_name': 'Carrier Proteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D002352', 'descriptor_name': 'Carrier Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002460', 'descriptor_name': 'Cell Line', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002462', 'descriptor_name': 'Cell Membrane', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D002462', 'descriptor_name': 'Cell Membrane', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D018076', 'descriptor_name': 'DNA, Complementary', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D018076', 'descriptor_name': 'DNA, Complementary', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D004591', 'descriptor_name': 'Electrophoresis, Polyacrylamide Gel', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D004721', 'descriptor_name': 'Endoplasmic Reticulum', 'qualifier_ui': 'Q000648', 'qualifier_name': 'ultrastructure', 'is_major_topic': False}, {'descriptor_ui': 'D004721', 'descriptor_name': 'Endoplasmic Reticulum', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D006056', 'descriptor_name': 'Golgi Apparatus', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D006056', 'descriptor_name': 'Golgi Apparatus', 'qualifier_ui': 'Q000648', 'qualifier_name': 'ultrastructure', 'is_major_topic': False}, {'descriptor_ui': 'D006056', 'descriptor_name': 'Golgi Apparatus', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D006367', 'descriptor_name': 'HeLa Cells', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D006801', 'descriptor_name': 'Humans', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D015151', 'descriptor_name': 'Immunoblotting', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D007425', 'descriptor_name': 'Intracellular Membranes', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D007425', 'descriptor_name': 'Intracellular Membranes', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008565', 'descriptor_name': 'Membrane Proteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D008565', 'descriptor_name': 'Membrane Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D018613', 'descriptor_name': 'Microscopy, Confocal', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008854', 'descriptor_name': 'Microscopy, Electron', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008856', 'descriptor_name': 'Microscopy, Fluorescence', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D016253', 'descriptor_name': 'Microscopy, Immunoelectron', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D020559', 'descriptor_name': 'Monomeric GTP-Binding Proteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D020559', 'descriptor_name': 'Monomeric GTP-Binding Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D028861', 'descriptor_name': 'Nuclear Pore Complex Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D010750', 'descriptor_name': 'Phosphoproteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D010750', 'descriptor_name': 'Phosphoproteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D010957', 'descriptor_name': 'Plasmids', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D010957', 'descriptor_name': 'Plasmids', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011485', 'descriptor_name': 'Protein Binding', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D017434', 'descriptor_name': 'Protein Structure, Tertiary', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011506', 'descriptor_name': 'Proteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D011506', 'descriptor_name': 'Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D016601', 'descriptor_name': 'RNA-Binding Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D051381', 'descriptor_name': 'Rats', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011993', 'descriptor_name': 'Recombinant Fusion Proteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D011993', 'descriptor_name': 'Recombinant Fusion Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D029701', 'descriptor_name': 'Saccharomyces cerevisiae Proteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D029701', 'descriptor_name': 'Saccharomyces cerevisiae Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D013997', 'descriptor_name': 'Time Factors', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D014162', 'descriptor_name': 'Transfection', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D033921', 'descriptor_name': 'Vesicular Transport Proteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D033921', 'descriptor_name': 'Vesicular Transport Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}], 'locations_count': 2, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m409673200', 'pdf_url': 'http://www.jbc.org/article/S0021925819304107/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/15623529', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m409673200', 'pdf_url': 'http://www.jbc.org/article/S0021925819304107/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 47, 'referenced_works': ['https://openalex.org/W1499112972', 'https://openalex.org/W185803649', 'https://openalex.org/W1884442241', 'https://openalex.org/W1943315667', 'https://openalex.org/W1969963064', 'https://openalex.org/W1971476311', 'https://openalex.org/W1987517959', 'https://openalex.org/W1990364715', 'https://openalex.org/W2003123776', 'https://openalex.org/W2003519864', 'https://openalex.org/W2005733184', 'https://openalex.org/W2008149441', 'https://openalex.org/W2011483335', 'https://openalex.org/W2016451610', 'https://openalex.org/W2020212296', 'https://openalex.org/W2029152767', 'https://openalex.org/W2029983725', 'https://openalex.org/W2030902990', 'https://openalex.org/W2039682288', 'https://openalex.org/W2045571454', 'https://openalex.org/W2059158034', 'https://openalex.org/W2059428912', 'https://openalex.org/W2063672920', 'https://openalex.org/W2064588375', 'https://openalex.org/W2065687264', 'https://openalex.org/W2067220774', 'https://openalex.org/W2075568323', 'https://openalex.org/W2076623484', 'https://openalex.org/W2078341212', 'https://openalex.org/W2083210641', 'https://openalex.org/W2085490483', 'https://openalex.org/W2092356580', 'https://openalex.org/W2097149853', 'https://openalex.org/W2097996196', 'https://openalex.org/W2098145494', 'https://openalex.org/W2104360518', 'https://openalex.org/W2109975639', 'https://openalex.org/W2116944145', 'https://openalex.org/W2129177835', 'https://openalex.org/W2130965044', 'https://openalex.org/W2134245600', 'https://openalex.org/W2138819541', 'https://openalex.org/W2144918914', 'https://openalex.org/W2160545452', 'https://openalex.org/W2167994809', 'https://openalex.org/W2169805130', 'https://openalex.org/W2170072969'], 'related_works': ['https://openalex.org/W4388166065', 'https://openalex.org/W3122581625', 'https://openalex.org/W2799760740', 'https://openalex.org/W2246427714', 'https://openalex.org/W2194991829', 'https://openalex.org/W2036420384', 'https://openalex.org/W2009198934', 'https://openalex.org/W2008801986', 'https://openalex.org/W1969143608', 'https://openalex.org/W1650842175'], 'abstract_inverted_index': {'Transport': [0, 192, 2948], 'vesicles': [1, 83, 193, 275, 509, 795, 1111, 1308, 1945, 3822], 'coated': [2, 194], 'with': [3, 45, 125, 129, 195, 237, 317, 321, 924, 1297, 1313, 1513, 1624, 2218, 2225, 2283, 2398, 2425, 2588, 2694, 2779, 2818, 2830, 2956, 3016, 3040, 3064, 3078, 3163, 3403, 3525, 3542, 3590, 3711, 3764, 3799, 3986, 4075, 4086, 4126, 4138, 4190, 4314, 4396, 4433], 'the': [4, 21, 56, 97, 112, 119, 137, 146, 154, 161, 187, 196, 213, 248, 289, 304, 311, 329, 338, 346, 353, 379, 387, 406, 579, 587, 593, 809, 890, 894, 919, 925, 1040, 1052, 1069, 1107, 1113, 1139, 1142, 1215, 1220, 1224, 1228, 1401, 1404, 1511, 1612, 1627, 1632, 1682, 1686, 1738, 1793, 1803, 1823, 1826, 1831, 1894, 1915, 1922, 1927, 1951, 1991, 2011, 2020, 2024, 2042, 2066, 2288, 2298, 2349, 2356, 2372, 2385, 2390, 2404, 2409, 2542, 2563, 2570, 2574, 2601, 2705, 2776, 2780, 2819, 2840, 2854, 2872, 2876, 2882, 2939, 2999, 3002, 3012, 3036, 3048, 3065, 3070, 3073, 3100, 3105, 3204, 3234, 3246, 3268, 3389, 3485, 3505, 3511, 3519, 3556, 3582, 3594, 3620, 3625, 3642, 3649, 3653, 3723, 3728, 3741, 3784, 3807, 3826, 3848, 3858, 3933, 4050, 4053, 4055, 4064, 4069, 4087, 4108, 4112, 4144, 4155, 4209, 4233, 4241, 4321, 4379, 4409], 'COPII': [5, 197, 574, 920, 1162, 1405, 3276, 3552, 3575, 3866, 3955, 3999, 4151, 4382], 'complex,': [6, 198, 1230], 'which': [7, 199, 590, 1231, 1546, 1556, 2274, 2352, 2375, 2771, 2801, 3730, 3855, 4222], 'is': [8, 36, 74, 116, 123, 176, 200, 228, 266, 308, 315, 368, 392, 922, 1692, 1725, 1936, 3372, 3659, 3715, 3731, 3823, 3924, 3948, 3961, 4214], 'assembled': [9, 201], 'from': [10, 20, 160, 202, 212, 352, 889, 2050, 2072, 2089, 2117, 2355, 2554, 2799, 2806, 2909, 3265, 3429, 3727, 3769, 4107], 'Sar1p,': [11, 203, 1387, 1393], 'Sec23p-Sec24p,': [12, 204], 'and': [13, 28, 41, 58, 67, 92, 102, 118, 184, 205, 220, 233, 250, 259, 284, 294, 310, 376, 389, 584, 765, 841, 911, 1103, 1147, 1169, 1171, 1227, 1388, 1429, 1444, 1541, 1543, 1674, 1809, 1897, 1912, 1948, 1984, 2009, 2065, 2074, 2084, 2092, 2102, 2180, 2228, 2269, 2285, 2287, 2323, 2327, 2331, 2342, 2400, 2436, 2532, 2569, 2630, 2698, 2824, 2846, 2903, 2945, 2962, 2986, 3006, 3019, 3025, 3051, 3069, 3193, 3203, 3233, 3267, 3438, 3472, 3516, 3545, 3573, 3644, 3788, 3868, 3914, 3990, 4059, 4063, 4198, 4203, 4240, 4259, 4287, 4401, 4425], 'Sec13p-Sec31p,': [14, 206, 1170], 'are': [15, 84, 207, 276, 796, 822, 842, 1099, 1149, 1303, 1890, 1946, 3263, 3273], 'involved': [16, 208, 1703, 1726], 'in': [17, 39, 62, 77, 168, 186, 209, 231, 254, 269, 360, 378, 507, 577, 928, 1039, 1061, 1101, 1219, 1400, 1442, 1700, 1704, 1727, 1740, 1830, 1939, 1979, 2106, 2839, 3085, 3154, 3200, 3270, 3374, 3409, 3467, 3490, 3495, 3510, 3601, 3630, 3639, 3698, 3704, 3801, 3895, 3906, 3909, 3927, 3941, 3950, 3965, 3975, 4220, 4253, 4317, 4320, 4417], 'protein': [18, 210, 1177, 1679, 1976, 2026, 2055, 2526, 2561, 2778, 2877, 2994, 3169], 'export': [19, 159, 211, 351], 'endoplasmic': [22, 214, 407, 415, 463], 'reticulum': [23, 215, 408], '(ER).': [24, 216], 'We': [25, 217, 1426, 2857, 4376], 'previously': [26, 218, 1428, 2188, 2440, 2613, 2638, 4162], 'identified': [27, 219, 1427, 1558], 'characterized': [29, 221, 1430, 3274], 'a': [30, 165, 177, 222, 357, 369, 799, 1043, 1062, 1172, 1383, 1431, 1446, 1677, 1720, 2006, 2053, 2310, 2321, 2339, 2377, 2550, 2559, 2760, 2787, 2803, 2959, 3089, 3110, 3165, 3195, 3412, 3420, 3498, 3526, 3546, 3551, 3770, 3774, 3954, 4139], 'novel': [31, 223, 1678], 'Sec23p-interacting': [32, 224, 1433, 1635], 'protein,': [33, 225, 1434, 1617], 'p125,': [34, 226, 1435, 1673, 1911, 3103], 'that': [35, 72, 174, 227, 264, 366, 396, 818, 918, 1096, 1436, 1619, 1671, 1718, 1907, 1934, 2862, 3259, 3271, 3533, 3555, 3662, 3922, 3946, 3997, 4142, 4212, 4246, 4405, 4416], 'only': [37, 229, 1440], 'expressed': [38, 230, 1441, 1978, 3150, 3447, 4406], 'mammals': [40, 232, 1443], 'exhibits': [42, 234, 1382, 1445, 3398], 'sequence': [43, 235, 1549, 1629, 2350, 2359, 3401], 'homology': [44, 236, 1550, 3402], 'phosphatidic': [46, 238, 429, 477], 'acid-preferring': [47, 239, 430, 478], 'phospholipase': [48, 240, 431, 479], 'A1': [49, 241], '(PA-PLA1).': [50, 242], 'In': [51, 243, 745, 877, 1901, 2885, 3593], 'this': [52, 190, 244, 382, 1298, 1690, 1697, 1723, 1796, 1902, 1954, 2107, 2886, 3396], 'study,': [53, 245, 1903, 2887, 3091], 'we': [54, 70, 246, 262, 1904, 1913, 2888, 3092, 3107, 3378, 3387, 3483, 3618, 3805, 3957, 3973], 'examined': [55, 247, 1914, 3007, 3806, 4377], 'localization': [57, 107, 249, 299, 1896, 1923, 3101, 3486, 3621, 3695], 'function': [59, 251, 1794, 1898], 'of': [60, 87, 96, 134, 139, 145, 180, 189, 252, 279, 288, 326, 331, 337, 372, 381, 581, 589, 595, 1042, 1164, 1212, 1223, 1390, 1403, 1614, 1689, 1696, 1722, 1792, 1795, 1825, 1828, 1899, 1917, 1919, 1924, 1953, 1962, 2000, 2022, 2278, 2301, 2346, 2351, 2371, 2393, 2412, 2541, 2546, 2567, 2576, 2591, 2683, 2707, 2759, 2775, 2795, 2812, 2842, 2900, 2914, 2925, 2981, 3035, 3072, 3102, 3197, 3245, 3248, 3393, 3422, 3427, 3487, 3622, 3635, 3696, 3725, 3735, 3809, 3811, 3820, 3829, 3847, 3860, 3993, 4052, 4066, 4083, 4114, 4123, 4135, 4158, 4228, 4232, 4235, 4248, 4257, 4381, 4387], 'p125': [61, 73, 91, 135, 175, 253, 265, 283, 327, 367, 1503, 1625, 1829, 1920, 1935, 1963, 2037, 2547, 2568, 2684, 2901, 3082, 3111, 3147, 3371, 3394, 3415, 3489, 3536, 3572, 3597, 3623, 3636, 3697, 3782, 3795, 3816, 3898, 3923, 3935, 3947, 3960, 4067, 4084, 4124, 4188, 4213, 4229, 4249, 4316, 4388], 'detail.': [63, 255], 'By': [64, 256, 3479], 'using': [65, 257, 2016, 2052, 2309, 2594, 2688, 2853, 2919, 3480], 'immunofluorescence': [66, 258, 2171, 2851, 3009, 3117, 3913], 'electron': [68, 260, 3915], 'microscopy,': [69, 261, 2172], 'found': [71, 263, 3159], 'principally': [75, 267], 'localized': [76, 268, 1938, 3926], 'ER': [78, 109, 140, 162, 181, 270, 301, 332, 354, 373, 801, 805, 819, 882, 932, 1108, 1143, 1216, 1940, 3086, 3229, 3252, 3260, 3375, 3643, 3699, 3742, 3928, 4236], 'exit': [79, 110, 141, 182, 271, 302, 333, 374, 405, 806, 820, 883, 933, 1144, 1941, 3230, 3253, 3261, 3376, 3700, 3929], 'sites': [80, 183, 272, 375, 807, 821, 884, 934, 3262, 3701, 3930], 'where': [81, 273, 1943], 'COPII-coated': [82, 274, 508, 794, 1944, 3821], 'produced.': [85, 277], 'Analyses': [86, 278], 'chimeric': [88, 280], 'proteins': [89, 281, 404, 583, 1098, 1155, 1302, 1925, 2424, 2608, 2697, 3250, 3558, 3739, 3871, 4264], 'comprising': [90, 282, 2384, 2562], 'two': [93, 285, 1165, 3557, 3705], 'other': [94, 286, 3583], 'members': [95, 287, 1695], 'mammalian': [98, 290, 746, 878, 1432, 2431], 'PA-PLA1': [99, 291, 1683, 2303], 'family': [100, 292, 1691, 1698, 1797], '(PA-PLA1': [101, 293], 'KIAA0725p)': [103, 295], 'showed': [104, 296, 3554, 3587, 4245], 'that,': [105, 297], 'for': [106, 298, 1159, 1510, 2434, 2704, 2769, 2822, 2827, 2848, 2898, 2943, 2965, 2998, 3030, 3116, 3170, 3251, 3571, 3664], 'to': [108, 300, 592, 886, 931, 1106, 1233, 1409, 1438, 1551, 1611, 1737, 1822, 1892, 1950, 1990, 2041, 2368, 2389, 2407, 2422, 2549, 2600, 2859, 2874, 2881, 2989, 2992, 3047, 3054, 3098, 3160, 3661, 3717, 3722, 3740, 3773, 3791, 3857, 3901, 3938, 3963, 4068, 4081, 4094, 4111, 4200, 4216], 'sites,': [111, 303, 1145, 1942, 3231, 3377], 'p125-specific': [113, 305], 'N-terminal': [114, 306, 1506, 2427, 2543, 2564, 3390], 'region': [115, 307, 897, 1508, 1636, 2300, 3397, 3513, 4323], 'critical,': [117, 309], 'putative': [120, 312, 2386], 'lipase': [121, 313], 'domain': [122, 314], 'interchangeable': [124, 316], 'KIAA0725p': [126, 318, 1675, 2551, 3404], 'but': [127, 319, 1630, 2866, 3453, 3507, 3646, 4430], 'not': [128, 320, 1150, 3114, 3237, 3454, 3538, 3647, 4149, 4428], 'PA-PLA1.': [130, 322, 2414, 2572, 3406], 'RNA': [131, 323, 443, 491, 2895, 2927, 2961], 'interference-mediated': [132, 324], 'depletion': [133, 325, 1918], 'affected': [136, 328], 'organization': [138, 188, 330, 380, 1952], 'sites.': [142, 334, 3254], 'The': [143, 335, 1973, 1994, 2045, 2061, 2079, 2096, 2109, 2119, 2335, 2362, 2380, 2430, 2793, 2922, 2971, 3462, 3694, 4121], 'structure': [144, 336], 'cis-Golgi': [147, 339, 1070, 1148, 3205, 3235, 3269, 3654, 3869, 4262], 'compartment': [148, 340, 1045, 1055], 'was': [149, 156, 341, 348, 1557, 1965, 1977, 2014, 2027, 2115, 2124, 2135, 2184, 2238, 2281, 2291, 2306, 2353, 2396, 2420, 2539, 2558, 2685, 2791, 2797, 2802, 2917, 2929, 3038, 3060, 3113, 3148, 3158, 3502, 3508, 3523, 3569, 3599, 3637, 3702, 3796, 3904, 4071, 4100, 4129, 4394], 'also': [150, 342], 'substantially': [151, 343], 'disturbed,': [152, 344], 'whereas': [153, 345, 3608, 3781, 4261], 'medial-Golgi': [155, 347], 'not.': [157, 349], 'Protein': [158, 350, 384], 'occurred': [163, 355], 'without': [164, 356, 2958], 'significant': [166, 358, 1548, 3400], 'delay': [167, 359], 'p125-depleted': [169, 361, 2167], 'cells.': [170, 362, 3492, 3803, 3911], 'Our': [171, 363, 1931], 'study': [172, 364, 4244], 'suggests': [173, 365], 'mammalian-specific': [178, 370], 'component': [179, 371, 3576], 'participates': [185, 377], 'compartment.': [191, 383, 1161, 1955], 'transport': [385, 1706, 1736], 'through': [386, 1311], 'exocytic': [388], 'endocytic': [390], 'pathways': [391], 'mediated': [393], 'by': [394, 1109, 1559, 1731, 2003, 2127, 2170, 2222, 2530, 2534, 2687, 2786, 2850, 3008, 3062, 3275, 3733, 4061, 4073, 4154], 'vesicles/tubules': [395], 'transit': [397], 'between': [398, 1141, 1805, 3641], 'intracellular': [399], 'membrane': [400, 585, 1044, 1217, 1705, 1810, 3738, 3863, 3977, 4115, 4156], 'compartments.': [401], 'Newly': [402], 'synthesized': [403], '(ER)': [409], '1The': [410], 'abbreviations': [411, 459], 'used': [412, 460, 2421, 2889, 2897, 3093], 'are:': [413, 461], 'ER,': [414, 462], 'reticulum;': [416, 464], 'COP,': [417, 465], 'coat': [418, 466, 921, 927], 'protein;': [419, 467], 'VTCs,': [420, 468, 1146, 3232, 4239], 'vesicular': [421, 446, 469, 494, 596, 1047, 3499, 3861], 'tubular': [422, 470, 1048, 3862], 'clusters;': [423, 471], 'ERGIC,': [424, 472], 'ER-Golgi': [425, 473, 1053], 'intermediate': [426, 474, 1054], 'compartment;': [427, 475], 'PA-PLA1,': [428, 476, 1555, 1672, 2280, 2348, 2395], 'A1;': [432, 480], 'aa,': [433, 481], 'amino': [434, 482], 'acid;': [435, 483], 'mAb,': [436, 484, 2023], 'monoclonal': [437, 485, 2046, 2110, 3380], 'antibody;': [438, 486], 'GST,': [439, 487], 'glutathione': [440, 488], 'S-transferase;': [441, 489], 'RNAi,': [442, 490], 'interference;': [444, 492], 'VSV,': [445, 493], 'stomatitis': [447, 495], 'virus;': [448, 496], 'VSV-045G,': [449, 497, 2770, 2865], 'VSVts045-encoded': [450, 498], 'glycoprotein;': [451, 499], 'BFA,': [452, 500, 3765], 'brefeldin': [453, 501], 'A;': [454, 502], 'Endo': [455, 503, 3041], 'H,': [456, 504], 'endoglycosidase': [457, 505], 'H.1The': [458], 'H.': [506, 1640, 1646, 1748, 2496, 2502, 2665, 3675, 4271], '(for': [510], 'reviews,': [511], 'see': [512], 'Refs.': [513], '1Bannykh': [514], 'S.I.': [515, 749, 938, 2642], 'Nishimura': [516], 'N.': [517, 609, 980, 1190, 1247, 3331, 4290], 'Balch': [518, 638, 752, 941, 2616, 2645, 2668, 2712, 4003, 4171], 'W.E.': [519, 639, 753, 942, 2617, 2646, 2669, 2713, 4004, 4172], 'Trends': [520], 'Cell': [521, 537, 550, 564, 641, 755, 784, 855, 944, 988, 1007, 2132, 2648, 2671, 2762, 3183, 3217, 3339, 3358, 3750, 3883, 4174, 4277], 'Biol.': [522, 551, 565, 642, 756, 785, 831, 856, 945, 963, 1008, 1026, 1462, 1591, 1654, 1846, 2150, 2196, 2257, 2452, 2510, 2649, 2672, 2715, 3130, 3184, 3218, 3283, 3314, 3359, 3679, 3751, 3884, 4006, 4175, 4278, 4335], '1998;': [523, 539, 643, 666, 1283, 1593, 4176], '8:': [524], '21-25Abstract': [525], 'Full': [526, 622, 669, 671, 707, 709, 735, 737, 967, 969, 1128, 1130, 1203, 1260, 1286, 1288, 1343, 1345, 1371, 1373, 1467, 1469, 1596, 1598, 1659, 1661, 1851, 1853, 2155, 2157, 2201, 2203, 2457, 2459, 2515, 2517, 2720, 2722, 3135, 3137, 3318, 3320, 3684, 3686, 4011, 4013, 4303, 4305, 4340, 4342], 'Text': [527, 623, 670, 672, 708, 710, 736, 738, 968, 970, 1129, 1131, 1204, 1261, 1287, 1289, 1344, 1346, 1372, 1374, 1468, 1470, 1597, 1599, 1660, 1662, 1852, 1854, 2156, 2158, 2202, 2204, 2458, 2460, 2516, 2518, 2721, 2723, 3136, 3138, 3319, 3321, 3685, 3687, 4012, 4014, 4304, 4306, 4341, 4343], 'PDF': [528, 624, 673, 711, 739, 971, 1132, 1205, 1262, 1290, 1347, 1375, 1471, 1600, 1663, 1855, 2159, 2205, 2461, 2519, 2724, 3139, 3322, 3688, 4015, 4307, 4344], 'PubMed': [529, 555, 569, 625, 646, 674, 692, 712, 740, 760, 789, 836, 860, 872, 905, 949, 972, 993, 1012, 1031, 1087, 1133, 1206, 1263, 1291, 1328, 1348, 1376, 1421, 1472, 1498, 1536, 1577, 1601, 1664, 1762, 1786, 1856, 1882, 2160, 2206, 2262, 2462, 2488, 2520, 2623, 2653, 2676, 2725, 2753, 3140, 3188, 3222, 3288, 3300, 3323, 3344, 3363, 3689, 3755, 3841, 3888, 4016, 4044, 4179, 4282, 4308, 4345, 4371], 'Scopus': [530, 556, 570, 626, 647, 675, 693, 713, 741, 761, 790, 837, 861, 873, 906, 950, 973, 1013, 1032, 1088, 1134, 1207, 1264, 1292, 1329, 1349, 1377, 1422, 1473, 1499, 1537, 1578, 1602, 1665, 1763, 1787, 1857, 1883, 2161, 2207, 2263, 2463, 2489, 2521, 2624, 2654, 2677, 2726, 2754, 3141, 3189, 3223, 3289, 3301, 3324, 3364, 3690, 3756, 3842, 3889, 4017, 4045, 4180, 4283, 4309, 4346, 4372], '(122)': [531], 'Google': [532, 542, 558, 572, 628, 649, 677, 695, 715, 743, 763, 792, 839, 863, 875, 908, 952, 975, 994, 1015, 1034, 1090, 1136, 1209, 1266, 1294, 1331, 1351, 1379, 1424, 1475, 1501, 1539, 1580, 1604, 1667, 1765, 1789, 1859, 1885, 2163, 2209, 2265, 2465, 2491, 2523, 2626, 2656, 2679, 2728, 2756, 3143, 3191, 3225, 3291, 3303, 3326, 3345, 3366, 3692, 3758, 3844, 3891, 4019, 4047, 4182, 4285, 4311, 4348, 4374], 'Scholar,': [533, 543, 559, 629, 650, 678, 696, 716, 864, 953, 976, 995, 1016, 1267, 1332, 1352, 1476, 1581, 1766, 1860, 2466, 2492, 2657, 2729, 3292, 3304, 3327, 3346, 4020, 4349], '2Hong': [534], 'W.': [535, 3677], 'J.': [536, 633, 640, 688, 702, 754, 772, 778, 783, 943, 987, 1005, 1006, 1082, 1123, 1324, 1338, 1461, 1590, 1644, 1653, 1845, 2149, 2195, 2451, 2500, 2509, 2647, 2670, 2714, 2749, 2808, 3129, 3182, 3216, 3338, 3356, 3357, 3678, 3748, 3749, 3881, 3882, 4005, 4040, 4166, 4173, 4276, 4334], 'Sci.': [538, 989, 1570, 3340], '111:': [540], '2831-2839PubMed': [541], '3Antonny': [544], 'B.': [545, 682, 1318], 'Schekman': [546, 616, 661, 685, 729, 1197, 1254, 1278, 1321, 1365], 'R.': [547, 617, 662, 686, 730, 961, 984, 1018, 1198, 1255, 1279, 1322, 1366, 1416, 3209, 3312, 3335, 3836], 'Curr.': [548, 562, 962, 3313], 'Opin.': [549, 563], '2001;': [552, 1009, 3360, 3885], '13:': [553], '438-443Crossref': [554], '(160)': [557], '4Barlowe': [560], 'C.': [561, 599, 637, 1022, 1180, 1237, 1414, 1774, 2667, 3834, 4170, 4269, 4296], '2002;': [566, 689, 857, 1325, 1656, 1759, 1783, 2512], '14:': [567, 1029, 1760, 1784, 2260], '417-422Crossref': [568], '(94)': [571], 'Scholar).': [573, 744, 876, 909, 1035, 1091, 1137, 1210, 1295, 1380, 1425, 1502, 1605, 1668, 1790, 2164, 2210, 2266, 2524, 2627, 2680, 2757, 3144, 3226, 3367, 3693, 3759, 3892, 4048, 4375], 'plays': [575], 'roles': [576], 'both': [578, 3201], 'selection': [580, 2883], 'cargo': [582, 1301], 'deformation,': [586], 'latter': [588], 'leads': [591, 1232, 3856], 'generation': [594, 3859], 'structures': [597, 3586, 3604], '(5Barlowe': [598, 1179, 1236], 'Orci': [600, 653, 727, 1181, 1238, 1270, 1363], 'L.': [601, 654, 728, 1182, 1239, 1271, 1364, 3179], 'Yeung': [602, 663, 1183, 1240, 1280], 'T.': [603, 664, 751, 940, 1020, 1184, 1241, 1281, 1412, 1454, 1478, 1516, 1642, 1744, 1770, 1776, 1838, 1862, 2142, 2251, 2444, 2468, 2498, 2615, 2644, 2659, 3122, 3177, 3669, 3832, 4327, 4351], 'Hosobuchi': [604, 1185, 1242], 'M.': [605, 613, 615, 631, 656, 936, 1186, 1194, 1196, 1243, 1251, 1253, 1273, 1460, 1484, 1488, 1522, 1526, 1648, 1650, 1752, 1754, 1756, 1780, 1844, 1868, 1872, 2148, 2190, 2243, 2245, 2255, 2450, 2474, 2478, 2504, 2506, 2640, 2661, 2711, 2747, 3128, 4002, 4038, 4164, 4292, 4333, 4357, 4361], 'Hamamoto': [606, 659, 683, 725, 1187, 1244, 1276, 1319, 1361], 'S.': [607, 635, 660, 684, 726, 1001, 1188, 1245, 1277, 1320, 1362, 1572, 2194, 2741, 3352, 3877, 4032, 4168], 'Salama': [608, 1189, 1246], 'Rexach': [610, 1191, 1248], 'M.F.': [611, 1192, 1249], 'Ravazzola': [612, 1193, 1250], 'Amherdt': [614, 655, 1195, 1252, 1272], 'Cell.': [618, 665, 703, 731, 832, 1027, 1124, 1199, 1256, 1282, 1339, 1367, 1758, 1782, 2258, 3284, 4299], '1994;': [619, 1200, 1257, 1574], '77:': [620, 1201, 1258], '895-907Abstract': [621, 1202, 1259], '(1043)': [627, 1208, 1265], '6Aridor': [630], 'Weissman': [632, 4165], 'Bannykh': [634, 937, 2641, 4167], 'Nuoffer': [636, 2666, 4169], '141:': [644, 4177], '61-70Crossref': [645, 4178], '(247)': [648, 4181], '7Matsuoka': [651, 1268], 'K.': [652, 1003, 1078, 1269, 1452, 1458, 1480, 1482, 1490, 1518, 1520, 1528, 1638, 1652, 1772, 1836, 1842, 1864, 1866, 1874, 2140, 2146, 2249, 2442, 2448, 2470, 2472, 2480, 2494, 2508, 2733, 3120, 3126, 3354, 3879, 4024, 4325, 4331, 4353, 4355, 4363], 'Bednarek': [657, 1274], 'S.Y.': [658, 1275], '93:': [667, 1284], '263-275Abstract': [668, 1285], '(498)': [676, 1293], '8Miller': [679], 'E.': [680, 698, 1024, 1316, 1334, 4275], 'Antonny': [681, 1317], 'EMBO': [687, 867, 900, 1323, 2748, 3295, 4039], '21:': [690, 1326], '6105-6113Crossref': [691, 1327], '(200)': [694, 1330], '9Mossessova': [697, 1333], 'Bickford': [699, 1335], 'L.C.': [700, 1336], 'Goldberg': [701, 1337], '2003;': [704, 732, 869, 902, 1028, 1340, 1368, 2259, 2750, 3297, 4041], '114:': [705, 733, 1341, 1369], '483-495Abstract': [706, 1342], '(295)': [714, 1350], '10Miller': [717, 1353], 'E.A.': [718, 1354], 'Beilharz': [719, 1355], 'T.H.': [720, 997, 1356, 3348, 3873], 'Malkus': [721, 1357], 'P.N.': [722, 1358], 'Lee': [723, 1359], 'M.C.': [724, 1360], '497-509Abstract': [734, 1370], '(403)': [742, 1378], 'cells': [747, 816, 1742, 2033, 2169, 2173, 2212, 2581, 2815, 2890, 2916, 2940, 2950, 2972, 3003, 3013, 3431, 3435, 3440, 3506, 3708, 3761, 4221, 4254, 4418], '(11Bannykh': [748], 'Rowe': [750, 939, 2643], '1996;': [757, 2198, 2673], '135:': [758, 2674], '19-35Crossref': [759], '(332)': [762], 'Scholar)': [764, 840, 1540, 4286, 4312], 'yeast': [766], 'Pichia': [767], 'pastoris': [768], '(12Rossanese': [769], 'O.W.': [770], 'Soderholm': [771], 'Bevis': [773], 'B.J.': [774, 847], 'Sears': [775], 'I.B.': [776], "O'Connor": [777], 'Williamson': [779], 'E.K.': [780], 'Glick': [781, 828, 852, 3280], 'B.S.': [782, 829, 853, 3281], '1999;': [786, 964, 1125, 1464, 1848, 2152, 2454, 3132, 3315, 4279, 4337], '145:': [787], '69-81Crossref': [788], '(259)': [791], 'Scholar),': [793, 1886, 3192, 3845, 4183], 'produced': [797, 1905, 1996, 2529, 3108], 'at': [798, 2968, 2976, 3027, 3151, 3624, 4250, 4421], 'specialized': [800], 'subdomain': [802], 'known': [803, 3167, 3716], 'as': [804, 2137, 2186, 2240, 2320, 2329, 2611, 2636, 2702, 3241, 4160, 4266], 'or': [808, 1051, 1707, 2579, 2934, 2957, 3405, 3458], 'transitional': [810], 'ER.': [811], 'Recent': [812, 1710], 'studies': [813, 915, 1815, 3257], 'involving': [814, 1816], 'living': [815], 'revealed': [817, 3258, 3611], 'immobile': [823], 'yet': [824], 'dynamic': [825], '(13Hammond': [826, 3278], 'A.T.': [827, 849, 3279], 'Mol.': [830, 1025, 2256, 3282], '2000;': [833, 990, 1495, 1533, 1879, 2485, 2717, 3285, 3341, 3681, 4008, 4368], '11:': [834, 3286], '3013-3030Crossref': [835, 3287], '(210)': [838, 3290], 'generated': [843], 'de': [844], 'novo': [845], '(14Bevis': [846], 'Hammaond': [848], 'Reinke': [850], 'C.A.': [851], 'Nat.': [854], '4:': [858, 870, 903, 3298], '750-756Crossref': [859], '(188)': [862], '15Stephens': [865, 3293], 'D.J.': [866, 899, 978, 3294, 3329], 'Rep.': [868, 901, 3296], '210-217Crossref': [871, 904, 3299], '(85)': [874, 907, 3302], 'cells,': [879, 1982, 3156], 'newly': [880], 'formed': [881, 4319], 'appear': [885], 'move': [887, 1060], 'slowly': [888], 'cell': [891, 913], 'periphery': [892], 'toward': [893, 1068, 1386], 'perinuclear': [895, 3512, 3595, 3771, 3907, 4218, 4322], 'Golgi-proximal': [896], '(15Stephens': [898], 'Biochemical': [910], 'live': [912], 'imaging': [914], 'have': [916, 1156], 'suggested': [917, 1095], 'replaced': [923], 'COPI': [926, 3198, 3726], 'close': [929], 'proximity': [930], '(16Aridor': [935, 2639], '1995;': [946, 2620, 2650], '131:': [947, 2651], '875-893Crossref': [948, 2652], '(342)': [951, 2655], '17Shima': [954, 3305], 'D.T.': [955, 3306], 'Scales': [956, 3307], 'S.J.': [957, 3308], 'Kreis': [958, 3210, 3309], 'T.E.': [959, 3211, 3310], 'Pepperkok': [960, 983, 3311, 3334], '9:': [965, 3316], '821-824Abstract': [966, 3317], '(82)': [974, 3325], '18Stephens': [977, 3328], 'Lin-Marq': [979, 3330], 'Pagano': [981, 3332], 'A.': [982, 1456, 1573, 1778, 1840, 2144, 2192, 2253, 2446, 2735, 2737, 3124, 3173, 3207, 3333, 4026, 4028, 4273, 4329], 'Paccaud': [985, 3336], 'J.P.': [986, 3337], '113:': [991, 3342], '2177-2185Crossref': [992, 3343], '19Ward': [996, 3347], 'Polishchuk': [998, 3349, 3874], 'R.S.': [999, 3350, 3875], 'Caplan': [1000, 3351, 3876], 'Hirschberg': [1002, 1077, 3353, 3878], 'Lippincott-Schwartz': [1004, 1081, 2809, 3355, 3747, 3880], '155:': [1010, 3361, 3886], '557-570Crossref': [1011, 3362, 3887], '(346)': [1014, 3365, 3890], '20Garcia-Mata': [1017], 'Szul': [1019], 'Alvarez': [1021], 'Sztul': [1023, 4274], '2250-2261Crossref': [1030], '(106)': [1033], 'This': [1036, 3443, 3656, 3713, 4205], 'replacement': [1037], 'results': [1038, 1218, 1399, 1932, 3917], 'formation': [1041], 'named': [1046, 3416], 'clusters': [1049, 3864, 3908, 3952, 4219, 4318], '(VTCs)': [1050], '(ERGIC).': [1056], 'These': [1057, 3912], 'cargo-containing': [1058], 'VTCs': [1059, 1102, 3171, 3202, 3266], 'COPI-dependent': [1063], 'manner': [1064], 'along': [1065], 'microtubule': [1066], 'tracks': [1067], '(21Presley': [1071], 'J.F.': [1072], 'Cole': [1073], 'N.B.': [1074], 'Schroer': [1075], 'T.A.': [1076], 'Zaal': [1079], 'K.J.': [1080], 'Nature.': [1083], '1997;': [1084, 4300], '389:': [1085], '81-85Crossref': [1086], '(3)': [1089], 'It': [1092, 1669, 4412], 'has': [1093, 1716], 'been': [1094, 1157], 'ER-resident': [1097], 'segregated': [1100], 'transported': [1104], 'back': [1105], 'COPI-coated': [1110], 'via': [1112, 3825], 'retrograde': [1114], 'pathway': [1115, 1834], '(22Martinez-Menarguez': [1116], 'J.A.': [1117, 1566, 1589, 3175], 'Geuze': [1118, 3212], 'H.J.': [1119, 3213], 'Slot': [1120, 3214], 'J.W.': [1121, 3215], 'Klumperman': [1122], '98:': [1126], '81-90Abstract': [1127], '(256)': [1135], 'Although': [1138, 1685, 1812], 'boundaries': [1140], 'fully': [1151, 3239], 'defined,': [1152], 'several': [1153], 'marker': [1154, 3168, 3249], 'reported': [1158, 4161], 'each': [1160], 'consists': [1163], 'heterotrimeric': [1166], 'complexes,': [1167], 'Sec23p-Sec24p': [1168, 1225], 'low': [1173, 3152], 'molecular': [1174], 'weight': [1175], 'GTP-binding': [1176], 'Sar1p': [1178, 1213, 3814, 3830, 4079, 4132, 4140], 'Activation': [1211], 'on': [1214, 1392, 1712, 1921, 2005, 2176, 2214, 2583, 3056, 3425, 3815, 4131], 'sequential': [1221, 2223], 'recruitment': [1222, 4152], 'complex': [1226], 'Sec13p-Sec31p': [1229], 'vesicle': [1234, 1397, 1735], 'budding': [1235, 1299], 'Concomitant': [1296], 'process,': [1300], 'selectively': [1304], 'incorporated': [1305], 'into': [1306, 1802, 1967, 1987, 2029, 2293, 2403], 'forming': [1307], 'most': [1309, 3474, 3736], 'likely': [1310, 3475], 'interaction': [1312, 1512, 4125, 4189], 'Sec24p': [1314], '(8Miller': [1315], 'Sec23p': [1381, 1514, 2083, 3577, 4402, 4426], 'GAP': [1384], 'activity': [1385], 'hydrolysis': [1389], 'GTP': [1391], 'perhaps': [1394, 1730], 'occurring': [1395], 'after': [1396, 2937, 2984], 'fission,': [1398], 'depolymerization': [1402], 'coat,': [1406], 'thereby': [1407, 3720], 'leading': [1408, 3721], 'uncoating': [1410, 3819], '(23Yoshihisa': [1411, 3831], 'Barlowe': [1413, 3833], 'Scheckman': [1415, 3835], 'Science.': [1417, 3837], '1993;': [1418, 3219, 3838], '259:': [1419, 3839], '1466-1468Crossref': [1420, 3840], '(287)': [1423, 3843], 'appears': [1437], 'be': [1439, 1702, 3161, 3238, 4414], 'wide': [1447], 'tissue': [1448], 'expression': [1449, 1819, 1968, 2416, 2432, 2575, 2592, 2767, 2820, 2829, 2849, 3096, 3810, 3846, 4247, 4386], 'distribution': [1450, 4380], '(24Tani': [1451, 1835, 2139, 2441, 3119, 4324], 'Mizoguchi': [1453, 1641, 1837, 2141, 2443, 2497, 3121, 4326], 'Iwamatsu': [1455, 1839, 2143, 2445, 3123, 4328], 'Hatsuzawa': [1457, 1481, 1519, 1841, 1865, 2145, 2248, 2447, 2471, 3125, 4330, 4354], 'Tagaya': [1459, 1487, 1525, 1649, 1843, 1871, 2147, 2254, 2449, 2477, 2505, 3127, 4332, 4360], 'Chem.': [1463, 1592, 1655, 1847, 2151, 2197, 2453, 2511, 2716, 3131, 3680, 4007, 4336], '274:': [1465, 1849, 2153, 2455, 3133, 4338], '20505-20512Abstract': [1466, 1850, 2154, 2456, 3134, 4339], '(83)': [1474, 1858, 2162, 2464, 3142, 4347], '25Mizoguchi': [1477, 1861, 2467, 4350], 'Nakajima': [1479, 1517, 1863, 2469, 4352], 'Nagahama': [1483, 1521, 1647, 1867, 2473, 2503, 4356], 'Hauri': [1485, 1523, 1869, 2475, 3180, 4358], 'H.-P.': [1486, 1524, 1870, 2476, 3181, 4359], 'Tani': [1489, 1527, 1651, 1873, 2250, 2479, 2507, 4362], 'Biochem.': [1491, 1529, 1875, 2481, 4364], 'Biophys.': [1492, 1530, 1876, 2482, 4365], 'Res.': [1493, 1531, 1877, 2483, 4366], 'Commun.': [1494, 1532, 1878, 2484, 4367], '279:': [1496, 1534, 1880, 2486, 4369], '144-149Crossref': [1497, 1535, 1881, 2487, 4370], '(26)': [1500, 1538, 1884, 2490, 4373], 'contains': [1504], 'an': [1505, 1713, 1800, 1817, 2426, 2926, 3094, 3385, 3942, 3966], 'proline-rich': [1507, 1634], 'responsible': [1509], '(25Mizoguchi': [1515], 'central': [1542], 'C-terminal': [1544, 2781], 'regions,': [1545], 'exhibit': [1547], 'phospholipid-modifying': [1552], 'proteins,': [1553, 2577], 'especially': [1554], 'Higgs': [1560], 'et': [1561], 'al.': [1562], '(26Higgs': [1563], 'H.N.': [1564, 1583], 'Glomset': [1565, 1588], 'Proc.': [1567], 'Natl.': [1568], 'Acad.': [1569], 'U.': [1571], '91:': [1575], '9574-9578Crossref': [1576], '(73)': [1579], '27Higgs': [1582], 'Han': [1584], 'M.H.': [1585], 'Johnson': [1586], 'G.E.': [1587], '273:': [1594], '5468-5477Abstract': [1595], '(80)': [1603], 'A': [1606, 2538, 3033, 3565, 4097], 'data': [1607, 2360], 'base': [1608], 'search': [1609], 'led': [1610, 4080], 'discovery': [1613], 'another': [1615, 3574], 'p125-like': [1616], 'KIAA0725p,': [1618], 'shows': [1620], '52.6%': [1621], 'aa': [1622, 1960, 2276, 2544, 2565, 2773, 2783, 3392], 'identity': [1623], 'over': [1626], 'entire': [1628, 2571], 'lacks': [1631], 'N-terminal,': [1633], '(28Nakajima': [1637], 'Sonoda': [1639, 2495], 'Aoki': [1643, 2499], 'Arai': [1645, 2501], '277:': [1657, 2513], '11329-11335Abstract': [1658, 2514], '(77)': [1666, 2522], 'seems': [1670], 'constitute': [1676], 'family,': [1680, 1724], 'i.e.': [1681], 'family.': [1684], 'physiological': [1687], 'implication': [1688], 'poorly': [1693], 'understood,': [1694], 'may': [1699, 1798], 'general': [1701], 'organelle': [1708], 'maintenance.': [1709], 'work': [1711], 'Arabidopsis': [1714], 'mutant': [1715, 4141], 'demonstrated': [1717, 1933], 'SGR2p,': [1719], 'member': [1721], 'gravity': [1728], 'sensing,': [1729], 'mediating': [1732], 'vacuole': [1733], 'and/or': [1734, 2231], 'vacuoles': [1739], 'endodermal': [1741], '(29Kato': [1743], 'Morita': [1745], 'M.T.': [1746, 1768], 'Fukaki': [1747], 'Yamauchi': [1749], 'Y.': [1750, 2247], 'Uehara': [1751], 'Niihama': [1753], 'Tasaka': [1755, 1779], 'Plant': [1757, 1781], '33-46Crossref': [1761], '(178)': [1764], '30Morita': [1767], 'Kato': [1769], 'Nagafusa': [1771], 'Saito': [1773], 'Ueda': [1775], 'Nakano': [1777], '47-56Crossref': [1785], '(136)': [1788], 'Understanding': [1791], 'provide': [1799], 'insight': [1801], 'relationships': [1804], 'lipid': [1806], 'metabolism,': [1807], 'signaling,': [1808], 'transport.': [1811, 2995], 'our': [1813], 'previous': [1814, 3090, 4243], 'ectopic': [1818, 3095, 4385], 'system': [1820, 3097], 'contributed': [1821], 'understanding': [1824], 'role': [1827], 'early': [1832, 1928], 'secretory': [1833, 1929], 'more': [1887, 3612], 'direct': [1888], 'approaches': [1889], 'necessary': [1891], 'define': [1893], 'exact': [1895], 'p125.': [1900, 3383, 3478], 'antibodies': [1906, 2002, 2035, 2047, 2081, 2098, 2227, 3381], 'specifically': [1908, 3418, 3534], 'recognize': [1909], 'endogenous': [1910, 3477, 3488], 'effect': [1916, 3808], 'within': [1926, 3648], 'pathway.': [1930], 'mainly': [1937], 'produced,': [1947], 'contributes': [1949], 'Antibodies—The': [1956], 'cDNA': [1957, 2312, 2317, 2411, 2794], 'fragment': [1958, 2290, 2552], 'encoding': [1959], '1–134': [1961], '(p125N)': [1964], 'inserted': [1966, 2292, 2402], 'vector': [1969, 2406], 'pGEX-4T-1': [1970], '(Amersham': [1971, 2059], 'Biosciences).': [1972, 2060], 'GST-p125N': [1974], 'fusion': [1975, 2560], 'Escherichia': [1980], 'coli': [1981], 'purified,': [1983], 'then': [1985, 2010, 2401, 2825, 2963, 2987, 3052], 'injected': [1986, 2028], 'rabbits': [1988], 'according': [1989, 2040, 2599, 3046], 'standard': [1992, 2043], 'method.': [1993], 'antisera': [1995], 'were': [1997, 2038, 2048, 2070, 2087, 2104, 2174, 2216, 2438, 2528, 2586, 2609, 2634, 2816, 2837, 2907, 2941, 2954, 2973, 3004, 3014, 3076, 3559, 3709, 3762, 3984, 4057, 4105, 4427], 'first': [1998], 'depleted': [1999], 'anti-GST': [2001, 2068], 'chromatography': [2004], 'GST': [2007], 'column,': [2008], 'anti-p125': [2012], 'antibody': [2013, 2069, 2111, 2120, 3106, 3444, 3528, 3548], 'affinity-purified': [2015], 'antigen-coupled': [2017], 'beads.': [2018], 'For': [2019, 2573], 'production': [2021], 'purified': [2025, 2049, 2610], 'BALB/c': [2030], 'mice.': [2031], 'Hybridoma': [2032], 'producing': [2034], 'against': [2036, 2082, 2099, 2112, 2121, 3109, 3382, 3414, 3549], 'obtained': [2039, 2071, 2869], 'protocol.': [2044], 'ascites': [2051], 'HiTrap™': [2054], 'G': [2056], 'HP': [2057], 'column': [2058], 'anti-FLAG': [2062], 'mAb': [2063, 3413, 3481, 3543, 4076], '(M2)': [2064], 'polyclonal': [2067, 2080, 2097, 3066, 3527, 3547], 'Sigma': [2073], 'Santa': [2075], 'Cruz': [2076], 'Biotechnology,': [2077], 'respectively.': [2078, 2095, 2334], 'mannosidase': [2085], 'II': [2086, 2123], 'purchased': [2088, 2908], 'Affinity': [2090], 'BioReagents': [2091], 'Chemicon': [2093], 'International,': [2094], 'VSV-G,': [2100], 'β-COP,': [2101, 3194], 'Sec31p': [2103, 3665, 3792, 3800, 3902, 4397, 4424], 'prepared': [2105, 2116, 2635, 3379], 'laboratory.': [2108], 'VSV-G': [2113], '(8G5)': [2114], 'ascites.': [2118], 'ribophorin': [2122], 'kindly': [2125], 'provided': [2126], 'Dr.': [2128, 2807], 'D.': [2129], 'Meyer': [2130], '(UCLA).': [2131], 'Culture—Cell': [2133], 'culture': [2134], 'performed': [2136, 2185, 2239, 2918, 3974], 'described': [2138, 2187, 2241, 2439, 2612, 2637, 2703], 'To': [2165, 2296, 3368, 3970], 'examine': [2166], 'HeLa': [2168, 2761, 2814, 2915, 3439, 3491], 'grown': [2175, 2213], 'poly-l-lysine-coated': [2177], 'coverslips.': [2178], 'Immunofluorescence': [2179], 'Immunoelectron': [2181, 2236], 'Microscopy—Immunofluorescence': [2182], 'microscopy': [2183, 2237, 2852], '(31Tagaya': [2189], 'Furuno': [2191], 'Mizushima': [2193], '271:': [2199], '466-470Abstract': [2200], '(44)': [2208], 'Briefly,': [2211], 'coverslips': [2215], 'fixed': [2217, 3005], '4%': [2219], 'paraformaldehyde,': [2220], 'followed': [2221, 2785, 3732], 'incubation': [2224, 2997], 'primary': [2226], 'fluorescein': [2229], 'isothiocyanate-conjugated': [2230], 'Texas': [2232], 'Red-conjugated': [2233], 'secondary': [2234], 'antibodies.': [2235], '(32Nagahama': [2242], 'Suzuki': [2244], 'Hamada': [2246], 'Yamamoto': [2252], '262-273Crossref': [2261], '(75)': [2264, 3691], 'Plasmid': [2267], 'Construction': [2268, 2758], 'Transfection—cDNA': [2270], 'clone': [2271], 'AK058137': [2272, 2373], '(Toyobo),': [2273], 'encodes': [2275, 2772], '360–872': [2277], 'human': [2279, 2302, 2311, 2315, 2347, 2357, 2394, 2413], 'cleaved': [2282], 'KpnI': [2284, 2340, 2378, 2391, 2399], 'XhoI,': [2286], 'resultant': [2289], 'pBluescript': [2294], 'SK+.': [2295], 'obtain': [2297, 2860], 'upstream': [2299], 'cDNA,': [2304], 'PCR': [2305, 2531], 'carried': [2307], 'out': [2308], 'library': [2313], '(MATCHMAKER': [2314], 'leukocyte': [2316], 'library,': [2318], 'Clontech)': [2319], 'template': [2322], 'synthetic': [2324], 'oligonucleotides': [2325], '(5′-gcgggtaccgagaattcaagatctatgaattacccgggccgcgg': [2326], '5′-ggcggtaccactacttgatgctttag)': [2328], 'sense': [2330, 2336], 'antisense': [2332, 2363], 'primers,': [2333], 'primer': [2337, 2364], 'contained': [2338, 2365], 'site': [2341, 2392], 'nucleotide': [2343], 'positions': [2344, 2369], '1–20': [2345], 'taken': [2354, 3918], 'genome': [2358], 'base.': [2361], 'nucleotides': [2366], 'complementary': [2367], '69–91': [2370], 'sequence,': [2374], 'includes': [2376], 'site.': [2379], 'amplified': [2381], 'DNA': [2382, 2535], 'fragment,': [2383], 'initiation': [2387], 'codon': [2388], 'treated': [2397, 3710, 3763], 'pBluescript-derived': [2405], 'generate': [2408], 'full-length': [2410], 'Mammalian': [2415], 'plasmid': [2417, 2768, 2821], 'pFLAG-CMV-2': [2418], '(Sigma)': [2419], 'express': [2423, 2864, 2875, 4223], 'FLAG': [2428], 'epitope.': [2429], 'plasmids': [2433, 2593], 'FLAG-p125': [2435, 3448, 4393, 4407, 4420], 'FLAG-KIAA0725p': [2437, 3455], '28Nakajima': [2493], 'Chimeric': [2525], 'constructs': [2527], 'verified': [2533], 'sequencing.': [2536], 'Chimera': [2537, 2556], 'composed': [2540], '1–234': [2545], 'fused': [2548], 'starting': [2553], 'Ser-2.': [2555], 'B': [2557], '1–259': [2566], 'Vero': [2578, 3434], '293T': [2580, 3430], 'plated': [2582], '35-mm': [2584], 'dishes': [2585], 'transfected': [2587, 2817, 2955], '1–2': [2589], 'μg': [2590], 'Lipofectamine': [2595], 'PLUS': [2596], 'reagent': [2597, 3714], '(Invitrogen)': [2598], "manufacturer's": [2602, 3049], 'instructions.': [2603], 'Membrane': [2604, 2681], 'Binding': [2605], 'Assays—Recombinant': [2606], 'Sar1': [2607, 2696], '(33Rowe': [2614], 'Methods': [2618], 'Enzymol.': [2619], '257:': [2621], '49-53Crossref': [2622], '(33)': [2625], 'Microsome': [2628, 3939, 3982], 'membranes': [2629, 2690, 3964, 3983, 4056, 4070, 4088, 4104, 4128, 4137, 4192], 'rat': [2631, 2699, 3987], 'liver': [2632, 2700, 3988], 'cytosol': [2633, 3989], '34Rowe': [2658], 'Aridor': [2660, 2746, 4037], 'McCaffery': [2662], 'J.M.': [2663], 'Plutner': [2664], '895-911Crossref': [2675], '(150)': [2678], 'binding': [2682, 2709, 3978, 4065, 4116, 4157], 'analyzed': [2686, 3619], 'microsome': [2689, 4103, 4127, 4136, 4191], '(20–40': [2691], 'μg)': [2692], 'supplemented': [2693], 'recombinant': [2695], 'cytosol,': [2701], 'analysis': [2706, 3118], 'Sec23': [2708], '(35Aridor': [2710, 4001], '275:': [2718, 3682, 4009], '35673-35676Abstract': [2719, 4010], '(103)': [2727, 4018], '36Pathre': [2730, 4021], 'P.': [2731, 4022], 'Shome': [2732, 4023], 'Blumental-Perry': [2734, 4025], 'Bielli': [2736, 4027], 'Haney': [2738, 4029], 'C.J.': [2739, 4030], 'Alber': [2740, 4031], 'Watkins': [2742, 4033], 'S.C.': [2743, 4034], 'Romero': [2744, 4035], 'G.': [2745, 4036, 4298], '22:': [2751, 4042], '4059-4069Crossref': [2752, 4043], '(66)': [2755, 4046], 'Line': [2763], 'Expressing': [2764], 'VSV-045G—A': [2765], 'pcDNA3-based': [2766], '1–511': [2774], 'VSV-045G': [2777, 2796, 2823, 2947, 2953, 3059], '4': [2782], '(RTAA)': [2784], 'T7': [2788], 'tag': [2789], '(MASMTGGQQMG),': [2790], 'constructed.': [2792], 'derived': [2798], 'pVSVG-GFP,': [2800], 'kind': [2804], 'gift': [2805], '(National': [2810], 'Institutes': [2811], 'Health).': [2813], 'selected': [2826], 'stable': [2828], '400': [2831, 2843], 'μg/ml': [2832, 2844], 'G418': [2833, 2845], '(Invitrogen).': [2834, 2921], 'Individual': [2835], 'clones': [2836, 2861, 2868], 'cultured': [2838, 3155], 'presence': [2841], 'screened': [2847], 'anti-VSVG': [2855], 'mAb.': [2856], 'sought': [2858], 'stably': [2863, 2951], 'all': [2867], 'gradually': [2870], 'lost': [2871], 'ability': [2873], 'while': [2878], 'retaining': [2879], 'resistance': [2880], 'marker.': [2884], 'moderately': [2891], 'expressing': [2892, 2952, 4419], 'VSV-045G.': [2893], 'RNAi—The': [2894], 'duplexes': [2896], 'targeting': [2899, 4410], '(aagttgaccatttggtgtttg)': [2902], 'lamin': [2904], 'A/C': [2905], '(aactggacttccagaagaacatc)': [2906], 'Japan': [2910], 'Bioservice,': [2911], 'Inc.': [2912], 'Transfection': [2913], 'Oligofectamine': [2920], 'final': [2923], 'concentration': [2924], 'duplex': [2928, 2960], '200': [2930], 'nm.': [2931], 'At': [2932, 4049], '48': [2933], '72': [2935, 2982], 'h': [2936, 2967, 2983], 'transfection,': [2938], 'processed': [2942], 'immunoblotting': [2944, 3063, 4074], 'immunofluorescence.': [2946], 'Assays—HeLa': [2949], 'incubated': [2964, 2975, 3985], '48–55': [2966], '37': [2969], '°C.': [2970], 'further': [2974], '40': [2977], '°C': [2978, 2991, 3029], '(a': [2979, 3787], 'total': [2980], 'transfection)': [2985], 'shifted': [2988], '32': [2990], 'allow': [2993], 'After': [2996], 'indicated': [3000], 'times,': [3001], 'microscopy.': [3010], 'Alternatively,': [3011], 'solubilized': [3015], '0.5%': [3017], 'SDS': [3018], '1%': [3020], '2-mercaptoethanol': [3021], '(0.1': [3022], 'ml/35-mm': [3023], 'dish)': [3024], 'heated': [3026], '100': [3028], '10': [3031], 'min.': [3032], 'portion': [3034], 'lysate': [3037], 'digested': [3039], 'H': [3042], '(New': [3043], 'England': [3044], 'Biolabs),': [3045], 'protocol,': [3050], 'subjected': [3053], 'SDS-PAGE': [3055], '10%': [3057], 'gels.': [3058], 'visualized': [3061], 'anti-VSV-G': [3067], 'antibody,': [3068], 'intensities': [3071], 'immunostained': [3074], 'bands': [3075], 'quantitated': [3077], 'NIH': [3079], 'image': [3080], 'software.': [3081], 'Is': [3083, 3936], 'Localized': [3084], 'Exit': [3087, 4237], 'Sites—In': [3088], 'determine': [3099, 3369], 'because': [3104, 3244, 3395], 'peptide': [3112], 'suitable': [3115], 'When': [3145, 3760, 4391], 'FLAG-tagged': [3146], 'transiently': [3149], 'levels': [3153, 4252], 'it': [3157, 4186], 'colocalized': [3162, 3561, 3798, 4395, 4432], 'ERGIC53,': [3164, 4260], 'well': [3166, 3560], '(37Schweizer': [3172], 'Fransen': [3174], 'Bachi': [3176], 'Ginsel': [3178], '1988;': [3185], '107:': [3186], '1643-1653Crossref': [3187], '(374)': [3190], 'subunit': [3196], 'located': [3199, 3373], '(38Oprins': [3206], 'Duden': [3208], '121:': [3220], '49-59Crossref': [3221], '(156)': [3224], 'Until': [3227], 'recently,': [3228], 'could': [3236], 'discerned': [3240], 'distinct': [3242, 3264], 'compartments': [3243], 'lack': [3247], 'However,': [3255], 'recent': [3256], 'they': [3272], 'components': [3277, 3867], 'whether': [3370, 3959, 4378], 'As': [3384, 3407, 3493, 3628, 3893], 'antigen,': [3386], 'chose': [3388], '134': [3391], 'no': [3399], 'shown': [3408, 3494, 3629, 3894], 'Fig.': [3410, 3468, 3496, 3530, 3631, 3896], '1A,': [3411, 3450, 3469], '1D4': [3417, 3544], 'recognized': [3419], 'band': [3421, 3465], '∼125': [3423], 'kDa': [3424], 'immunoblots': [3426], 'lysates': [3428], '(lane': [3432, 3436, 3441, 3456, 3460], '1),': [3433], '2),': [3437], '3).': [3442], 'detected': [3445, 3466], 'ectopically': [3446], '(Fig.': [3449, 3562, 3578, 3605, 3778, 3980, 4089, 4117, 4193, 4389, 4398], 'lane': [3451, 4092, 4119], '7)': [3452], '8)': [3457], 'FLAG-PA-PLA1': [3459], '9).': [3461], 'faint': [3463], '125-kDa': [3464], 'lanes': [3470, 4095, 4196, 4201], '8': [3471], '9,': [3473], 'represents': [3476], '1D4,': [3482], 'investigated': [3484], '1B,': [3497, 3563, 3579], 'staining': [3500, 3521, 3598, 3610, 3767], 'pattern': [3501, 3522, 3568, 3658, 3772, 3786], 'observed': [3503, 3524, 3570, 3600, 3638, 3663, 3905, 4101], 'throughout': [3504], 'concentrated': [3509, 3602], '(a,': [3514], 'd,': [3515], 'g).': [3517], 'Essentially': [3518], 'same': [3520], '(see': [3529], '3B,': [3531, 3897], 'b)': [3532], 'recognizes': [3535], '(data': [3537], 'shown).': [3539], 'Double': [3540], 'labeling': [3541, 3634], 'Sec31p,': [3550], 'component,': [3553, 3956], 'a–f).': [3564], 'similar': [3566, 3660, 3790, 3900], 'colocalization': [3567], 'g–i).': [3580], 'On': [3581], 'hand,': [3584], 'p125-positive': [3585], 'limited': [3588], 'overlapping': [3589], 'β-COP-positive': [3591], 'ones.': [3592], 'region,': [3596], 'dot-like': [3603, 3785], '1C,': [3606], 'd),': [3607], 'β-COP': [3609, 3766, 4258], 'closely': [3613], 'connected': [3614], 'ones': [3615], '(e).': [3616], 'Next,': [3617, 3804], 'ultrastructural': [3626], 'level.': [3627], '2,': [3632], 'immunogold': [3633], 'regions': [3640], 'Golgi': [3645, 3650, 3737], 'stacks': [3651], 'including': [3652], 'area.': [3655], 'immunolabeling': [3657], '(39Tang': [3666], 'B.L.': [3667], 'Zhang': [3668], 'Low': [3670], 'D.Y.': [3671], 'Wong': [3672], 'E.T.': [3673], 'Horstmann': [3674], 'Hong': [3676], '13597-13604Abstract': [3683], 'confirmed': [3703], 'ways.': [3706], 'First,': [3707], 'BFA.': [3712], 'inactivate': [3718], 'Arf1,': [3719], 'dissociation': [3724], 'Golgi,': [3729], 'redistribution': [3734], '(40Klausner': [3743], 'R.D.': [3744], 'Donaldon': [3745], 'J.G.': [3746], '1992;': [3752], '116:': [3753], '1071-1080Crossref': [3754], '(1541)': [3757], 'changed': [3768], 'diffuse,': [3775], 'cytosolic': [3776], 'one': [3777], '3A,': [3779], 'e),': [3780], 'retained': [3783], 'd)': [3789], '(b).': [3793], 'Clearly,': [3794], 'still': [3797], 'BFA-treated': [3802], 'constitutive': [3812], 'active': [3813, 3850, 3967, 4225], 'localization.': [3817], 'Because': [3818], 'regulated': [3824], 'GTP/GDP': [3827], 'cycle': [3828], 'constitutively': [3849, 4224], 'form': [3851, 4146], '(Sar1p[H79G])': [3852], 'prevents': [3853], 'uncoating,': [3854], 'containing': [3865, 3953], 'matrix': [3870, 4263], '(19Ward': [3872], '(b),': [3899], '(e),': [3903], 'FLAG-Sar1p[H79G]-expressing': [3910], 'microscopic': [3916], 'together': [3919], 'strongly': [3920], 'suggest': [3921], 'primarily': [3925], 'rather': [3931, 4431], 'than': [3932], 'cis-Golgi.': [3934], 'Recruited': [3937], 'Membranes': [3940], 'Active': [3943], 'Sar1p-dependent': [3944, 3968], 'Manner—Given': [3945], 'present': [3949], 'Sar1p[H79G]-induced': [3951], 'wondered': [3958], 'recruited': [3962], 'manner.': [3969], 'test': [3971], 'this,': [3972], 'vitro': [3976], 'assays': [3979], '4).': [3981, 4204], 'increasing': [3991], 'concentrations': [3992], 'Sar1p[H79G]': [3994], 'under': [3995], 'conditions': [3996], 'support': [3998, 4150], 'assembly': [4000], 'end': [4051], 'incubations,': [4054], 'washed': [4058], 'collected': [4060], 'centrifugation,': [4062], 'assessed': [4072], '1D4.': [4077], 'Activated': [4078], 'enhancement': [4082, 4122], 'association': [4085], '4A,': [4090, 4118], 'compare': [4091, 4195], '1': [4093], '2–5).': [4096], 'minor': [4098], 'signal': [4099], 'when': [4102], 'omitted': [4106], 'incubation,': [4109], 'attesting': [4110], 'specificity': [4113], '6).': [4120], 'dependent': [4130], 'activation.': [4133], 'Incubation': [4134], 'mimics': [4143], 'GDP-bound': [4145], '(Sar1p[T39N])': [4147], 'did': [4148, 4185], '(analyzed': [4153], 'Sec23p),': [4159], '(6Aridor': [4163], 'nor': [4184], 'enhance': [4187], '4B,': [4194], '5': [4197], '6': [4199], '3': [4202], 'biochemical': [4206], 'result': [4207], 'complements': [4208], 'morphological': [4210], 'observation': [4211], 'redistributed': [4215], 'Sec31-enriched': [4217], 'Sar1p.': [4226], 'Overexpression': [4227], 'Causes': [4230], 'Perturbation': [4231], 'Structures': [4234], 'Sites,': [4238], 'cis-Golgi—Our': [4242], 'high': [4251, 4422], 'causes': [4255], 'dispersion': [4256], 'such': [4265], 'p115': [4267], '(41Alvarez': [4268], 'Fujita': [4270], 'Hubbard': [4272], '147:': [4280], '1205-1211Crossref': [4281], '(100)': [4284], 'GM130': [4288], '(42Nakamura': [4289], 'Lowe': [4291], 'Levine': [4293], 'T.P.': [4294], 'Rabouille': [4295], 'Warren': [4297], '89:': [4301], '445-455Abstract': [4302], '(344)': [4310], 'coexist': [4313], 'overexpressed': [4315], 'changes': [4383], 'upon': [4384], '5A).': [4390], 'expressed,': [4392], '5A,': [4399], 'a–c)': [4400], '(d–f),': [4403], 'demonstrating': [4404], 'retains': [4408], 'ability.': [4411], 'should': [4413], 'noted': [4415], 'levels,': [4423], 'dispersed': [4429], 'overex': [4434]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W2030749742', 'counts_by_year': [{'year': 2024, 'cited_by_count': 3}, {'year': 2023, 'cited_by_count': 2}, {'year': 2022, 'cited_by_count': 3}, {'year': 2021, 'cited_by_count': 3}, {'year': 2020, 'cited_by_count': 3}, {'year': 2019, 'cited_by_count': 4}, {'year': 2018, 'cited_by_count': 7}, {'year': 2017, 'cited_by_count': 1}, {'year': 2016, 'cited_by_count': 2}, {'year': 2015, 'cited_by_count': 2}, {'year': 2014, 'cited_by_count': 5}, {'year': 2013, 'cited_by_count': 6}, {'year': 2012, 'cited_by_count': 6}], 'updated_date': '2024-12-11T20:56:44.757524', 'created_date': '2016-06-24'}