p42/44 MAP Kinase-dependent and -independent Signaling Pathways Regulate Caveolin-1 Gene Expression

Name: Work Video:
Duration: 3 min 30 s
Jeffrey A. Engelman; Xiao Lan Zhang; Babak Razani; Richard G. Pestell; Michael P. Lisanti
{'id': 'https://openalex.org/W2030102642', 'doi': 'https://doi.org/10.1074/jbc.274.45.32333', 'title': 'p42/44 MAP Kinase-dependent and -independent Signaling Pathways Regulate Caveolin-1 Gene Expression', 'display_name': 'p42/44 MAP Kinase-dependent and -independent Signaling Pathways Regulate Caveolin-1 Gene Expression', 'publication_year': 1999, 'publication_date': '1999-11-01', 'ids': {'openalex': 'https://openalex.org/W2030102642', 'doi': 'https://doi.org/10.1074/jbc.274.45.32333', 'mag': '2030102642', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/10542274'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.274.45.32333', 'pdf_url': 'http://www.jbc.org/article/S0021925819515629/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S0021925819515629/pdf', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5040093136', 'display_name': 'Jeffrey A. Engelman', 'orcid': 'https://orcid.org/0009-0004-0775-4523'}, 'institutions': [{'id': 'https://openalex.org/I129975664', 'display_name': 'Albert Einstein College of Medicine', 'ror': 'https://ror.org/05cf8a891', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I129975664', 'https://openalex.org/I4210112371']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Jeffrey A. Engelman', 'raw_affiliation_strings': ['Department of Molecular Pharmacology, Albert Einstein Cancer Center, Albert Einstein College of Medicine, Bronx, New York 10461, USA.'], 'affiliations': [{'raw_affiliation_string': 'Department of Molecular Pharmacology, Albert Einstein Cancer Center, Albert Einstein College of Medicine, Bronx, New York 10461, USA.', 'institution_ids': ['https://openalex.org/I129975664']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5109885793', 'display_name': 'Xiao Lan Zhang', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I129975664', 'display_name': 'Albert Einstein College of Medicine', 'ror': 'https://ror.org/05cf8a891', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I129975664', 'https://openalex.org/I4210112371']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Xiao Lan Zhang', 'raw_affiliation_strings': ['From the Department of Molecular Pharmacology and The Albert Einstein Cancer Center, Albert Einstein College of Medicine, Bronx, New York 10461'], 'affiliations': [{'raw_affiliation_string': 'From the Department of Molecular Pharmacology and The Albert Einstein Cancer Center, Albert Einstein College of Medicine, Bronx, New York 10461', 'institution_ids': ['https://openalex.org/I129975664']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5079794322', 'display_name': 'Babak Razani', 'orcid': 'https://orcid.org/0000-0002-7172-9240'}, 'institutions': [{'id': 'https://openalex.org/I129975664', 'display_name': 'Albert Einstein College of Medicine', 'ror': 'https://ror.org/05cf8a891', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I129975664', 'https://openalex.org/I4210112371']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Babak Razani', 'raw_affiliation_strings': ['From the Department of Molecular Pharmacology and The Albert Einstein Cancer Center, Albert Einstein College of Medicine, Bronx, New York 10461'], 'affiliations': [{'raw_affiliation_string': 'From the Department of Molecular Pharmacology and The Albert Einstein Cancer Center, Albert Einstein College of Medicine, Bronx, New York 10461', 'institution_ids': ['https://openalex.org/I129975664']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5016235708', 'display_name': 'Richard G. Pestell', 'orcid': 'https://orcid.org/0000-0003-3244-8777'}, 'institutions': [{'id': 'https://openalex.org/I129975664', 'display_name': 'Albert Einstein College of Medicine', 'ror': 'https://ror.org/05cf8a891', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I129975664', 'https://openalex.org/I4210112371']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Richard G. Pestell', 'raw_affiliation_strings': ['Departments of Developmental & Molecular Biology and Medicine, and the Albert Einstein Cancer Center, Albert Einstein College of Medicine, Bronx, New York 10461'], 'affiliations': [{'raw_affiliation_string': 'Departments of Developmental & Molecular Biology and Medicine, and the Albert Einstein Cancer Center, Albert Einstein College of Medicine, Bronx, New York 10461', 'institution_ids': ['https://openalex.org/I129975664']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5016681558', 'display_name': 'Michael P. Lisanti', 'orcid': 'https://orcid.org/0000-0003-2034-1382'}, 'institutions': [{'id': 'https://openalex.org/I129975664', 'display_name': 'Albert Einstein College of Medicine', 'ror': 'https://ror.org/05cf8a891', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I129975664', 'https://openalex.org/I4210112371']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Michael P. Lisanti', 'raw_affiliation_strings': ['From the Department of Molecular Pharmacology and The Albert Einstein Cancer Center, Albert Einstein College of Medicine, Bronx, New York 10461'], 'affiliations': [{'raw_affiliation_string': 'From the Department of Molecular Pharmacology and The Albert Einstein Cancer Center, Albert Einstein College of Medicine, Bronx, New York 10461', 'institution_ids': ['https://openalex.org/I129975664']}]}], 'institution_assertions': [], 'countries_distinct_count': 1, 'institutions_distinct_count': 1, 'corresponding_author_ids': [], 'corresponding_institution_ids': [], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 3.595, 'has_fulltext': True, 'fulltext_origin': 'ngrams', 'cited_by_count': 167, 'citation_normalized_percentile': {'value': 0.999781, 'is_in_top_1_percent': True, 'is_in_top_10_percent': True}, 'cited_by_percentile_year': {'min': 97, 'max': 98}, 'biblio': {'volume': '274', 'issue': '45', 'first_page': '32333', 'last_page': '32341'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T12793', 'display_name': 'Caveolin-1 and cellular processes', 'score': 1.0, 'subfield': {'id': 'https://openalex.org/subfields/1307', 'display_name': 'Cell Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, 'topics': [{'id': 'https://openalex.org/T12793', 'display_name': 'Caveolin-1 and cellular processes', 'score': 1.0, 'subfield': {'id': 'https://openalex.org/subfields/1307', 'display_name': 'Cell Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T11339', 'display_name': 'Metabolism, Diabetes, and Cancer', 'score': 0.9852, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T10169', 'display_name': 'Protein Kinase Regulation and GTPase Signaling', 'score': 0.924, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/caveolin-1', 'display_name': 'Caveolin 1', 'score': 0.7209039}, {'id': 'https://openalex.org/keywords/caveolin', 'display_name': 'Caveolin', 'score': 0.5172604}, {'id': 'https://openalex.org/keywords/c-raf', 'display_name': 'c-Raf', 'score': 0.44609243}, {'id': 'https://openalex.org/keywords/3t3-cells', 'display_name': '3T3 cells', 'score': 0.4372499}, {'id': 'https://openalex.org/keywords/mapk7', 'display_name': 'MAPK7', 'score': 0.41475928}], 'concepts': [{'id': 'https://openalex.org/C2780870201', 'wikidata': 'https://www.wikidata.org/wiki/Q17855958', 'display_name': 'Caveolin 1', 'level': 2, 'score': 0.7209039}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.53201604}, {'id': 'https://openalex.org/C2779403975', 'wikidata': 'https://www.wikidata.org/wiki/Q24724230', 'display_name': 'Caveolin', 'level': 4, 'score': 0.5172604}, {'id': 'https://openalex.org/C49866891', 'wikidata': 'https://www.wikidata.org/wiki/Q1051872', 'display_name': 'Caveolae', 'level': 3, 'score': 0.5017953}, {'id': 'https://openalex.org/C62478195', 'wikidata': 'https://www.wikidata.org/wiki/Q828130', 'display_name': 'Signal transduction', 'level': 2, 'score': 0.49786282}, {'id': 'https://openalex.org/C153911025', 'wikidata': 'https://www.wikidata.org/wiki/Q7202', 'display_name': 'Molecular biology', 'level': 1, 'score': 0.49739936}, {'id': 'https://openalex.org/C95444343', 'wikidata': 'https://www.wikidata.org/wiki/Q7141', 'display_name': 'Cell biology', 'level': 1, 'score': 0.4853648}, {'id': 'https://openalex.org/C99405784', 'wikidata': 'https://www.wikidata.org/wiki/Q410434', 'display_name': 'c-Raf', 'level': 5, 'score': 0.44609243}, {'id': 'https://openalex.org/C2776746612', 'wikidata': 'https://www.wikidata.org/wiki/Q68153243', 'display_name': '3T3 cells', 'level': 4, 'score': 0.4372499}, {'id': 'https://openalex.org/C97029542', 'wikidata': 'https://www.wikidata.org/wiki/Q281417', 'display_name': 'Protein kinase A', 'level': 3, 'score': 0.43291143}, {'id': 'https://openalex.org/C138227536', 'wikidata': 'https://www.wikidata.org/wiki/Q18030789', 'display_name': 'MAPK7', 'level': 5, 'score': 0.41475928}, {'id': 'https://openalex.org/C184235292', 'wikidata': 'https://www.wikidata.org/wiki/Q421851', 'display_name': 'Kinase', 'level': 2, 'score': 0.41196957}, {'id': 'https://openalex.org/C137361374', 'wikidata': 'https://www.wikidata.org/wiki/Q6714442', 'display_name': 'MAP kinase kinase kinase', 'level': 4, 'score': 0.3870908}, {'id': 'https://openalex.org/C54009773', 'wikidata': 'https://www.wikidata.org/wiki/Q1429031', 'display_name': 'Transfection', 'level': 3, 'score': 0.3604086}, {'id': 'https://openalex.org/C90934575', 'wikidata': 'https://www.wikidata.org/wiki/Q6593810', 'display_name': 'Mitogen-activated protein kinase kinase', 'level': 4, 'score': 0.34877533}, {'id': 'https://openalex.org/C104317684', 'wikidata': 'https://www.wikidata.org/wiki/Q7187', 'display_name': 'Gene', 'level': 2, 'score': 0.28874418}, {'id': 'https://openalex.org/C54355233', 'wikidata': 'https://www.wikidata.org/wiki/Q7162', 'display_name': 'Genetics', 'level': 1, 'score': 0.17707369}], 'mesh': [{'descriptor_ui': 'D022461', 'descriptor_name': 'Caveolins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': True}, {'descriptor_ui': 'D017868', 'descriptor_name': 'Cyclic AMP-Dependent Protein Kinases', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D015536', 'descriptor_name': 'Down-Regulation', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': True}, {'descriptor_ui': 'D005786', 'descriptor_name': 'Gene Expression Regulation', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': True}, {'descriptor_ui': 'D008565', 'descriptor_name': 'Membrane Proteins', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': True}, {'descriptor_ui': 'D019950', 'descriptor_name': 'Mitogen-Activated Protein Kinase 1', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D020928', 'descriptor_name': 'Mitogen-Activated Protein Kinases', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D011401', 'descriptor_name': 'Promoter Regions, Genetic', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': True}, {'descriptor_ui': 'D015398', 'descriptor_name': 'Signal Transduction', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': True}, {'descriptor_ui': 'D016475', 'descriptor_name': '3T3 Cells', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D000818', 'descriptor_name': 'Animals', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D051242', 'descriptor_name': 'Caveolin 1', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002472', 'descriptor_name': 'Cell Transformation, Viral', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D017868', 'descriptor_name': 'Cyclic AMP-Dependent Protein Kinases', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D004789', 'descriptor_name': 'Enzyme Activation', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008565', 'descriptor_name': 'Membrane Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D051379', 'descriptor_name': 'Mice', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D019950', 'descriptor_name': 'Mitogen-Activated Protein Kinase 1', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D048052', 'descriptor_name': 'Mitogen-Activated Protein Kinase 3', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D020928', 'descriptor_name': 'Mitogen-Activated Protein Kinases', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008969', 'descriptor_name': 'Molecular Sequence Data', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D014157', 'descriptor_name': 'Transcription Factors', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D014157', 'descriptor_name': 'Transcription Factors', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}], 'locations_count': 2, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.274.45.32333', 'pdf_url': 'http://www.jbc.org/article/S0021925819515629/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/10542274', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.274.45.32333', 'pdf_url': 'http://www.jbc.org/article/S0021925819515629/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 37, 'referenced_works': ['https://openalex.org/W1037454573', 'https://openalex.org/W1588998681', 'https://openalex.org/W1878126797', 'https://openalex.org/W1966949741', 'https://openalex.org/W1971571944', 'https://openalex.org/W1971915141', 'https://openalex.org/W1978279440', 'https://openalex.org/W1987270140', 'https://openalex.org/W1993803695', 'https://openalex.org/W1995150314', 'https://openalex.org/W1996462307', 'https://openalex.org/W1997726565', 'https://openalex.org/W1998143976', 'https://openalex.org/W1999743098', 'https://openalex.org/W2009180805', 'https://openalex.org/W2015661133', 'https://openalex.org/W2016730049', 'https://openalex.org/W2027691597', 'https://openalex.org/W2032379027', 'https://openalex.org/W2044053783', 'https://openalex.org/W2046053482', 'https://openalex.org/W2046774437', 'https://openalex.org/W2054710626', 'https://openalex.org/W2060416249', 'https://openalex.org/W2075575317', 'https://openalex.org/W2075796682', 'https://openalex.org/W2080124363', 'https://openalex.org/W2088272992', 'https://openalex.org/W2092437783', 'https://openalex.org/W2094222567', 'https://openalex.org/W2095480781', 'https://openalex.org/W2110453766', 'https://openalex.org/W2139345025', 'https://openalex.org/W2405185874', 'https://openalex.org/W311062589', 'https://openalex.org/W53564630', 'https://openalex.org/W85001041'], 'related_works': ['https://openalex.org/W4239908869', 'https://openalex.org/W3043683239', 'https://openalex.org/W2165467938', 'https://openalex.org/W2159413140', 'https://openalex.org/W2139345025', 'https://openalex.org/W2091701987', 'https://openalex.org/W2055781207', 'https://openalex.org/W2015376902', 'https://openalex.org/W1994359425', 'https://openalex.org/W1976350481'], 'abstract_inverted_index': {'Caveolin-1': [0, 10, 268, 278], 'is': [1, 48, 67, 144, 151, 191, 218, 240, 269, 316, 335, 412, 419, 459, 486, 508, 564, 881, 1382, 1494, 1518, 1678, 3828, 3939, 3996, 4001, 4063, 4091, 4102, 4134, 4145, 4254, 4353], 'a': [2, 100, 168, 270, 368, 436, 611, 650, 713, 756, 884, 1030, 1210, 1216, 1389, 1403, 1510, 1555, 1568, 1594, 1639, 2061, 2069, 2522, 2584, 2590, 2599, 2632, 2703, 3090, 3106, 3139, 3162, 3274, 3340, 3349, 3353, 3744, 3780, 4026, 4247], 'principal': [3, 271], 'component': [4, 272], 'of': [5, 53, 61, 69, 73, 83, 92, 114, 167, 170, 196, 234, 273, 321, 329, 337, 341, 351, 360, 382, 435, 438, 464, 502, 560, 625, 643, 688, 699, 707, 759, 763, 769, 816, 876, 888, 996, 1201, 1224, 1388, 1398, 1407, 1501, 1550, 1558, 1621, 1641, 1769, 1783, 1807, 1877, 1999, 2013, 2063, 2072, 2087, 2226, 2285, 2317, 2328, 2534, 2538, 2577, 2582, 2606, 2610, 2622, 2626, 2639, 2644, 2652, 2668, 2675, 2682, 2685, 2693, 2711, 2908, 2922, 2962, 2982, 2987, 3044, 3089, 3135, 3141, 3241, 3268, 3286, 3325, 3342, 3371, 3385, 3413, 3572, 3621, 3640, 3680, 3688, 3725, 3775, 3833, 3856, 3862, 3869, 3935, 4007, 4022, 4028, 4061, 4066, 4075, 4078, 4096, 4105, 4111, 4121, 4139, 4150, 4240, 4259, 4306, 4347, 4358, 4366], 'caveolae': [6, 274, 1648, 1788, 1882], 'membranes': [7, 275], 'in': [8, 17, 21, 179, 224, 276, 285, 289, 447, 492, 960, 1023, 1338, 1349, 1395, 1504, 1507, 1633, 1681, 1774, 1793, 1809, 1822, 2057, 2359, 2364, 2598, 2697, 2728, 2892, 2912, 2928, 2947, 2959, 2977, 2979, 3022, 3041, 3119, 3132, 3316, 3693, 3748, 3876, 3942, 4025, 4044, 4126, 4178, 4264, 4310, 4332, 4350], 'vivo.': [9, 277], 'mRNA': [11, 279, 1625, 3434, 3871, 4172], 'and': [12, 31, 79, 116, 148, 226, 247, 260, 280, 299, 347, 384, 416, 494, 515, 528, 566, 580, 629, 657, 702, 803, 805, 919, 1018, 1250, 1341, 1400, 1412, 1542, 1626, 1647, 1785, 1799, 1814, 1881, 1911, 1953, 2042, 2055, 2066, 2076, 2082, 2089, 2095, 2100, 2236, 2292, 2332, 2354, 2372, 2517, 2526, 2589, 2628, 2649, 2687, 2723, 2750, 2808, 2945, 3030, 3127, 3179, 3196, 3225, 3337, 3352, 3360, 3377, 3402, 3421, 3440, 3529, 3585, 3595, 3605, 3608, 3615, 3713, 3730, 3759, 3823, 3872, 3878, 4053, 4085, 4124, 4128, 4180, 4314, 4368], 'protein': [13, 63, 109, 235, 245, 281, 331, 377, 503, 513, 537, 539, 808, 910, 1627, 1677, 1879, 2044, 2634, 2659, 3194, 3873, 3938, 4024, 4040, 4141, 4262, 4309, 4329], 'expression': [14, 47, 64, 178, 246, 282, 315, 332, 446, 514, 1628, 1762, 1806, 1880, 2785, 3934, 3991, 4000, 4021, 4041, 4110, 4120, 4142, 4258, 4305, 4330, 4349], 'are': [15, 283, 1021, 1535, 1629, 1649, 3105, 3874, 4174, 4339], 'down-regulated': [16, 284, 1680, 3875, 4043, 4177], 'NIH': [18, 96, 119, 182, 286, 364, 387, 450, 1634, 1811, 2097, 2103, 2197, 2238, 2270, 2302, 2352, 3881, 4031, 4045, 4131, 4183, 4243, 4316, 4334, 4371], '3T3': [19, 97, 120, 183, 287, 365, 388, 451, 1635, 1812, 2098, 2104, 2198, 2239, 2271, 2303, 2353, 2883, 3882, 4032, 4046, 4132, 4184, 4244, 4317, 4335, 4372], 'cells': [20, 98, 121, 288, 366, 389, 1636, 1654, 1771, 1778, 1813, 2099, 2105, 2199, 2240, 2272, 2304, 2321, 2356, 2881, 2884, 2887, 2938, 2974, 3038, 3093, 3104, 3160, 3883, 3944, 4047, 4133, 4185, 4245, 4266, 4352, 4373], 'response': [22, 290, 1682, 3023], 'to': [23, 216, 242, 291, 484, 510, 810, 1121, 1328, 1496, 1514, 1553, 1683, 1772, 1887, 2657, 2706, 2991, 3024, 3181, 3192, 3198, 3303, 3362, 3405, 3423, 3830, 3849, 4148, 4256, 4355], 'transformation': [24, 292, 1599, 1685, 4090], 'by': [25, 51, 65, 194, 221, 293, 319, 333, 462, 489, 568, 1116, 1638, 2307, 2544, 3175, 3207, 3310, 3322, 3446, 3496, 3500, 3551, 3637, 3763, 3772, 3853, 3984, 4004, 4049, 4093, 4115, 4143, 4156], 'activated': [26, 84, 294, 352, 1642, 3284, 3306, 4117], 'oncogenes,': [27, 295], 'such': [28, 296], 'as': [29, 297, 755, 1344, 1346, 1538, 1544, 1567, 2107, 2334, 2753, 2814, 2888, 2995, 3052, 3205, 3320, 3456, 3577, 4154], 'H-Ras(G12V)': [30, 180, 298, 448, 1017, 3877], 'v-Abl.': [32, 300], 'The': [33, 165, 301, 433, 557, 1026, 1199, 1892, 2250, 2573, 2730, 2783, 2973, 3437, 3561, 3755, 3765, 3843, 3982, 4109, 4119], 'mechanisms': [34, 302, 1893], 'governing': [35, 303], 'this': [36, 304, 689, 897, 1515, 1622, 3298, 4015], 'down-regulation': [37, 305, 1876, 1897, 4060, 4149, 4346], 'event': [38, 306], 'remain': [39, 307, 1898], 'unknown.': [40, 308, 1900, 3993], 'Here,': [41, 309, 1901], 'we': [42, 207, 251, 310, 475, 519, 748, 1204, 1902, 2108, 2630, 2754, 3214, 3272, 4018, 4167], 'show': [43, 186, 231, 311, 454, 499], 'that': [44, 143, 150, 187, 210, 232, 262, 312, 411, 418, 455, 478, 500, 530, 619, 640, 751, 873, 993, 1020, 1035, 1529, 1804, 1875, 1894, 1913, 2635, 3111, 3278, 3297, 3568, 3827, 3997, 4038, 4058, 4101, 4170, 4238, 4298, 4344], 'caveolin-1': [45, 62, 108, 128, 140, 171, 188, 212, 244, 265, 313, 330, 376, 396, 408, 439, 456, 480, 512, 533, 691, 877, 899, 1551, 1624, 1761, 1784, 1808, 1878, 1896, 1917, 2514, 2658, 2686, 3433, 3556, 3870, 3990, 3998, 4023, 4039, 4062, 4123, 4140, 4152, 4171, 4261, 4308, 4328, 4348, 4380], 'gene': [46, 266, 314, 534, 3999], 'directly': [49, 317, 4103], 'regulated': [50, 318, 567, 655, 1007, 4003], 'activation': [52, 233, 320, 501, 656, 995, 3266, 4006, 4357], 'the': [54, 71, 81, 160, 197, 211, 322, 339, 349, 428, 465, 479, 623, 634, 696, 704, 718, 767, 811, 874, 891, 1010, 1118, 1202, 1222, 1225, 1379, 1385, 1396, 1413, 1491, 1498, 1519, 1531, 1559, 1767, 1780, 1790, 1889, 1997, 2010, 2224, 2282, 2296, 2313, 2325, 2496, 2502, 2539, 2558, 2612, 2619, 2641, 2646, 2650, 2653, 2665, 2669, 2683, 2694, 2698, 2708, 2712, 2788, 2796, 2898, 2937, 2960, 3025, 3037, 3042, 3087, 3208, 3259, 3265, 3283, 3323, 3378, 3406, 3431, 3497, 3536, 3547, 3554, 3573, 3638, 3857, 3863, 3936, 4008, 4020, 4067, 4076, 4097, 4151, 4260, 4304, 4307, 4342, 4345, 4359], 'Ras-p42/44': [55, 323, 4009], 'MAP': [56, 146, 153, 162, 199, 258, 324, 414, 421, 430, 467, 526, 1909, 2031, 3027, 3270, 3308, 4010, 4361], 'kinase': [57, 200, 236, 259, 325, 468, 504, 527, 538, 540, 576, 705, 711, 911, 1404, 1540, 3028, 3309, 4011, 4099, 4362], 'cascade.': [58, 201, 326, 469, 4012, 4363], 'Down': [59, 327], 'regulation': [60, 328], 'Ras': [66, 85, 93, 334, 353, 361, 4079, 4106], 'independent': [68, 336, 4065, 4074], '(i)': [70, 338, 4064], 'type': [72, 340, 4068, 4077], 'activating': [74, 342, 1014, 4069], 'mutation': [75, 343, 4070], '(G12V': [76, 344, 4071], 'versus': [77, 88, 345, 356, 4083], 'Q61L)': [78, 346], '(ii)': [80, 348, 4073], 'form': [82, 350, 800, 3285], 'transfected': [86, 354, 2903, 4080], '(H-Ras': [87, 355], 'K-Rasversus': [89, 357], 'N-Ras).': [90, 358], 'Treatment': [91, 359], 'or': [94, 362, 614, 1002, 1631, 2885, 2919, 2967, 4389], 'Raf-transformed': [95, 363], 'with': [99, 122, 367, 390, 570, 878, 901, 1009, 1533, 1766, 2243, 2275, 2370, 2664, 2741, 2904, 2942, 3034, 3189, 3219, 3367, 3419, 3427, 3488, 3583, 3593, 3603, 3613, 3627, 3674, 3685, 4164, 4246, 4300, 4341, 4374], 'well': [101, 369, 1031, 1211, 1345, 4248], 'characterized': [102, 370, 1212, 4249], 'MEK': [103, 371, 4250], 'inhibitor': [104, 372, 1523, 2008, 4251], '(PD': [105, 373, 4252], '98059)': [106, 374, 4253], 'restores': [107, 375, 4303], 'expression.': [110, 129, 267, 378, 397, 535, 4381], 'In': [111, 379, 686, 986, 1375, 1619, 1759, 3932, 4162, 4319], 'contrast,': [112, 380, 3933, 4320], 'treatment': [113, 381, 4239, 4299, 4365], 'v-Src': [115, 383, 1569, 4129, 4144, 4367], 'v-Abl': [117, 385, 3879, 4127, 4181, 4369], 'transformed': [118, 181, 386, 449, 1560, 1637, 1653, 1810, 1890, 3880, 4048, 4130, 4182, 4370], 'PD': [123, 391, 2049, 2965, 4301, 4321, 4375], '98059': [124, 392, 2050, 2966, 4302, 4322, 4376], 'does': [125, 393, 3116], 'not': [126, 394, 1679, 3117, 4378], 'restore': [127, 395, 4257, 4379], 'Thus,': [130, 250, 398, 518, 747, 1590, 3860, 4382], 'there': [131, 399, 4383], 'must': [132, 400, 4384], 'be': [133, 401, 1554, 1885, 3301, 3850, 4385], 'at': [134, 402, 2060, 2068, 2084, 2263, 2281, 2295, 2312, 2679, 3752, 3851, 4386], 'least': [135, 403, 4387], 'two': [136, 254, 404, 522, 1905, 2930, 4388], 'pathways': [137, 256, 405, 524, 663, 1907], 'for': [138, 406, 653, 1525, 2718, 2910, 2926, 2951, 3049, 3125, 3339, 3430, 3546, 3719, 3732, 4136], 'down-regulating': [139, 407], 'expression:': [141, 409], 'one': [142, 410, 2915], 'p42/44': [145, 152, 161, 198, 413, 420, 429, 466, 3026, 3269, 3307, 4360], 'kinase-dependent': [147, 163, 415, 431], 'another': [149, 417, 2688, 2952], 'kinase-independent.': [154, 422], 'We': [155, 185, 229, 423, 453, 497, 628, 2672, 2701, 4235], 'focused': [156, 424], 'our': [157, 425, 1797, 3216], 'efforts': [158, 426], 'on': [159, 427, 3717, 3737, 3743, 4327], 'pathway.': [164, 432], 'activity': [166, 190, 434, 458, 698, 706, 1500, 3021], 'panel': [169, 437], 'promoter': [172, 189, 213, 248, 440, 457, 481, 516, 1918, 2684, 3020, 3574], 'constructs': [173, 441], 'was': [174, 442, 1114, 1206, 1564, 2051, 2495, 2519, 2542, 2548, 2562, 2616, 2733, 2793, 2902, 2917, 2957, 2989, 3245, 3400, 3417, 3581, 3591, 3601, 3611, 3625, 3635, 3683, 3728, 3770, 3847, 4042, 4113], 'evaluated': [175, 443, 1208], 'using': [176, 444, 1117, 1209, 3235, 3247, 3258, 3348, 3393, 3535, 3553, 3779, 3817], 'transient': [177, 445], 'cells.': [184, 228, 452, 496, 3171, 4033, 4318, 4336], 'up-regulated': [192, 460], '∼5-fold': [193, 461], 'inhibition': [195, 463], 'Using': [202, 470], 'electrophoretic': [203, 471, 553], 'mobility': [204, 472, 554, 3451], 'shift': [205, 473, 555, 3452], 'assays': [206, 474, 2810, 3082, 3453], 'provide': [208, 476, 649], 'evidence': [209, 477, 617], '(from': [214, 482], '−156': [215, 483], '−561)': [217, 485], 'differentially': [219, 487], 'bound': [220, 488], 'transcription': [222, 490], 'factors': [223, 491], 'normal': [225, 493, 2101, 3113, 4333], 'H-Ras(G12V)-transformed': [227, 495], 'also': [230, 498, 4087, 4146, 4175], 'A': [237, 505, 541, 577, 2507, 3580, 4036], '(PKA)': [238, 506], 'signaling': [239, 255, 507, 523, 562, 612, 636, 646, 662, 764, 879, 998, 1391, 1906], 'sufficient': [241, 509, 1495, 4255], 'down-regulate': [243, 264, 511, 532, 1916, 3989], 'activity.': [249, 517, 1919], 'have': [252, 520, 632, 749, 871, 1325, 1335, 1802, 1903, 3161, 4168], 'identified': [253, 521, 1115, 1205, 1566, 1904], '(Ras-p42/44': [257, 525, 1908], 'PKA)': [261, 529, 1912], 'transcriptionally': [263, 531, 1915], 'mitogen-actived': [536], 'isobutylmethylxanthine': [542], 'isopropyl-1-thio-β-d-galactopyranoside': [543], 'Chinese': [544], 'hamster': [545], 'ovary': [546], 'kilobase(s)': [547], 'polymerase': [548], 'chain': [549], 'reaction': [550], 'base': [551], 'pair(s)': [552], 'assay': [556], 'subcellular': [558], 'distribution': [559], 'several': [561, 1037], 'molecules': [563, 647, 765, 880, 999], 'restricted': [565], 'association': [569], 'scaffolding': [571, 626, 1492], 'proteins': [572], '(Ste5p,': [573], 'AKAPs': [574], '(protein': [575], 'anchor': [578, 3819], 'proteins),': [579], '14-3-3)': [581], '(1Rubin': [582], 'C.S.': [583], 'Biochim.': [584], 'Biophys.': [585], 'Acta.': [586], '1994;': [587, 675, 3008], '1224:': [588], '467-479PubMed': [589], 'Google': [590, 608, 684, 745, 797, 845, 867, 957, 984, 1067, 1088, 1110, 1154, 1175, 1197, 1248, 1278, 1299, 1321, 1373, 1444, 1465, 1487, 1588, 1617, 1674, 1720, 1757, 1851, 1870, 1951, 1994, 2145, 2166, 2194, 2221, 2350, 2409, 2430, 2458, 2479, 2493, 2781, 2851, 2877, 3015, 3079, 3156, 3469, 3486, 3520, 3655, 3672, 3810, 3903, 3930, 3980, 4205, 4233, 4293], 'Scholar,': [591, 846, 1068, 1089, 1155, 1176, 1279, 1300, 1445, 1466, 1721, 1852, 2146, 2167, 2410, 2431, 2480, 2852, 3470, 3656, 4206], '2Faux': [592], 'M.C.': [593, 829, 1930], 'Scott': [594], 'J.D.': [595], 'Cell.': [596, 2342, 3148, 3463, 3649], '1996;': [597, 856, 1237], '85:': [598], '9-12Abstract': [599], 'Full': [600, 602, 678, 737, 739, 789, 791, 859, 861, 949, 951, 976, 978, 1059, 1061, 1102, 1104, 1146, 1148, 1189, 1191, 1240, 1242, 1270, 1272, 1313, 1315, 1365, 1367, 1436, 1438, 1479, 1481, 1712, 1714, 1749, 1751, 1843, 1845, 1943, 1945, 1986, 1988, 2137, 2139, 2186, 2188, 2401, 2403, 2450, 2452, 2475, 2843, 2845, 3011, 3922, 3924, 3972, 3974, 4225, 4227, 4285, 4287], 'Text': [601, 603, 679, 738, 740, 790, 792, 860, 862, 950, 952, 977, 979, 1060, 1062, 1103, 1105, 1147, 1149, 1190, 1192, 1241, 1243, 1271, 1273, 1314, 1316, 1366, 1368, 1437, 1439, 1480, 1482, 1713, 1715, 1750, 1752, 1844, 1846, 1944, 1946, 1987, 1989, 2138, 2140, 2187, 2189, 2402, 2404, 2451, 2453, 2476, 2844, 2846, 3012, 3923, 3925, 3973, 3975, 4226, 4228, 4286, 4288], 'PDF': [604, 680, 741, 793, 863, 953, 980, 1063, 1106, 1150, 1193, 1244, 1274, 1317, 1369, 1440, 1483, 1716, 1753, 1847, 1947, 1990, 2141, 2190, 2405, 2454, 2477, 2847, 3013, 3926, 3976, 4229, 4289], 'PubMed': [605, 681, 742, 794, 842, 864, 954, 981, 1064, 1085, 1107, 1151, 1172, 1194, 1245, 1275, 1296, 1318, 1370, 1441, 1462, 1484, 1585, 1614, 1671, 1717, 1754, 1848, 1867, 1948, 1991, 2142, 2163, 2191, 2218, 2347, 2406, 2427, 2455, 2478, 2778, 2848, 2874, 3014, 3076, 3153, 3468, 3483, 3517, 3654, 3669, 3807, 3900, 3927, 3977, 4202, 4230, 4290], 'Scopus': [606, 682, 743, 795, 843, 865, 955, 982, 1065, 1086, 1108, 1152, 1173, 1195, 1246, 1276, 1297, 1319, 1371, 1442, 1463, 1485, 1586, 1615, 1672, 1718, 1755, 1849, 1868, 1949, 1992, 2143, 2164, 2192, 2219, 2348, 2407, 2428, 2456, 2779, 2849, 2875, 3077, 3154, 3484, 3518, 3670, 3808, 3901, 3928, 3978, 4203, 4231, 4291], '(221)': [607], 'Scholar),': [609, 1322, 3487, 3673], 'forming': [610], 'pathway': [613, 4100], 'module.': [615], 'Accumulating': [616], 'suggests': [618], 'caveolins': [620, 1534], 'possesses': [621], 'all': [622, 1376], 'qualities': [624], 'proteins.': [627, 1331], 'other': [630, 1329, 1800, 4029], 'investigators': [631, 1801], 'proposed': [633], '"caveolae': [635], 'hypothesis,"': [637], 'which': [638, 2501, 2737, 2913, 2929, 2988, 3985], 'states': [639], 'caveolar': [641], 'localization': [642], 'certain': [644], 'inactive': [645], 'could': [648], 'compartmental': [651], 'basis': [652], 'their': [654, 1820], 'explain': [658], 'cross-talk': [659], 'between': [660], 'different': [661, 761], '(3Lisanti': [664], 'M.P.': [665, 730, 782, 831, 852, 942, 969, 1052, 1078, 1095, 1139, 1165, 1182, 1233, 1263, 1289, 1306, 1358, 1429, 1455, 1472, 1660, 1705, 1742, 1836, 1936, 1979, 2130, 2152, 2179, 2394, 2416, 2443, 2772, 2836, 2868, 3070, 3889, 3915, 3965, 4191, 4218, 4278], 'Scherer': [666, 820, 966, 1075, 1162, 1286, 1355, 1452], 'P.': [667, 934, 1697, 1740, 1858, 1977, 2122, 2386, 2828, 3506, 3963], 'Tang': [668, 822, 1927], 'Z.-L.': [669, 823, 1928], 'Sargiacomo': [670, 1092, 1179, 1303, 1469, 1931], 'M.': [671, 819, 932, 1093, 1180, 1304, 1470, 1695, 1932, 2120, 2384, 2826, 3459, 3645], 'Trends': [672, 1079, 1166, 1290, 1456], 'Cell': [673], 'Biol.': [674, 732, 784, 854, 944, 971, 1054, 1097, 1141, 1184, 1235, 1265, 1308, 1360, 1431, 1474, 1707, 1744, 1838, 1938, 1981, 2132, 2181, 2396, 2445, 2470, 2838, 3006, 3464, 3650, 3917, 3967, 4220, 4280], '4:': [676], '231-235Abstract': [677], '(590)': [683], 'Scholar).': [685, 746, 798, 868, 985, 1111, 1198, 1374, 1488, 1589, 1618, 1758, 1871, 2195, 2351, 2459, 2782, 2878, 3016, 3080, 3157, 3521, 3811, 3931, 3981, 4234, 4294], 'support': [687, 1620], 'idea,': [690], 'binding': [692, 3694], 'can': [693, 1914, 3300], 'functionally': [694], 'suppress': [695], 'GTPase': [697], 'heterotrimeric': [700], 'G-proteins': [701], 'inhibit': [703, 1497], 'Src': [708, 906, 1003], 'family': [709, 907, 1004], 'tyrosine': [710, 908, 1340, 1399], 'through': [712, 766, 3086], 'common': [714, 1556], 'caveolin': [715, 752, 817, 1516, 1563, 1591, 2503], 'domain,': [716, 898], 'termed': [717, 890], 'caveolin-scaffolding': [719, 892, 1011, 1027, 1119, 1226], 'domain': [720, 893, 1028, 1120, 1227, 1387, 1405, 1493, 1517], '(4Couet': [721, 773, 1043, 1130, 1254, 1420], 'J.': [722, 731, 774, 783, 850, 853, 943, 970, 1044, 1053, 1070, 1091, 1096, 1131, 1140, 1157, 1178, 1183, 1231, 1234, 1255, 1264, 1281, 1302, 1307, 1359, 1421, 1430, 1447, 1468, 1473, 1706, 1733, 1743, 1837, 1937, 1970, 1980, 2131, 2180, 2248, 2341, 2395, 2444, 2469, 2837, 3005, 3147, 3916, 3956, 3966, 4219, 4279], 'Li': [723, 775, 1045, 1071, 1132, 1158, 1256, 1282, 1422, 1448], 'S.': [724, 776, 837, 848, 1046, 1072, 1133, 1159, 1229, 1257, 1283, 1423, 1449, 1580, 1609, 1666, 1830, 2158, 2173, 2213, 2422, 2437, 3802, 3895, 3909, 4197, 4212, 4272], 'Okamoto': [725, 777, 1047, 1073, 1134, 1160, 1258, 1284, 1424, 1450, 1833, 2176, 2440, 2767, 2863, 3065, 3912, 4215, 4275], 'T.': [726, 728, 778, 780, 963, 1048, 1050, 1074, 1135, 1137, 1161, 1259, 1261, 1285, 1352, 1425, 1427, 1451, 1834, 2177, 2441, 2766, 2768, 2862, 2864, 3064, 3066, 3792, 3913, 4216, 4276], 'Ikezu': [727, 779, 1049, 1136, 1260, 1426, 2765, 2861, 3063], 'Lisanti': [729, 781, 830, 851, 941, 968, 1051, 1077, 1094, 1138, 1164, 1181, 1232, 1262, 1288, 1305, 1357, 1428, 1454, 1471, 1659, 1704, 1741, 1835, 1935, 1978, 2129, 2151, 2178, 2393, 2415, 2442, 2771, 2835, 2867, 3069, 3888, 3914, 3964, 4190, 4217, 4277], 'Chem.': [733, 785, 855, 945, 972, 1055, 1098, 1142, 1185, 1236, 1266, 1309, 1361, 1432, 1475, 1708, 1745, 1839, 1939, 1982, 2133, 2182, 2397, 2446, 2471, 2839, 3007, 3918, 3968, 4221, 4281], '1997;': [734, 786, 1056, 1082, 1099, 1143, 1169, 1186, 1267, 1293, 1310, 1433, 1459, 1476, 1746, 1840, 1983, 2183, 2447, 3919, 3969, 4222, 4282], '272:': [735, 787, 1057, 1100, 1144, 1187, 1268, 1311, 1434, 1477, 1747, 1841, 1984, 2184, 2448, 3920, 3970, 4223, 4283], '6525-6533Abstract': [736, 788, 1058, 1145, 1269, 1435], '(807)': [744, 796, 1066, 1153, 1277, 1443], 'suggested': [750, 3321], 'may': [753, 1592, 1884], 'function': [754], 'negative': [757], 'regulator': [758], 'many': [760, 987, 1508], 'classes': [762], 'recognition': [768], 'specific': [770], 'caveolin-binding': [771, 1033, 1213, 1251, 1333, 1380, 1414], 'motifs': [772, 1253, 1334], 'Caveolins': [799], 'multivalent': [801], 'homo-': [802], 'heter-oligomers': [804], 'each': [806, 2923], 'caveolin-interacting': [807, 1330], 'binds': [809], 'same': [812], 'cytosolic': [813], 'membrane-proximal': [814], 'region': [815, 887, 3865], '(5Sargiacomo': [818], 'P.E.': [821, 967, 1356, 1723, 1926, 1960, 3946], 'Kubler': [824], 'E.': [825, 1738, 1975, 3504, 3961], 'Song': [826, 1831, 2174, 2438, 3910, 4213, 4273], 'K.S.': [827, 1832, 2175, 2439, 3911, 4214, 4274], 'Sanders': [828], 'Proc.': [832, 1575, 1604, 1661, 2153, 2208, 2417, 3797, 3890, 4192], 'Natl.': [833, 1576, 1605, 1662, 2154, 2209, 2418, 3798, 3891, 4193], 'Acad.': [834, 1577, 1606, 1663, 2155, 2210, 2419, 3799, 3892, 4194], 'Sci.': [835, 1578, 1607, 1664, 2156, 2211, 2420, 3800, 3893, 4195], 'U.': [836, 1579, 1608, 1665, 2157, 2212, 2421, 3801, 3894, 4196], 'A.': [838, 928, 965, 1354, 1581, 1610, 1667, 1691, 2116, 2159, 2203, 2207, 2214, 2380, 2423, 2762, 2822, 2858, 3000, 3060, 3803, 3896, 4198], '1995;': [839, 1668, 1940, 2160, 2424, 3897, 4199], '92:': [840, 1669, 2161, 2425, 3898, 4200], '9407-9411Crossref': [841], '(478)': [844], '6Li': [847], 'Couet': [849, 1230, 1732, 1969, 3955], '271:': [857, 1238], '29182-29190Abstract': [858, 1239], '(674)': [866, 1247], 'Domain-mapping': [869], 'studies': [870], 'revealed': [872], 'interaction': [875, 1008, 1532], 'mediated': [882, 4092], 'via': [883, 1490, 2259, 2288], 'membrane': [885], 'proximal': [886], 'caveolin,': [889], '(residues': [894], '82–101).': [895], 'Through': [896], 'interacts': [900], 'G-protein': [902, 1217], 'α': [903, 1218, 2790], 'subunits,': [904], 'H-Ras,': [905, 1001], 'kinases,': [909, 1343, 1402], 'C': [912, 3600], 'isoforms,': [913], 'epidermal': [914, 2746], 'growth': [915, 1821, 2747, 3108, 3130], 'factor': [916, 2748], 'receptor,': [917, 2749], 'Neu,': [918], 'eNOS': [920, 1347], '(see': [921], 'Ref.': [922, 961, 1350], '7Engelman': [923], 'J.A.': [924, 1687, 1729, 1826, 1966, 2112, 2169, 2376, 2433, 2758, 2818, 2854, 3056, 3905, 3952, 4208, 4268], 'Lee': [925, 1688, 2113, 2377, 2819], 'R.J.': [926, 1689, 2114, 2378, 2820], 'Karnezis': [927, 1690, 2115, 2379, 2821], 'Bearss': [929, 1692, 2117, 2381, 2823], 'D.J.': [930, 1693, 2118, 2382, 2824], 'Webster': [931, 1694, 2119, 2383, 2825], 'Siegel': [933, 1696, 2121, 2385, 2827], 'Muller': [935, 1698, 2123, 2387, 2829, 3507], 'W.J.': [936, 1699, 2124, 2388, 2830], 'Windle': [937, 1700, 2125, 2389, 2831], 'J.J.': [938, 1701, 2126, 2390, 2832], 'Pestell': [939, 1702, 2127, 2391, 2833], 'R.G.': [940, 1703, 2128, 2392, 2834, 2998], '1998;': [946, 973, 1362, 1709, 1864, 2134, 2398, 2775, 2840, 2871, 3073], '273:': [947, 974, 1363, 1710, 2135, 2399, 2841], '20448-20455Abstract': [948, 1711, 2136, 2400, 2842], '(191)': [956, 1719, 2144, 2408, 2850], 'Scholar;': [958], 'reviewed': [959], '8Okamoto': [962, 1351], 'Schlegel': [964, 1353], '5419-5422Abstract': [975, 1364], '(1345)': [983, 1372], 'cases,': [988, 1509], 'it': [989], 'has': [990, 3112, 3279, 3293, 4323], 'been': [991, 1326, 1336, 2739, 3280, 3295], 'shown': [992, 3296, 4135, 4169], 'mutational': [994], 'these': [997, 1323, 1502, 1526, 1652, 1770, 3159, 3943, 3986, 4116, 4165, 4265, 4351], '(G-proteins,': [1000], 'kinases)': [1005], 'prevents': [1006], 'domain.': [1012], 'These': [1013, 1872, 3081, 4055, 4337], 'mutations': [1015], 'include': [1016], 'Gαs(Q227L)': [1019], 'found': [1022], 'human': [1024], 'cancers.': [1025], 'recognizes': [1029], 'defined': [1032], 'motif': [1034, 1113, 1203, 1381, 1415], 'includes': [1036], 'crucial': [1038], 'aromatic': [1039], 'amino': [1040], 'acid': [1041], 'residues': [1042], '9Couet': [1069, 1156, 1280, 1446], 'P.S.': [1076, 1163, 1287, 1453], 'Cardiovasc.': [1080, 1167, 1291, 1457], 'Med.': [1081, 1168, 1292, 1458], '7:': [1083, 1170, 1294, 1460, 2491], '103-110Crossref': [1084, 1171, 1295, 1461], '(111)': [1087, 1174, 1298, 1464], '10Couet': [1090, 1177, 1301, 1467], '30429-30438Abstract': [1101, 1188, 1312, 1478], '(546)': [1109, 1196, 1320, 1486], 'This': [1112, 2546, 2715, 2955], 'select': [1122], 'random': [1123], 'peptide': [1124, 1512, 1522], 'ligands': [1125], 'from': [1126, 1651, 2053, 2080, 2245, 2277, 2521, 2569, 2587, 2593, 2795, 3525, 3821], 'phage': [1127], 'display': [1128], 'libraries': [1129], 'relevance': [1200], 'stringently': [1207], 'protein,': [1214], 'namely': [1215], 'subunit': [1219], '(Gαi2).': [1220], 'Since': [1221], 'identification': [1223], '(6Li': [1228], 'Scholar)': [1249, 2222, 2494], 'sequence': [1252, 2536, 2660, 3861], 'observations': [1324], 'extended': [1327], 'Functional': [1332], 'deduced': [1337], 'both': [1339, 3220, 4122], 'serine/threonine': [1342, 1401], '(reviewed': [1348], 'cases': [1377], 'examined,': [1378], 'located': [1383, 2689], 'within': [1384, 1417], 'catalytic': [1386, 2791], 'given': [1390], 'molecule.': [1392], 'For': [1393, 2580, 2608, 2624, 3017, 3200], 'example,': [1394], 'case': [1397], 'consists': [1406], '11': [1408], 'conserved': [1409], 'subdomains': [1410], '(I-XI),': [1411], 'occurs': [1416, 4088], 'subdomain': [1418], 'IX': [1419], 'Caveolin-binding': [1489], 'enzymatic': [1499], 'kinases': [1503], 'vitro.': [1505], 'Indeed,': [1506], 'synthetic': [1511], 'corresponding': [1513], 'most': [1520], 'potent': [1521], 'known': [1524], 'enzymes.': [1527], 'Agents': [1528], 'mimic': [1530], 'potentially': [1536], 'useful': [1537], 'general': [1539], 'inhibitors,': [1541], 'possibly': [1543], 'anti-tumor': [1545], 'drugs.': [1546], 'Modification': [1547], 'and/or': [1548], 'inactivation': [1549], 'appears': [1552], 'feature': [1557], 'phenotype.': [1561, 1891], 'Historically,': [1562], 'first': [1565, 2642, 2647], 'substrate': [1570], '(11Glenney': [1571, 1600], 'J.R.': [1572, 1601], 'Soppet': [1573, 1602], 'D.': [1574, 1603, 1658, 1727, 1964, 2150, 2309, 2414, 3476, 3662, 3887, 3950, 4189], '1992;': [1582, 1611, 3804], '89:': [1583, 1612, 3805], '10517-10521Crossref': [1584, 1613], '(341)': [1587, 1616], 'represent': [1593], 'critical': [1595, 1886], 'target': [1596], 'during': [1597], 'cell': [1598, 1817], 'notion,': [1623], 'reduced': [1630], 'absent': [1632], 'variety': [1640], 'oncogenes': [1643, 3988], '(v-Abl,': [1644], 'Bcr-Abl,': [1645], 'H-Ras(G12V)),': [1646], 'missing': [1650], '(12Koleske': [1655, 3884, 4186], 'A.J.': [1656, 2148, 2412, 3885, 4187], 'Baltimore': [1657, 2149, 2413, 3475, 3661, 3886, 4188], '1381-1385Crossref': [1670, 2162, 2426, 3899, 4201], '(472)': [1673, 1756, 1993, 2165, 2429, 3902, 3979, 4204], 'Scholar);': [1675], 'caveolin-2': [1676, 3937, 4112], 'oncogenic': [1684], '(7Engelman': [1686, 2111, 2375, 2817], '13Scherer': [1722], 'Lewis': [1724, 1961, 3947], 'R.Y.': [1725, 1962, 3948], 'Volonte': [1726, 1963, 3949], 'Engelman': [1728, 1965, 3951], 'Galbiati': [1730, 1967, 3953], 'F.': [1731, 1968, 2488, 3954], 'Kohtz': [1734, 1971, 2311, 2769, 2865, 3067, 3957], 'D.S.': [1735, 1972, 2770, 2866, 3068, 3958], 'van': [1736, 1973, 3959], 'Donselaar': [1737, 1974, 3960], 'Peters': [1739, 1976, 3962], '29337-29346Abstract': [1748, 1985, 3971], 'addition,': [1760], 'levels': [1763, 4173, 4331], 'correlated': [1764], 'inversely': [1765], 'ability': [1768], 'grow': [1773, 3118], 'soft': [1775, 1794, 1823], 'agar,': [1776], 'i.e.': [1777], 'expressing': [1779, 2744], 'smallest': [1781], 'amount': [1782], 'lacking': [1786], 'detectable': [1787], 'formed': [1789], 'largest': [1791], 'colonies': [1792], 'agar.': [1795], 'Furthermore,': [1796], 'laboratory': [1798], 'demonstrated': [1803, 4237], 'recombinant': [1805], 'mammary': [1815], 'carcinoma': [1816], 'lines': [1818], 'abrogates': [1819], 'agar': [1824], '(14Engelman': [1825, 4267], 'Wycoff': [1827, 2170, 2434, 3906, 4209, 4269], 'C.C.': [1828, 2171, 2435, 3907, 4210, 4270], 'Yasuhara': [1829, 2172, 2436, 3908, 4211, 4271], '16374-16381Abstract': [1842, 2185, 2449, 3921, 4224, 4284], '(335)': [1850, 2193, 2457, 3929, 4232, 4292], '15Lee': [1853], 'S.W.': [1854], 'Reimer': [1855], 'C.L.': [1856], 'Oh': [1857], 'Campbell': [1859], 'D.B.': [1860], 'Schnitzer': [1861], 'J.E.': [1862], 'Oncogene.': [1863], '16:': [1865], '1391-1397Crossref': [1866], '(399)': [1869], 'results': [1873, 4056, 4338], 'suggest': [1874], 'organelles': [1883], 'maintaining': [1888], 'govern': [1895], 'largely': [1899, 3940], 'kinase1': [1910], 'Anti-caveolin-1': [1920], 'IgG': [1921, 1955, 2029], '(monoclonal': [1922, 1956], 'antibody': [1923, 1957, 3276, 3299, 3327, 3383], '2297': [1924], '(16Scherer': [1925], 'Chun': [1929], 'Lodish': [1933, 3795], 'H.F.': [1934, 3796], '270:': [1941], '16395-16401Abstract': [1942], '(322)': [1950], 'Scholar))': [1952, 1995], 'anti-caveolin-2': [1954], '65': [1958], '(13Scherer': [1959, 3945], 'were': [1996, 2009, 2024, 2078, 2106, 2223, 2241, 2273, 2305, 2324, 2333, 2357, 2505, 2596, 2752, 2811, 2890, 2932, 2939, 2975, 3039, 3083, 3173, 3187, 3204, 3233, 3314, 3334, 3346, 3365, 3391, 3444, 3454, 3494, 3523, 3533, 3549, 3575, 3741, 3757, 3761, 3815, 3838], 'gifts': [1998], 'Dr.': [2000, 2014, 2227, 2246, 2260, 2278, 2308, 2329, 2570], 'Roberto': [2001], 'Campos-Gonzalez,': [2002], 'Transduction': [2003, 3387], 'Labs.': [2004], 'Antibodies': [2005], 'against': [2006, 3282], 'GDP-dissociation': [2007], 'generous': [2011, 2326, 2567], 'gift': [2012, 2225, 2327, 2568], 'Perry': [2015], 'Bickel,': [2016], 'Washington': [2017], 'University,': [2018], 'St.': [2019], 'Louis,': [2020], 'MO.': [2021], 'Other': [2022], 'reagents': [2023], 'purchased': [2025, 2052, 2079], 'commercially:': [2026], 'anti-activated': [2027], 'ERK-1/2': [2028, 3287], '(p42/44': [2030], 'kinase;': [2032], 'New': [2033, 3373], 'England': [2034, 3289, 3330, 3374], 'Biolabs,': [2035, 3290, 3331, 3375], 'Inc),': [2036], 'fetal': [2037, 2948, 3046], 'bovine': [2038, 2949, 3047, 3222], 'serum': [2039, 2374, 2950, 3048, 3123, 3136, 3223], '(JRH': [2040], 'Biosciences),': [2041], 'pre-stained': [2043], 'markers': [2045], '(Life': [2046], 'Technologies,': [2047], 'Inc.).': [2048, 3332, 3410, 3633], 'Calbiochem': [2054], 'dissolved': [2056], 'dimethyl': [2058], 'sulfoxide': [2059], 'concentration': [2062, 2071], '50': [2064, 2073, 2963, 3708], 'mm': [2065, 2969, 3699, 3704, 3709, 3715], 'used': [2067, 2083, 2702, 2990, 3302], 'final': [2070, 2085], 'μm.': [2074], 'Forskolin': [2075], 'IBMX': [2077], 'Sigma': [2081], 'concentrations': [2086, 3124, 3134], '10': [2088], '500': [2090], 'μm,': [2091], 'respectively.': [2092], 'H-Ras(G12V),': [2093], 'v-Abl,': [2094], 'v-Src-transformed': [2096], 'non-transformed': [2102, 3107], 'described': [2109, 2335, 2755, 2815, 2996, 3053, 3206, 3457, 3499, 3559, 3782], 'previously': [2110, 2336, 2756, 2816, 3054, 3294, 3781, 4236], '12Koleske': [2147, 2411], '14Engelman': [2168, 2432, 4207], 'N-Ras(Q61K)-transformed': [2196], '(17Guerrero': [2200], 'I.': [2201], 'Villasante': [2202], 'Corces': [2204], 'V.': [2205], 'Pellicer': [2206, 2229], '1985;': [2215], '82:': [2216], '7810-7814Crossref': [2217], '(88)': [2220], 'Angel': [2228], '(New': [2230, 3288, 3329], 'York': [2231], 'University': [2232], 'Medical': [2233], 'Center).': [2234], 'H-Ras(Q61L)-': [2235], 'K-Ras(G12V)-transformed': [2237], 'obtained': [2242, 2274, 2794], 'permission': [2244, 2276], 'Channing': [2247], 'Der,': [2249], 'Lineberger': [2251], 'Comprehensive': [2252], 'Cancer': [2253], 'Center,': [2254], 'UNC': [2255], 'Chapel': [2256], 'Hill,': [2257], 'NC,': [2258], 'Shama': [2261], 'Kajiji': [2262], 'Pfizer,': [2264], 'Inc.,': [2265], 'Groton,': [2266], 'CT.': [2267], 'Ras(G12V)': [2268], 'IPTG-inducible': [2269], 'Yoshito': [2279], 'Kaziro': [2280], 'Tokyo': [2283], 'Institute': [2284], 'Technology,': [2286], 'Japan,': [2287], 'Drs.': [2289], 'Mark': [2290], 'Hamilton': [2291], 'Alan': [2293], 'Wolfman': [2294], 'Cleveland': [2297], 'Clinic': [2298], 'Foundation,': [2299], 'OH.': [2300], 'v-Raf-transformed': [2301, 4315], 'donated': [2306], 'Stave': [2310], 'Mt.': [2314], 'Sinai': [2315], 'School': [2316], 'Medicine,': [2318, 2578], 'NY.': [2319], 'CHO': [2320, 2355, 2886, 3100, 3170], '(GRC+': [2322], 'LR-73)': [2323], 'Jeffrey': [2330], 'Pollard': [2331], '(18Pollard': [2337, 3143], 'J.W.': [2338, 3144], 'Stanners': [2339, 3145], 'C.P.': [2340, 3146], 'Physiol.': [2343, 3149], '1979;': [2344, 3150], '98:': [2345, 3151], '571-585Crossref': [2346, 3152], '(75)': [2349, 3155], 'propagated': [2358], 'T75': [2360], 'tissue': [2361], 'culture': [2362], 'flasks': [2363], "Dulbecco's": [2365], 'modified': [2366], "Eagle's": [2367], 'medium': [2368], 'supplemented': [2369, 3215], 'antibiotics': [2371], '10%': [2373], 'pA3Luc': [2460], '(19Wood': [2461], 'W.M.': [2462, 2486], 'Kao': [2463], 'M.Y.': [2464], 'Gordon': [2465], 'D.F.': [2466], 'Ridgway': [2467], 'E.C.': [2468], '1989;': [2472, 2490, 3514], '264:': [2473], '14840-14847Abstract': [2474], '20Maxwell': [2481], 'I.H.': [2482], 'Harrison': [2483], 'G.S.': [2484], 'Wood': [2485], 'Maxwell': [2487], 'BioTechniques.': [2489], '276-280PubMed': [2492], 'luciferase': [2497, 2670, 2699, 2809, 2993], 'reporter': [2498, 2909], 'plasmid': [2499, 2916, 2924, 2925], 'into': [2500, 2528, 2550, 2564, 2603, 2618, 2735, 3787, 3840], 'promoters': [2504], 'cloned.': [2506], '∼13-kb': [2508], 'NotI': [2509], 'genomic': [2510, 2524, 2535, 3557], 'clone': [2511, 3558], 'containing': [2512, 2557], 'murine': [2513, 2523, 2789, 3766, 3834], 'exons': [2515], '1': [2516, 2920, 2968, 3711, 3714, 3749, 4035, 4160], '2': [2518, 2906, 4296], 'isolated': [2520, 2543, 3524], 'library': [2525, 3785], 'cloned': [2527, 2734, 3786, 3839], 'Bluescript': [2529], 'SK.': [2530], 'An': [2531], '∼3-kb': [2532], 'fragment': [2533, 2547, 2556, 2586, 2592, 2615], 'upstream': [2537], 'starting': [2540, 2666, 2695], 'ATG': [2541, 2696], 'PCR.': [2545], 'subcloned': [2549, 2563, 2617, 3858], 'pZero': [2551, 2594], 'Blunt': [2552, 2595], '(Invitrogen).': [2553, 3842], 'Subsequently,': [2554], 'aSacI': [2555], 'entire': [2559], 'PCR': [2560, 2713, 2731, 3552, 3623, 3813, 3836], 'product': [2561, 2732, 3624, 4263], 'pXP2': [2565], '(a': [2566], 'Susan': [2571], 'Horwitz,': [2572], 'Albert': [2574], 'Einstein': [2575], 'College': [2576], 'NY).': [2579], 'construction': [2581, 2609, 2625], 'Pr-3kb,': [2583], '2.2-kbKpnI-HindIII': [2585], 'pXP2,': [2588], '∼750-bpHindIII-HindIII': [2591], 'combined': [2597], 'three': [2600, 4390], 'part': [2601], 'ligation': [2602], 'theKpnI-HindIII': [2604], 'site': [2605, 2621, 2727, 3769, 3846], 'pA3Luc.': [2607, 2623], 'Pr-750bp,': [2611], '750-bp': [2613], 'HindIII-HindIII': [2614], 'HindIII': [2620], 'Pr-3kb': [2627, 2736], 'Int1,': [2629], 'created': [2631], 'fusion': [2633], 'contains': [2636], '∼3': [2637], 'kb': [2638], 'promoter,': [2640], 'exon': [2643, 2655, 2720], 'caveolin-1,': [2645], 'intron,': [2648], 'beginning': [2651], 'second': [2654], '(extending': [2656], 'NIYKP)': [2661], 'fused': [2662], 'in-frame': [2663], 'methionine': [2667], 'gene.': [2671, 2700], 'took': [2673], 'advantage': [2674], 'unique': [2676], 'NarI': [2677], 'sites': [2678], 'position': [2680], '−750': [2681], '32': [2690], 'bp': [2691, 3571], 'downstream': [2692, 4104], 'primer,': [2704], 'AGGATAGAATGGCGCCGGGCCTTTCTTTATGTTTTTGGCGTCTTCCATGGGCTTGTAGATGTTGCCCTGTTC,': [2705], 'generate': [2707], '3′': [2709], 'end': [2710], 'product.': [2714], 'primer': [2716, 3820, 3826], 'encodes': [2717], 'NIYKP(cav-1': [2719], '2)-MEDAK': [2721], '(luciferase)': [2722], 'extends': [2724], 'past': [2725], 'theNarI': [2726], 'luciferase.': [2729], 'had': [2738], 'digested': [2740], 'NarI.': [2742], 'Constructs': [2743], 'ERK-2,': [2745], 'Raf': [2751], '(21Engelman': [2757, 3055], 'Chu': [2759, 2855, 3057], 'C.': [2760, 2856, 3002, 3058], 'Lin': [2761, 2857, 3059, 3793], 'Jo': [2763, 2859, 3061], 'H.': [2764, 2860, 3062, 3472, 3658, 3794], 'FEBS': [2773, 2869, 3071], 'Lett.': [2774, 2870, 3072], '428:': [2776, 2872, 3074], '205-211Crossref': [2777, 2873, 3075], '(347)': [2780, 2876, 3078], 'PKA': [2784], 'vector': [2786], '(encoding': [2787], 'subunit)': [2792], 'PathDetect': [2797], 'CREBtrans-Reporting': [2798], 'System': [2799], '(Stratagene,': [2800], 'Inc).': [2801, 3291], 'Transient': [2802], 'transfections': [2803], '(using': [2804], 'calcium': [2805], 'phosphate': [2806], 'precipitation)': [2807], 'performed': [2812, 3246, 3455, 3636], 'essentially': [2813], '21Engelman': [2853], 'Briefly,': [2879, 3491, 3677, 3812], '300,000': [2880], '(NIH': [2882], 'specified)': [2889], 'seeded': [2891], 'six-well': [2893], 'plates': [2894], '12–24': [2895], 'h': [2896, 2935, 3051], 'before': [2897], 'transfection.': [2899], 'Each': [2900], 'point': [2901], 'either': [2905], 'μg': [2907, 2921, 3679, 3687], 'experiments': [2911, 2927, 3018], 'only': [2914], 'transfected;': [2918], 'plasmids': [2931], 'co-transfected.': [2933], '12': [2934, 3698], 'post-transfection,': [2936], 'rinsed': [2940], 'twice': [2941], 'phosphate-buffered': [2943, 3035], 'saline': [2944], 'incubated': [2946, 3040, 3684, 3731], '24–36': [2953, 3050], 'h.': [2954], 'incubation': [2956, 3202], 'done': [2958], 'presence': [2961, 3043], 'μm': [2964], 'IPTG': [2970], 'when': [2971], 'applicable.': [2972], 'then': [2976, 3335], 'lysed': [2978, 3315], '200': [2980, 3619], 'μl': [2981, 2986], 'extraction': [2983], 'buffer,': [2984, 3319], '75': [2985], 'measure': [2992], 'activity,': [2994], '(22Pestell': [2997], 'Hollenberg': [2999], 'Albanese': [3001], 'Jameson': [3003], 'J.L.': [3004], '269:': [3009], '31090-31096Abstract': [3010], 'assessing': [3019], 'activators': [3029], 'PKA,': [3031], 'after': [3032], 'washing': [3033], 'saline,': [3036], '1%': [3045, 3221], 'made': [3084], 'possible': [3085], 'use': [3088], 'special': [3091], 'CHO-derived': [3092], 'line,': [3094], 'called': [3095], 'GRC+': [3096, 3102], 'LR-73.': [3097], 'Unlike': [3098], 'parental': [3099, 3169], 'cells,': [3101, 3527], 'LR-73': [3103], 'control': [3109], 'revertant': [3110], 'fibroblastic': [3114], 'morphology,': [3115], 'suspension,': [3120], 'requires': [3121], 'high': [3122], 'growth,': [3126], 'undergoes': [3128], 'synchronized': [3129], 'arrest': [3131], 'low': [3133], '(1–2%)': [3137], 'without': [3138], 'loss': [3140], 'viability': [3142], 'Also,': [3158], 'much': [3163], 'higher': [3164], 'transfection': [3165], 'efficiency': [3166], '(∼10-fold)': [3167], 'than': [3168], 'Samples': [3172, 3333, 3345], 'separated': [3174, 3742], 'SDS-polyacrylamide': [3176, 3357], 'gel': [3177, 3358, 3747], 'electrophoresis': [3178, 3359], 'transferred': [3180], 'nitrocellulose.': [3182], 'After': [3183, 3356], 'transfer,': [3184], 'nitrocellulose': [3185], 'sheets': [3186], 'stained': [3188], 'Ponceau': [3190], 'S': [3191, 3439, 3442], 'visualize': [3193], 'bands': [3195], 'subjected': [3197, 3422], 'immunoblotting.': [3199], 'immunoblotting,': [3201], 'conditions': [3203], 'manufacturer': [3209, 3324], '(Amersham': [3210, 3237, 3395, 3690], 'Pharmacia': [3211, 3238, 3396, 3691], 'Biotech),': [3212], 'except': [3213], 'blocking': [3217], 'solution': [3218], 'albumin': [3224], '2%': [3226], 'non-fat': [3227], 'dry': [3228], 'milk': [3229], '(Carnation).': [3230], 'Bound': [3231, 3389], 'antibodies': [3232, 3369, 3390], 'visualized': [3234, 3392, 3445, 3762], 'ECL': [3236, 3394], 'Biotech).': [3239, 3397], 'Quantitation': [3240], 'Western': [3242, 3311], 'blot': [3243, 3425], 'films': [3244], 'an': [3248, 3733, 3818, 3824, 4094], 'AlphaInnotech': [3249], 'ChemiImager': [3250], '4000': [3251], 'low-light': [3252], 'imaging': [3253], 'system': [3254], '(San': [3255], 'Leandro,': [3256], 'CA)': [3257], 'AlphaEase': [3260], 'software': [3261], 'package.': [3262], 'To': [3263, 4013], 'investigate': [3264, 4014], 'state': [3267], 'kinase,': [3271], 'employed': [3273], 'phospho-specific': [3275, 3326], 'probe': [3277, 3727], 'generated': [3281, 3576], 'It': [3292], 'selectively': [3304], 'detect': [3305], 'blotting.': [3312], 'Cells': [3313], 'boiling': [3317], 'sample': [3318], 'probes': [3328, 3429, 3545, 3564], 'collected': [3336], 'boiled': [3338], 'total': [3341, 3414], '5': [3343, 3686], 'min.': [3344, 3721], 'homogenized': [3347], '26-g': [3350], 'needle': [3351], '1-ml': [3354], 'syringe.': [3355], 'transfer': [3361], 'nitrocellulose,': [3363], 'blots': [3364], 'probed': [3366], 'primary': [3368], '(dilution': [3370, 3384], '1:500;': [3372], 'Inc.)': [3376], 'appropriate': [3379], 'horseradish': [3380], 'peroxidase-conjugated': [3381], 'secondary': [3382, 4147], '1:5000;': [3386], 'Laboratories).': [3388], 'Total': [3398], 'RNA': [3399, 3416], 'extracted': [3401], 'purified': [3403, 3622], 'according': [3404], "manufacturer's": [3407], 'instructions': [3408], '(Qiagen,': [3409], 'Ten': [3411], 'micrograms': [3412], 'cellular': [3415], 'denatured': [3418], 'formaldehyde': [3420], 'Northern': [3424, 4157], 'analysis': [3426, 3778, 4158], '32P-labeled': [3428], 'mouse': [3432, 3555], '(2.4': [3435], 'kb).': [3436], '28': [3438], '18': [3441], 'rRNA': [3443], 'ethidium': [3447], 'bromide': [3448], 'staining.': [3449], 'Electrophoretic': [3450], '(23Singh': [3458, 3644], 'Birshtein': [3460, 3646], 'B.K.': [3461, 3647], 'Mol.': [3462, 3648], '1993;': [3465, 3651], '13:': [3466, 3652], '3611-3622Crossref': [3467, 3653], '24Singh': [3471, 3657], 'Sen': [3473, 3659], 'R.': [3474, 3660], 'Sharp': [3477, 3663], 'P.A.': [3478, 3664], 'Nature.': [3479, 3665], '1986;': [3480, 3666], '319:': [3481, 3667], '154-158Crossref': [3482, 3668], '(624)': [3485, 3671], 'minor': [3489, 3675], 'modifications.': [3490, 3676], 'nuclear': [3492, 3681], 'extracts': [3493, 3682], 'prepared': [3495], 'method': [3498, 3639], 'Schreiber': [3501], 'et': [3502, 3642], 'al.(25Schreiber': [3503], 'Matthias': [3505], 'M.M.': [3508], 'Schaffner': [3509], 'W.': [3510], 'Nucleic': [3511], 'Acids': [3512], 'Res.': [3513], '17:': [3515], '6419Crossref': [3516], '(3917)': [3519], 'Extracts': [3522], '∼108': [3526], 'aliquoted,': [3528], 'frozen': [3530], 'immediately.': [3531], 'Concentrations': [3532], 'determined': [3534, 3771, 3848], 'BCA': [3537], 'Protein': [3538], 'Assay': [3539], 'Reagent': [3540], '(Pierce': [3541], 'Chemical': [3542], 'Co.).': [3543], 'DNA': [3544], 'EMSA': [3548, 3634], 'constructed': [3550], 'above.': [3560], 'four': [3562], 'overlapping': [3563], '(each': [3565], '∼250': [3566], 'bp)': [3567], 'spanned': [3569], '750': [3570], 'follows:': [3578], 'Probe': [3579, 3589, 3599, 3609], 'amplified': [3582, 3592, 3602, 3612, 3816], '5′-AGACCCGGCGCAGAGCACGTCCTAG-3′': [3584], '5′-TCGGAGTCCAC': [3586], 'GTATTTGCCC-3′': [3587], 'primers;': [3588, 3598, 3607], 'B': [3590], '5′-CCTCCACCCCTGCTGAGATGATG-3′': [3594], '5′-GTTCTGCTCTCAGTTGGC': [3596], 'TAGGAC-3′': [3597], '5′-GGTTCCCAGCCATCTCGCTTCTATATC-3′': [3604], '5′-AACCTACAGAGAGGCATCCAGGG-3′': [3606], 'D': [3610], '5′-CTCTCTAGTAACAAGCTTGAACCTC-3′': [3614], '5′-TCTGTCTCCTTGTTTCACAGAG-3': [3616], 'primers.': [3617], 'Approximately': [3618, 3722], 'ng': [3620], 'end-labeled': [3626, 3726], '[γ-32P]ATP': [3628], '(NEN': [3629], 'Life': [3630], 'Science': [3631], 'Products': [3632], 'Singh': [3641], 'al.': [3643], '15': [3678, 3720], 'poly(dI-dC)': [3689], 'Biotech)': [3692], 'buffer': [3695], '(12%': [3696], 'glycerol,': [3697], 'HEPES,': [3700], 'pH': [3701, 3706], '7.9],': [3702], '4': [3703], 'Tris,': [3705], '8.0,': [3707], 'KCl,': [3710], 'mmEDTA,': [3712], 'dithiothreitol)': [3716], 'ice': [3718], '40,000': [3723], 'cpm': [3724], 'added': [3729], 'additional': [3734], '30': [3735], 'min': [3736], 'ice.': [3738], 'Protein-DNA': [3739], 'complexes': [3740, 3760], '5%': [3745], 'polyacylamide': [3746], '×': [3750], 'TBE': [3751], '20': [3753], 'mA.': [3754], 'gels': [3756], 'dried': [3758], 'autoradiography.': [3764], 'transcriptional': [3767, 3844], 'start': [3768, 3845], '5′-rapid': [3773], 'amplification': [3774], 'cDNA': [3776], 'ends': [3777], '3T3-L1': [3783], 'adipocyte': [3784], 'pCDNA1': [3788, 3822], '(26Baldini': [3789], 'G.': [3790], 'Hohl': [3791], '5049-5052Crossref': [3806], '(195)': [3809], 'products': [3814, 3837], 'oligonuceotide': [3825], 'antisense': [3829], 'nucleotides': [3831], '9–26': [3832], 'caveolin-1.': [3835], 'pCR-Blunt': [3841], '−63': [3852], 'direct': [3854], 'sequencing': [3855], 'inserts.': [3859], '5′-untranslated': [3864], 'is:': [3866], 'CAGTTCTCTTAAATCACAGCCCAGGGAAACCTCCTCAGAGCCTGCAGCCAGCCACGCGCCAGC.': [3867], 'Expression': [3868], 'Scholar,14Engelman': [3904], 'unaffected': [3941, 4114], 'mechanism': [3983], 'transforming': [3987], 'remains': [3992], 'One': [3994], 'possibility': [3995], 'negatively': [4002], 'constitutive': [4005, 4356], 'hypothesis': [4016, 4343], 'further,': [4017], 'examined': [4019], 'number': [4027], 'Ras-transformed': [4030], 'Fig.': [4034, 4295], 'shows': [4037], 'H-Ras(Q61L),': [4050, 4311], 'K-Ras(G12V),': [4051, 4312], 'N-Ras(Q61K),': [4052, 4313], 'v-Raf.': [4054], 'indicate': [4057], 'Ras-induced': [4059], 'versusQ61L),': [4072], '(H-Rasversus': [4081], 'K-Ras': [4082], 'N-Ras),': [4084], '(iii)': [4086], 'if': [4089], 'element': [4095], 'Ras-MAP': [4098], 'itself': [4107], '(v-Raf).': [4108], 'oncogenes.': [4118], '-2': [4125], 'comparison.': [4137], 'Down-regulation': [4138], 'mRNA,': [4153], 'seen': [4155], '(Fig.': [4159], 'B).': [4161], 'accordance': [4163], 'observations,': [4166], 'dramatically': [4176], 'Ras-': [4179], 'H-Ras': [4241], '(G12V)-transformed': [4242], 'Ashows': [4297], 'no': [4324], 'significant': [4325], 'effect': [4326], 'consistent': [4340], 'due': [4354], 'Interestingly,': [4364], 'did': [4377], 'indepe': [4391]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W2030102642', 'counts_by_year': [{'year': 2024, 'cited_by_count': 3}, {'year': 2023, 'cited_by_count': 3}, {'year': 2022, 'cited_by_count': 2}, {'year': 2021, 'cited_by_count': 2}, {'year': 2020, 'cited_by_count': 2}, {'year': 2019, 'cited_by_count': 1}, {'year': 2018, 'cited_by_count': 1}, {'year': 2017, 'cited_by_count': 3}, {'year': 2016, 'cited_by_count': 3}, {'year': 2015, 'cited_by_count': 5}, {'year': 2014, 'cited_by_count': 3}, {'year': 2013, 'cited_by_count': 7}, {'year': 2012, 'cited_by_count': 7}], 'updated_date': '2024-12-17T14:43:01.139086', 'created_date': '2016-06-24'}
Publication Information

Basic Information

Access and Citation

AI Researcher Chatbot

Primary Location

Authors

Topics

Keywords

Related Works
