Title: The Bacterial ATPase SecA Functions as a Monomer in Protein Translocation
Abstract: The ATPase SecA drives the post-translational translocation of proteins through the SecY channel in the bacterial inner membrane. SecA is a dimer that can dissociate into monomers under certain conditions. To address the functional importance of the monomeric state, we generated an Escherichia coli SecA mutant that is almost completely monomeric (>99%), consistent with predictions from the crystal structure of Bacillus subtilis SecA. In vitro, the monomeric derivative retained significant activity in various assays, and in vivo, it sustained 85% of the growth rate of wild type cells and reduced the accumulation of precursor proteins in the cytoplasm. Disulfide cross-linking in intact cells showed that mutant SecA is monomeric and that even its parental dimeric form is dissociated. Our results suggest that SecA functions as a monomer during protein translocation in vivo. The ATPase SecA drives the post-translational translocation of proteins through the SecY channel in the bacterial inner membrane. SecA is a dimer that can dissociate into monomers under certain conditions. To address the functional importance of the monomeric state, we generated an Escherichia coli SecA mutant that is almost completely monomeric (>99%), consistent with predictions from the crystal structure of Bacillus subtilis SecA. In vitro, the monomeric derivative retained significant activity in various assays, and in vivo, it sustained 85% of the growth rate of wild type cells and reduced the accumulation of precursor proteins in the cytoplasm. Disulfide cross-linking in intact cells showed that mutant SecA is monomeric and that even its parental dimeric form is dissociated. Our results suggest that SecA functions as a monomer during protein translocation in vivo. Many bacterial proteins are transported post-translationally across the inner membrane by the Sec machinery, which consists of two essential components (1Duong F. Eichler J. Price A. Leonard M.R. Wickner W. Cell. 1997; 91: 567-573Abstract Full Text Full Text PDF PubMed Scopus (128) Google Scholar, 2Pohlschröder M. Prinz W.A. Hartmann E. Beckwith J. Cell. 1997; 91: 563-566Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar, 3Manting E.H. Driessen A.J. Mol. Microbiol. 2000; 37: 226-238Crossref PubMed Scopus (210) Google Scholar, 4Mori H. Ito K. Trends Microbiol. 2000; 9: 494-500Abstract Full Text Full Text PDF Scopus (235) Google Scholar). One is the SecY complex, which forms a conserved heterotrimeric protein-conducting channel in the inner membrane (5Breyton C. Haase W. Rapoport T.A. Kuhlbrandt W. Collinson I. Nature. 2002; 418: 662-665Crossref PubMed Scopus (215) Google Scholar, 6Van den Berg B. Clemons W.M.J. Collinson I. Modis Y. Hartmann E. Harrison S.C. Rapoport T.A. Nature. 2004; 427: 36-44Crossref PubMed Scopus (1004) Google Scholar). The other is SecA, a cytoplasmic ATPase, which "pushes" substrate polypeptide chains through the SecY channel (7Hunt J.F. Weinkauf S. Henry L. Fak J.J. McNicholas P. Oliver D.B. Deisenhofer J. Science. 2002; 297: 2018-2026Crossref PubMed Scopus (242) Google Scholar). SecA interacts not only with the SecY channel (8Hartl F.-U. Lecker S. Schiebel E. Hendrick J.P. Wickner W. Cell. 1990; 63: 269-279Abstract Full Text PDF PubMed Scopus (481) Google Scholar) but also with acidic phospholipids (9Lill R. Dowhan W. Wickner W. Cell. 1990; 60: 271-280Abstract Full Text PDF PubMed Scopus (496) Google Scholar, 10Ulbrandt N.D. London E. Oliver D. J. Biol. Chem. 1992; 267: 15184-15192Abstract Full Text PDF PubMed Google Scholar, 11van der Does C. Swaving J. van Klompenburg W. Driessen A.J.M. J. Biol. Chem. 2000; 275: 2472-2478Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar) and with both the signal sequence and the mature part of a substrate protein (12Cunningham K. Wickner W. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 8630-8634Crossref PubMed Scopus (103) Google Scholar). It also binds the chaperone SecB, which ushers some precursor proteins to SecA (8Hartl F.-U. Lecker S. Schiebel E. Hendrick J.P. Wickner W. Cell. 1990; 63: 269-279Abstract Full Text PDF PubMed Scopus (481) Google Scholar, 13Xu Z. Knafels J.D. Yoshino K. Nat. Struct. Biol. 2000; 7: 1172-1177Crossref PubMed Scopus (101) Google Scholar, 14Driessen A.J. Trends Microbiol. 2001; 9: 193-196Abstract Full Text Full Text PDF PubMed Scopus (58) Google Scholar). When associated with the SecY complex, SecA undergoes repeated cycles of ATP-dependent conformational changes, which are linked to the movement of successive segments of a polypeptide chain through the channel (15Economou A. Wickner W. Cell. 1994; 78: 835-843Abstract Full Text PDF PubMed Scopus (488) Google Scholar, 16Eichler J. Wickner W. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 5574-5581Crossref PubMed Scopus (73) Google Scholar). However the mechanism employed by SecA to translocate substrates polypeptide chains through the SecY channel remains largely unknown. An important issue concerning the function of SecA is its oligomeric state during translocation. SecA is a dimer in solution (17Akita M. Shinkai A. Matsuyama S. Mizushima S. Biochem. Biophys. Res. Commun. 1991; 174: 211-216Crossref PubMed Scopus (101) Google Scholar, 18Doyle S.M. Braswell E.H. Teschke C.M. Biochemistry. 2000; 39: 11667-11676Crossref PubMed Scopus (61) Google Scholar), and previous work argued that this is its functional state (19Driessen A.J.M. Biochemistry. 1993; 32: 13190-13197Crossref PubMed Scopus (133) Google Scholar). An x-ray structure of Bacillus subtilis SecA also indicates the existence of a dimer (7Hunt J.F. Weinkauf S. Henry L. Fak J.J. McNicholas P. Oliver D.B. Deisenhofer J. Science. 2002; 297: 2018-2026Crossref PubMed Scopus (242) Google Scholar). However, recent evidence raises the possibility that SecA might actually function as a monomer; in solution, SecA dimers are in rapid equilibrium with monomers (20Woodbury R.L. Hardy S.J.S. Randall L.L. Protein Sci. 2002; 11: 875-882Crossref PubMed Scopus (125) Google Scholar, 21Or E. Navon A. Rapoport T.A. EMBO J. 2002; 21: 4470-4479Crossref PubMed Scopus (137) Google Scholar). Although the equilibrium favors dimers, it is shifted almost completely toward monomers in the presence of membranes containing acidic phospholipids or upon binding to the SecY complex (21Or E. Navon A. Rapoport T.A. EMBO J. 2002; 21: 4470-4479Crossref PubMed Scopus (137) Google Scholar). A synthetic signal peptide had a similar effect, although this result is controversial (22Benach J. Chou Y.-T. Fak J.J. Itkin A. Nicolae D.D. Smith P.C. Wittrock G. Floyd D.L. Golsaz C.M. Gierasch L.M. Gierasch F.H. J. Biol. Chem. 2003; 278: 3628-3638Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar). A monomeric derivative of SecA containing six point mutations retained some in vitro translocation activity (21Or E. Navon A. Rapoport T.A. EMBO J. 2002; 21: 4470-4479Crossref PubMed Scopus (137) Google Scholar), but the low level of translocation precluded any firm conclusion. In addition, the previous results do not exclude models in which SecA cycles between monomeric and oligomeric states during the translocation of a polypeptide chain (22Benach J. Chou Y.-T. Fak J.J. Itkin A. Nicolae D.D. Smith P.C. Wittrock G. Floyd D.L. Golsaz C.M. Gierasch L.M. Gierasch F.H. J. Biol. Chem. 2003; 278: 3628-3638Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar, 23Bu Z. Wang L. Kendall D.A. J. Mol. Biol. 2003; 332: 23-30Crossref PubMed Scopus (53) Google Scholar). Most importantly, the functional oligomeric state of SecA in vivo remains to be established. In this report, we have tested whether SecA can function as a monomer in vivo. Guided by the x-ray structure of B. subtilis SecA (7Hunt J.F. Weinkauf S. Henry L. Fak J.J. McNicholas P. Oliver D.B. Deisenhofer J. Science. 2002; 297: 2018-2026Crossref PubMed Scopus (242) Google Scholar), we generated a monomeric derivative of Escherichia coli SecA that lacks the first 11 amino acids. The monomeric derivative retains significant activity in various in vitro assays and can substitute for endogenous SecA in vivo. Cross-linking experiments in intact cells indicate that even the parental dimeric derivative is mostly present as a monomer. Our results therefore suggest that SecA functions as a monomer. Bacterial Strains and Plasmids—Table I lists the bacterial strains and plasmids used in this work. The segment containing the arabinose promoter and the AraC gene on pBAD22 was amplified by PCR using the primers BclIBAD5pr (gtacgtgatcatgcataatgtgcctgtcaaatggac) and SecABAD3pr (gtgcgatcgttacgactaccgaaaactttagttaacaatttgattagcatggtgaattcctcctgctagccc). The kanamycin resistance gene was amplified from pBAD18 using BglIIKan3pr (gcttagatctgcctcgtgaagaaggtgttgctgac) and SecMKan5pr (gtgcgaacgctgttttcttaagcacttttccgcacaacttatcttcattcaagccacgttgtgtctcaaaatctc). The PCR-amplified fragments were digested with either BclI (araC-PBAD) or BglII (kan) and ligated to each other. The ligation mixture was digested with BclI and BglII, and the product fragment was amplified by PCR using SecMKan5pr and SecABAD3pr. The amplified linear cassette (SecM(-50–1)-kan-araC-PBAD-SecA(1–50)) was used to replace the chromosomal region between SecM(+1) and SecA(–1) by homologous recombination using strain DY378 as described (24Yu D. Ellis H.M. Lee E.-C. Jenkins N.A. Copeland N.G. Court D.L. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 5978-5983Crossref PubMed Scopus (1408) Google Scholar). The resulting strain, EO527, requires arabinose for growth. Strain EO528 was generated by P1 transduction of the prlA4 allele into strain EO527. The presence of the prlA4 mutation was confirmed by sequencing. Strain EO529 was generated by P1 transduction of kan-araC-PBAD-SecA from EO527 into strain SMG96. Δ11/N95 was constructed from pT7N95-SecA (21Or E. Navon A. Rapoport T.A. EMBO J. 2002; 21: 4470-4479Crossref PubMed Scopus (137) Google Scholar) by PCR-based deletion of residues Leu2–Gly11. N95 and Δ11/N95 were amplified by PCR and cloned between the NcoI and BamHI sites of pDSW204 (25Weiss D.S. Chen J.C. Ghigo J.-M. Boyd D. Beckwith J. J. Bacteriol. 1999; 181: 508-520Crossref PubMed Google Scholar), generating pDSW204N95 and pDSW204Δ11/N95, respectively. Δ11/N95 was also cloned between the BamHI and NotI sites of pET21 (Novagene). The mutations S636C and Q801C were introduced into pT7N95-SecA(C98S) using PCR-based site-directed mutagenesis (Invitrogen) and confirmed by sequencing. The double-cycteine construct, N95(CC), was used to generate Δ11/N95(CC) by PCR-based deletion. Both constructs were then amplified by PCR and cloned between the NcoI and BamHI site of pDSW204, yielding plasmids pDSW204N95(CC) and pDSW204Δ11/N95(CC), respectively.Table IBacterial strains and plasmids used in this workPlasmidsDescriptionSource or referencepT7N95-SecApT7-SecA(Met1-Val831)-His6Ref. 21Or E. Navon A. Rapoport T.A. EMBO J. 2002; 21: 4470-4479Crossref PubMed Scopus (137) Google ScholarpET21Δ11N95SecA(Met1-Val831)-His6 cloned in pET21This workpDSW204Ref. 25Weiss D.S. Chen J.C. Ghigo J.-M. Boyd D. Beckwith J. J. Bacteriol. 1999; 181: 508-520Crossref PubMed Google ScholarpDSW204N95SecA(Met1-Val831)-His6 cloned in pDSW204This workpDSW204Δ11N95SecA(Ser12-Val831)-His6 cloned in pDSW204This workpT7N95(C636)pT7N95-SecA (C98S,S636C)This workpT7N95(C801)pT7N95-SecA (C98S,Q801C)This workpDSW204N95(CC)pDSW204N95 (C98S,S636C,Q801C)This workpDSW204Δ11N95(CC)pDSW204Δ11N95 (C98S,S636C,Q801C)This workStrainsGenotypeSource or referenceDY378W3110 λcI857 Δ(cro-bioA)Ref. 24Yu D. Ellis H.M. Lee E.-C. Jenkins N.A. Copeland N.G. Court D.L. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 5978-5983Crossref PubMed Scopus (1408) Google ScholarEO527DY378 SecM<>kan-araC-PBADThis workEO528DY378 prlA4..Tn10 SecM<>kan-araC-PBADThis workSMG96DHB4 ΔtrxB Δgor ahpC*Ref. 52Ritz D. Lim J. Reynolds M.C. Poole L.B. Beckwith J. Science. 2001; 294: 158-160Crossref PubMed Scopus (107) Google ScholarEO529SMG96 SecM<>kan-araC-PBADThis work Open table in a new tab Overexpression and Purification of Proteins—Expression and purification of SecYEHis6G, SecY(prlA4)EHis6G, SecA, and its derivatives were done as described (21Or E. Navon A. Rapoport T.A. EMBO J. 2002; 21: 4470-4479Crossref PubMed Scopus (137) Google Scholar, 26Collinson I. Breyton C. Duong F. Tziatzios C. Schubert D. Or E. Rapoport T. Kuhlbrandt W. EMBO J. 2001; 20: 2462-2471Crossref PubMed Scopus (111) Google Scholar). Δ11/N95 was additionally purified by Superdex200 GF. Pro-outer membrane protein A (pro-OmpA) 1The abbreviations used are: OmpA, outer membrane protein A; EDC, 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide; IPTG, isopropyl β-d-thiogalactoside; MBP, maltose-binding protein. was expressed and purified from inclusion bodies as described (27Crooke E. Gurthrie B. Lecker S. Lill R. Wickner W. Cell. 1988; 54: 1003-1011Abstract Full Text PDF PubMed Scopus (154) Google Scholar). Cross-linking and Sucrose Gradients—SecA and derivatives in buffer (50 mm K-HEPES, pH 7.5, 100 mm KCl, 4 mm MgCl2, 1 mm dithiothreitol) were cross-linked with 20 mm EDC or analyzed by sucrose gradient centrifugation as described (21Or E. Navon A. Rapoport T.A. EMBO J. 2002; 21: 4470-4479Crossref PubMed Scopus (137) Google Scholar). In Vitro Assays—SecA and Δ11/N95 were labeled with 125I using IODO-GEN (Pierce) as described (15Economou A. Wickner W. Cell. 1994; 78: 835-843Abstract Full Text PDF PubMed Scopus (488) Google Scholar). Liposomes containing reconstituted wild type SecY or SecY(prlA4) complexes were prepared as described (26Collinson I. Breyton C. Duong F. Tziatzios C. Schubert D. Or E. Rapoport T. Kuhlbrandt W. EMBO J. 2001; 20: 2462-2471Crossref PubMed Scopus (111) Google Scholar). Proteoliposome binding assays were done according to Ref. 8Hartl F.-U. Lecker S. Schiebel E. Hendrick J.P. Wickner W. Cell. 1990; 63: 269-279Abstract Full Text PDF PubMed Scopus (481) Google Scholar as detailed in Ref. 21Or E. Navon A. Rapoport T.A. EMBO J. 2002; 21: 4470-4479Crossref PubMed Scopus (137) Google Scholar. ATPase and translocation assays were carried out at 30 and 37 °C, respectively, as described (21Or E. Navon A. Rapoport T.A. EMBO J. 2002; 21: 4470-4479Crossref PubMed Scopus (137) Google Scholar). To follow the kinetics of translocation, 40-μl aliquots were withdrawn from a master mixture (380 μl) at different times and mixed with 160 μl of ice-cold 75 mm KCl, 50 mm K-HEPES, pH 7.5. Samples were then processed as usual. Disulfide Cross-linking of SecA Derivatives—Strains EO529 and EO527 expressing N95(CC) from pDSW204N95(CC) were grown in LB containing ampicillin (100 μg/ml) at 30 °C for 5 h. Where indicated, 150 μm IPTG was added after 3.5 h. EO529 expressing Δ11/N95(CC) from pDSW204Δ11/N95(CC) was grown for 5 h at 30 °C with or without 150 μm IPTG. Where indicated, cells were grown for an additional 20 min in the presence of 1 mm diamide (Sigma). Aliquots of 1.5 ml of culture were withdrawn, mixed with 150 μl of 100% trichloroacetic acid, incubated on ice for 20 min, and centrifuged at 14,000 rpm for 10 min. Pellets were washed with ice-cold acetone, incubated on ice for 20 min, and centrifuged again. Pellets then were air-dried and dissolved with 150 μl of 20 mm iodoacetamide, 1% SDS, 0.1 m Tris-Cl, pH 8.0. After 1 h at 22 °C 40 μl of 6% SDS, 50% glycerol, 0.1% bromphenol blue were added. In vitro cross-linking of SecA derivatives in buffer (50 mm K-HEPES, pH 7.5, 50 mm NaCl, 4 mm MgCl2) was done with 40 μm diamide for 15 min at 22 °C. The reaction was stopped with 30 mm iodoacetamide, 1% SDS, 50 mm Tris-Cl, pH 8.0, and after 1 h, 12 μl of 6% SDS, 50% glycerol, 0.1% bromphenol blue were added. In Vivo Pulse-Chase Labeling of Pro-OmpA—Cells were grown at 30 °C in minimal glycerol medium (M63 salts with 0.5% glycerol, vitamin B1 (1 μg/ml), vitamin B5 (2 μg/ml), 1 mm MgSO4, 18 amino acids, each at 50 μg/ml, and 0.005% yeast extract). Early log phase cells (7.5 ml) were pulsed with 0.1 mCi of [35S]methionine for 20 s, and chase was initiated by adding 750 μl of 1% methionine, chloramphenicol (1 mg/ml). Samples (1 ml) were removed at the indicated times and precipitated with trichloroacetic acid as described (28Katzen F. Beckwith J. Methods Enzymol. 2002; 348: 54-66Crossref PubMed Scopus (13) Google Scholar). Acetone-washed pellets were solubilized with 25 mm Tris-Cl, 1 mm EDTA, 1% SDS, and OmpA was immunoprecipitated using OmpA antibodies and protein A. Generation of a Monomeric Derivative of SecA—We previously generated a monomeric SecA derivative by mutagenizing into alanines six residues that we suspected to be important for dimerization (21Or E. Navon A. Rapoport T.A. EMBO J. 2002; 21: 4470-4479Crossref PubMed Scopus (137) Google Scholar). The x-ray structure of B. subtilis SecA (7Hunt J.F. Weinkauf S. Henry L. Fak J.J. McNicholas P. Oliver D.B. Deisenhofer J. Science. 2002; 297: 2018-2026Crossref PubMed Scopus (242) Google Scholar) later showed that four of the six residues were indeed close to the interface between the monomers. However, the derivative exhibited low translocation activity in vitro, probably because the specific mutations had additional effects. The x-ray structure of B. subtilis SecA now offers a more rational design of a monomeric derivative. In the crystal, SecA is a dimer with the monomers arranged head-to-tail (7Hunt J.F. Weinkauf S. Henry L. Fak J.J. McNicholas P. Oliver D.B. Deisenhofer J. Science. 2002; 297: 2018-2026Crossref PubMed Scopus (242) Google Scholar). Most of the intersubunit contacts are contributed by the first nine residues of each subunit (Met1–Phe9), which contact side chains in the C-terminal domain of the other subunit (Fig. 1). To test whether these residues are crucial for dimer stability, we deleted the corresponding sequence (2LIKLLTKVFG11) from N95, an E. coli SecA derivative that lacks the last 70 residues. We used N95 as a starting point, because it is shorter than SecA and yet is fully dimeric and functional (21Or E. Navon A. Rapoport T.A. EMBO J. 2002; 21: 4470-4479Crossref PubMed Scopus (137) Google Scholar, 29Matsuyama S. Kimura E. Mizushima S. J. Biol. Chem. 1990; 265: 8760-8765Abstract Full Text PDF PubMed Google Scholar, 30Shinkai A. Akita M. Matsuyama S. Mizushima S. Biochem. Biophys. Res. Commun. 1990; 172: 1217-1223Crossref PubMed Scopus (17) Google Scholar). Also, the last 70 residues contribute slightly to dimer formation (data not shown). After sucrose gradient centrifugation, the parental N95 dimer (189 kDa) migrated in fractions 15–17, close to full-length SecA (fraction 18, 204 kDa; Fig. 2). In contrast, the derivative Δ11/N95, lacking residues Leu2–Gly11, migrated in fractions 11–13, close to the position of bovine serum albumin (fraction 9, 70 kDa) and consistent with it being monomeric. Quantification of the experiment showed that at most 1% of Δ11/N95 exists as dimers (data not shown). Cross-linking experiments using EDC (17Akita M. Shinkai A. Matsuyama S. Mizushima S. Biochem. Biophys. Res. Commun. 1991; 174: 211-216Crossref PubMed Scopus (101) Google Scholar, 21Or E. Navon A. Rapoport T.A. EMBO J. 2002; 21: 4470-4479Crossref PubMed Scopus (137) Google Scholar) supported the conclusion that Δ11/N95 is monomeric (Fig. 3E).Fig. 2Deletion of the 11 N-terminal residues converts dimeric N95(SecA) into a monomer. Purified N95(SecA) and Δ11/N95 (90 μg each) were subjected to sucrose gradient centrifugation. Twenty-four 520-μl fractions were collected, and 60-μl aliquots from fractions 1–20 were analyzed by SDS-PAGE followed by Coomassie Blue staining. The arrows point to the peak positions of SecA and bovine serum albumin (BSA) analyzed under the same conditions.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Fig. 3Δ11/N95 retains significant activityin vitro. A, binding of [125I]SecA (5 nm, 38,000 cpm) to proteoliposomes containing reconstituted SecY complex was performed in the presence of increasing concentrations of unlabeled SecA or Δ11/N95. Binding of [125I]SecA in the absence of a competitor protein was taken as 100%. The curves are the best fit to the equation, Bound(% of initial) = (100– offset)* Ki /(Ki +[I]) + offset. B, ATPase activity of SecA(filled symbols) and of Δ11/N95 (open symbols) was measured in the presence of proteoliposomes containing reconstituted of SecY complex (circles) or reconstituted SecY(prlA4) complex (squares) or in the absence of any liposomes (triangles). The concentrations of SecA and Δ11/N95 were 0.25 μm. C, pro-OmpA (0.25 μg), spiked with [35S]Met-pro-OmpA, was incubated for 15 min with SecA or with Δ11/N95 in the presence of proteoliposomes containing either wild type SecY or SecY(prlA4) complex. The numbers below are the fraction of total pro-OmpA that was translocated and protected from protease. D, pro-OmpA was translocated by SecA or Δ11/N95 into proteoliposomes containing SecY(prlA4) complex. Raw data (inset) were quantified by phosphorimaging and normalized to the value obtained by SecA after 12 min. -ATP, 15-min incubation without ATP. TX, Triton X-100 present during proteinase K treatment. E, Δ11/N95 or SecA were treated with EDC in the presence or absence of 2 μl of proteoliposomes containing reconstituted SecY(prlA4). Samples containing 0.5-μg protein were resolved on a 5% gel and immunoblotted with antibodies against SecA.View Large Image Figure ViewerDownload Hi-res image Download (PPT) The Monomeric Derivative Δ11/N95 Is Active in Vitro—Next we compared the activity of Δ11/N95 with that of wild type, full-length SecA in several in vitro assays. 2The activity of N95 in these assays was the same as that of full-length SecA (data not shown). We first measured their binding affinity to the SecY channel. Increasing amounts of SecA or Δ11/N95 were mixed with a constant amount of 125I-SecA and incubated with proteoliposomes containing the SecY complex (Fig. 3A). As the amount of unlabeled competitor was increased, the level of 125I-SecA bound to reconstituted SecY decreased. A binding constant of 224 ± 19 nm was calculated for wild type SecA (Fig. 3A, circles), in close agreement with previous data (31Dapic V. Oliver D. J. Biol. Chem. 2000; 275: 25000-25007Abstract Full Text Full Text PDF PubMed Scopus (48) Google Scholar). The monomeric derivative, Δ11/N95, had an only 2-fold lower affinity of 447 ± 32 nm (triangles). About 28% of the bound 125I-SecA could not be competed away by Δ11/N95, perhaps because the N-terminal residues of SecA have a secondary binding site at SecY. Previous experiments had shown that the prlA4 signal sequence suppressor mutation in SecY (32Emr S.D. Hanley-Way S. Silhavy T.J. Cell. 1981; 23: 79-88Abstract Full Text PDF PubMed Scopus (240) Google Scholar) enhances the activity of a monomeric derivative of SecA ∼5-fold (21Or E. Navon A. Rapoport T.A. EMBO J. 2002; 21: 4470-4479Crossref PubMed Scopus (137) Google Scholar). We therefore tested proteoliposomes containing the mutant SecY complex for its ability to bind Δ11/N95. The affinities for SecA and Δ11/N95 were a little higher than with wild type SecY (173 ± 12 and 305 ± 23 nm, respectively), and again, the monomeric SecA derivative, Δ11/N95, had only a slightly reduced affinity for the SecY complex. We next compared the translocation ATPase activity of SecA and Δ11/N95 under conditions where the ATPase activity is proportional to the protein concentration (Fig. 3B). SecA and Δ11/N95 exhibited the same low basal ATPase activity (∼6.5 mol of ATP/mol of protein/min; Fig. 3B, closed and open triangles, respectively). The addition of both SecY complex-containing proteoliposomes and translocation substrate (pro-OmpA), stimulated the ATPase activity of SecA and of Δ11/N95 by a factor of 16 and 10, respectively (closed and open circles, respectively). With SecY(prlA4) proteoliposomes, the factor of stimulation was 13 and 12, respectively (closed and open squares, respectively). Thus, the monomeric derivative has almost the same level of translocation ATPase activity as wild type SecA. To compare the translocation activities of SecA and Δ11/N95, they were incubated with SecY complex-containing proteoliposomes, ATP, and [35S]Met-pro-OmpA. Translocated pro-OmpA was detected by its resistance to protease treatment (Fig. 3C). We found that Δ11/N95 translocated 16% of the amount of pro-OmpA compared with wild type SecA (Fig. 3C, SecY). With SecY(prlA4) complex-containing proteoliposomes, the translocation efficiency of Δ11/N95 increased to 74% (Fig. 3C, prlA4). The kinetics of translocation was almost the same for SecA and Δ11/N95 (Fig. 3D; see inset for raw data). As expected, no protease-protected pro-OmpA was seen in the absence of ATP or when Triton X-100 was added during proteolysis (Fig. 3D, inset). Together, these results show that the Δ11/N95 monomer retains significant activity in several in vitro assays. To exclude the possibility that Δ11/N95 dimerizes when bound to the SecY(prlA4) complex, we performed cross-linking experiments with the carbodiimide EDC. Wild type SecA on its own showed strong dimer cross-links, and these were reduced upon the addition of proteoliposomes containing SecY(prlA4) complex (Fig. 3E, lanes 1 and 2), in agreement with previous experiments showing dissociation of wild type SecA under these conditions (21Or E. Navon A. Rapoport T.A. EMBO J. 2002; 21: 4470-4479Crossref PubMed Scopus (137) Google Scholar). Δ11/N95 did not give rise to dimer cross-links in the absence or presence of proteoliposomes (Fig. 3E, lanes 3 and 4), indicating that it remains monomeric when bound to SecY(prlA4). The Monomeric Derivative Δ11/N95 Supports Cell Growth—To test the activity of Δ11/N95 in vivo, we constructed E. coli strain EO527, in which the 5′ regulatory region of the chromosomal SecA gene (∼300 bp) was replaced with the tightly regulated arabinose promoter. This promoter is active in the presence of arabinose but is turned off completely in the presence of glucose. Indeed, strain EO527 exhibited robust growth in arabinose (doubling time of 45 min), but upon a switch to glucose, the cells stopped growing after 4 h (Fig. 4A). This was paralleled by the expression of SecA; whereas in the presence of arabinose SecA was expressed at similar levels throughout the experiment (Fig. 4B, +Arabinose), its expression dropped to negligible levels 4 h after the switch to glucose (+Glucose). These data are consistent with SecA being essential for viability of E. coli (33Liss L.R. Oliver D.B. J. Biol. Chem. 1986; 261: 2299-2303Abstract Full Text PDF PubMed Google Scholar). Next we tested whether Δ11/N95 can replace SecA and support growth of EO527 cells when expression of chromosomal SecA is shut down. N95 and Δ11/N95 were cloned into the plasmid pDSW204 under the control of an attenuated IPTG-driven promoter (25Weiss D.S. Chen J.C. Ghigo J.-M. Boyd D. Beckwith J. J. Bacteriol. 1999; 181: 508-520Crossref PubMed Google Scholar). The two plasmids and, as a control, the empty vector were each introduced into EO527 cells. It should be noted that the deletion of the sequence coding for Leu2–Gly11 also removes a segment, which plays a key role in translation initiation (34Etchegaray J.-P. Inouye M. J. Biol. Chem. 1999; 274: 10079-10085Abstract Full Text Full Text PDF PubMed Scopus (81) Google Scholar), resulting in much lower expression levels of the Δ11/N95 construct. As expected, all strains grew on plates containing arabinose due to the expression of chromosomal SecA (Fig. 4C, left plate, lower half). On glucose plates lacking IPTG, only the N95-expressing construct gave viable cells (middle plate, lower half). As expected, the incomplete repression of the promoter by the Lac repressor allowed N95 to be made at levels sufficient for growth. Immunoblotting showed that even in the absence of IPTG, N95 was still made in significant amounts (Supplementary Fig. S1). The Δ11/N95 construct did not support growth in the absence of IPTG, consistent with its negligible basal expression level (see Fig. 5D). In the presence of IPTG, both N95 and Δ11/N95 supported growth (right plate, lower half). Immunoblots showed that, in the presence of arabinose, the full-length SecA protein was synthesized from the chromosomal gene, whereas in the presence of IPTG and absence of arabinose, only the plasmidencoded Δ11/N95 protein was made (Fig. 4D, lane 2 versus lane 1). These data show that Δ11/N95 is responsible for cell growth under these conditions. We performed similar experiments using strain EO528, which differs from EO527 by harboring the prlA4 mutation in its chromosomal SecY gene (Fig. 4C, upper halves of the plates). Again, Δ11/N95 supported cell growth only in the presence of IPTG (compare right and middle plates). Interestingly, N95 supported growth in the absence but not in the presence of IPTG. This is explained by the massive overexpression of N95 in the presence of IPTG, which inhibits growth of strain EO528 (Supplemental Fig. S1). To compare the efficiency of Δ11/N95 with wild type SecA in a quantitative manner, we determined the growth rates of cells expressing similar levels of either protein. In the presence of arabinose, EO527 cells had a growth rate that approached that of the parental strain DY378 (Fig. 5A). In the absence of arabinose and presence of IPTG, plasmid-borne Δ11/N95 supported a growth rate that reached 85% of that of the parental strain DY378 (Fig. 5B). Immunoblotting for SecA showed that after induction, the levels of SecA and Δ11/N95 were about equal (Fig. 5, C versus D). These data therefore indicate that the monomeric derivative is a