Title: Inhibition of Rho Kinases Enhances the Degradation of Mutant Huntingtin
Abstract: Huntington disease (HD) is a fatal hereditary neurodegenerative disease caused by an expansion of the polyglutamine (polyQ) stretch in huntingtin (htt). Whereas the pathological significance of the expanded polyQ has been clearly established and a tremendous effort to develop therapeutic tools for HD has been exerted, there is yet no effective cure. Whereas many molecules able to reduce the polyQ accumulation and aggregation have been identified, including several Rho kinase (ROCK) inhibitors, it remains very important to determine the mechanism of action of the potential drugs. ROCK inhibitors, including Y-27632 were reported to decrease aggregation of htt and androgen receptor (AR) through ROCK1 and protein kinase C-related protein kinase-2 (PRK-2). A downstream effector of ROCK1, actin-binding factor profilin, was shown to inhibit the mutant htt aggregation but not AR by direct interaction. We found that the anti-aggregation effect of ROCK inhibitors was not limited to the mutant htt and AR and that Y-27632 was also able to reduce the aggregation of ataxin-3 and atrophin-1 with expanded polyQ. These results suggested that in addition to the mechanism reported for htt and AR, there might also be other common mediators involved in the reduced aggregation of different polyQ proteins. In this study, we show that Y-27632 not only reduced the mutant htt aggregation by enhancing its degradation, but surprisingly was able to activate the main cellular degradation pathways, proteasome, and macroautophagy. We also show that this unique effect was mediated by ROCK1 and ROCK2. Huntington disease (HD) is a fatal hereditary neurodegenerative disease caused by an expansion of the polyglutamine (polyQ) stretch in huntingtin (htt). Whereas the pathological significance of the expanded polyQ has been clearly established and a tremendous effort to develop therapeutic tools for HD has been exerted, there is yet no effective cure. Whereas many molecules able to reduce the polyQ accumulation and aggregation have been identified, including several Rho kinase (ROCK) inhibitors, it remains very important to determine the mechanism of action of the potential drugs. ROCK inhibitors, including Y-27632 were reported to decrease aggregation of htt and androgen receptor (AR) through ROCK1 and protein kinase C-related protein kinase-2 (PRK-2). A downstream effector of ROCK1, actin-binding factor profilin, was shown to inhibit the mutant htt aggregation but not AR by direct interaction. We found that the anti-aggregation effect of ROCK inhibitors was not limited to the mutant htt and AR and that Y-27632 was also able to reduce the aggregation of ataxin-3 and atrophin-1 with expanded polyQ. These results suggested that in addition to the mechanism reported for htt and AR, there might also be other common mediators involved in the reduced aggregation of different polyQ proteins. In this study, we show that Y-27632 not only reduced the mutant htt aggregation by enhancing its degradation, but surprisingly was able to activate the main cellular degradation pathways, proteasome, and macroautophagy. We also show that this unique effect was mediated by ROCK1 and ROCK2. Huntington disease (HD) 3The abbreviations used are: HD, Huntington disease; polyQ, polyglutamine; htt, huntingtin; AR, androgen receptor; DRPLA, dentatorubropallidoluysian atrophy; tNhtt, truncated N-terminal huntingtin; ROCK, Rho kinase; EGFP, enhanced green fluorescent protein; NLS, nuclear localization signal; mRFP, monomeric red fluorescence protein; Ub-dsRED, ubiquitinated discosoma red fluorescent protein; PI, propidium iodide; 3MA, 3-methyladenine; MEF, mouse embryonic fibroblasts; dbcAMP, N6, 2′-O-dibutyryladenosine-3′, 5′-cyclic monophosphate sodium salt; RT-PCR, reverse transcriptase PCR; ponA, ponasterone A; FTA, filter trap assay; PBS, phosphate-buffered saline; shRNA, short hairpin RNA; PGPH, peptidyl glutamyl peptide hydrolase; UPS, ubiquitin proteasome system; PEA, phosphatidylethanolamine; PRK-2, protein kinase C-related protein kinase-2; ANOVA, analysis of variance. is a dominantly transmitted neurodegenerative disorder involving the basal ganglia and cerebral cortex that typically strikes in midlife, where survival from onset to death averages 17-20 years. Its prevalence is around 5-10 cases per 100,000 worldwide, which makes it one of the most common inherited neurodegenerative disorders. The characteristic symptoms of HD are involuntary choreiform movements, cognitive impairment, mood disorders, and behavioral changes that are chronic and progressive over the course of the illness. The underlying gene defect was proved to be a CAG repeat encoding polyglutamine (polyQ) in exon 1 of a 348-kDa protein named huntingtin (htt) (1Myers R.H. NeuroRX. 2004; 1: 255-262Crossref PubMed Scopus (244) Google Scholar, 2The Huntington's Disease Collaborative Research GroupCell. 1993; 72: 971-983Abstract Full Text PDF PubMed Scopus (7074) Google Scholar). In the unaffected population, the number of CAG repeats varies from 6 to 34 while repeats of 36 or more define an HD allele. The variability of the pathological alleles is quite wide, ranging from 36 to 121 repeats, displaying an inverse correlation with onset age (3Orr H.T. Zoghbi H.Y. Annu. Rev. Neurosci. 2007; 30: 575-621Crossref PubMed Scopus (1101) Google Scholar). Endogenous wild-type htt was shown to be essential for the normal development and health of the individual, but its mutated form confers a toxic gain-of-function (4Leavitt B.R. van Raamsdonk J.M. Shehadeh J. Fernandes H. Murphy Z. Graham R.K. Wellington C.L. Raymond L.A. Hayden M.R. J. Neurochem. 2006; 96: 1121-1129Crossref PubMed Scopus (131) Google Scholar). In 1997, polyQ aggregates were reported in the brains of transgenic mice and in the postmortem brains from patients with HD in the form of nuclear inclusions (5Davies S.W. Turmaine M. Cozens B.A. DiFiglia M. Sharp A.H. Ross C.A. Scherzinger E. Wanker E.E. Mangiarini L. Bates G.P. Cell. 1997; 90: 537-548Abstract Full Text Full Text PDF PubMed Scopus (1912) Google Scholar, 6DiFiglia M. Sapp E. Chase K.O. Davies S.W. Bates G.P. Vonsattel J.P. Aronin N. Science. 1997; 277: 1990-1993Crossref PubMed Scopus (2319) Google Scholar). Several models have been proposed to explain the mechanism by which the mutant htt causes neuronal degeneration (7Landles C. Bates G.P. EMBO Rep. 2004; 5: 958-963Crossref PubMed Scopus (351) Google Scholar), for example impairment of transcription and gene expression (8Yamanaka T. Miyazaki H. Oyama F. Kurosawa M. Washizu C. Doi H. Nukina N. EMBO J. 2008; 27: 827-839Crossref PubMed Scopus (91) Google Scholar, 9Kegel K.B. Meloni A.R. Yi Y. Kim Y.J. Doyle E. Cuiffo B.G. Sapp E. Wang Y. Qin Z.H. Chen J.D. Nevins J.R. Aronin N. DiFiglia M. J. Biol. Chem. 2002; 277: 7466-7476Abstract Full Text Full Text PDF PubMed Scopus (220) Google Scholar, 10Nucifora Jr., F.C. Sasaki M. Peters M.F. Huang H. Cooper J.K. Yamada M. Takahashi H. Tsuji S. Troncoso J. Dawson V.L. Dawson T.M. Ross C.A. Science. 2001; 291: 2423-2428Crossref PubMed Scopus (944) Google Scholar, 11Steffan J.S. Kazantsev A. Spasic-Boskovic O. Greenwald M. Zhu Y.Z. Gohler H. Wanker E.E. Bates G.P. Housman D.E. Thompson L.M. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 6763-6768Crossref PubMed Scopus (878) Google Scholar), impairment of axonal transport and synaptic transmission (12Lee W.C. Yoshihara M. Littleton J.T. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 224-3229Google Scholar, 13Li H. Li S.H. Johnston H. Shelbourne P.F. Li X.J. Nat. Genet. 2000; 25: 385-389Crossref PubMed Scopus (260) Google Scholar, 14Usdin M.T. Shelbourne P.F. Myers R.M. Madison D.V. Hum. Mol. Genet. 1999; 8: 839-846Crossref PubMed Scopus (205) Google Scholar), suppression of energy metabolism (15Beal M.F. Ann. Neurol. 2005; 58: 495-505Crossref PubMed Scopus (778) Google Scholar, 16Ross C.A. Neuron. 2002; 35: 819-822Abstract Full Text Full Text PDF PubMed Scopus (445) Google Scholar), and induction of apoptosis (17Evert B.O. Wullner U. Klockgether T. Cell Tissue Res. 2000; 301: 189-204Crossref PubMed Scopus (67) Google Scholar). Although controversial, mutant htt has also been proposed to impair the ubiquitin proteasome system (UPS) (18Davies J.E. Sarkar S. Rubinsztein D.C. BMC Biochem. 2007; 8: S2Crossref PubMed Scopus (44) Google Scholar, 19Bence N.F. Sampat R.M. Kopito R.R. Science. 2001; 292: 1552-1555Crossref PubMed Scopus (1821) Google Scholar, 20Jana N.R. Zemskov E.A. Wang G. Nukina N. Hum. Mol. Genet. 2001; 10: 1049-1059Crossref PubMed Scopus (384) Google Scholar, 21Bennett E.J. Bence N.F. Jayakumar R. Kopito R.R. Mol. Cell. 2005; 17: 351-365Abstract Full Text Full Text PDF PubMed Scopus (411) Google Scholar). Despite enormous progress in elucidating the molecular pathology of HD, the prognosis for patients has improved little since the first description of this disease, thus no effective treatments for HD patients have been developed. Rho-associated kinases (ROCKs) are Ser/Thr protein kinases, which were found to be downstream targets of the small GTPase RhoA GTPase (22Ishizaki T. Maekawa M. Fujisawa K. Okawa K. Iwamatsu A. Fujita A. Watanabe N. Saito Y. Kakizuka A. Morii N. Narumiya S. EMBO J. 1996; 15: 1885-1893Crossref PubMed Scopus (792) Google Scholar, 23Leung T. Manser E. Tan L. Lim L. J. Biol. Chem. 1995; 270: 29051-29054Abstract Full Text Full Text PDF PubMed Scopus (635) Google Scholar, 24Matsui T. Amano M. Yamamoto T. Chihara K. Nakafuku M. Ito M. Nakano T. Okawa K. Iwamatsu A. Kaibuchi K. EMBO J. 1996; 15: 2208-2216Crossref PubMed Scopus (938) Google Scholar). In the mammalian system, ROCKs consist of two isoforms. ROCK1 (ROKβ, p160ROCK) is located on chromosome 18 and encodes a 1,354-amino acid protein (22Ishizaki T. Maekawa M. Fujisawa K. Okawa K. Iwamatsu A. Fujita A. Watanabe N. Saito Y. Kakizuka A. Morii N. Narumiya S. EMBO J. 1996; 15: 1885-1893Crossref PubMed Scopus (792) Google Scholar). ROCK2 (ROKα), is located on chromosome 12 and contains 1,388 amino acids (25Riento K. Ridley A.J. Nat. Rev. Mol. Cell Biol. 2003; 4: 446-456Crossref PubMed Scopus (1567) Google Scholar). The ROCKs are important regulators of cell growth, migration, and apoptosis via control of actin cytoskeletal assembly. They regulate cell contraction through serine-threonine phosphorylation of adducin, ezrin-radixin-moesin (ERM) proteins, LIM kinase, myosin light chain phosphatase (MLCP), and Na/H exchanger 1 (NHE-1) (25Riento K. Ridley A.J. Nat. Rev. Mol. Cell Biol. 2003; 4: 446-456Crossref PubMed Scopus (1567) Google Scholar, 26Denker S.P. Huang D.C. Orlowski J. Furthmayr H. Barber D.L. Mol. Cell. 2000; 6: 1425-1436Abstract Full Text Full Text PDF PubMed Scopus (360) Google Scholar). RhoA/ROCK was shown to regulate the intracellular localization and phosphorylation of phosphatase and tensin homolog (PTEN), and RhoA/ROCK-mediated phosphorylation of PTEN is required for the phospholipid phosphatase activity of PTEN that antagonizes PI3K-mediated Akt signaling (27Li Z. Dong X. Wang Z. Liu W. Deng N. Ding Y. Tang L. Hla T. Zeng R. Li L. Wu D. Nat. Cell Biol. 2005; 7: 399-404Crossref PubMed Scopus (395) Google Scholar). The RhoA/ROCK pathway was also reported to be implicated in the Aβ42 processing (28Zhou Y. Su Y. Li B. Liu F. Ryder J.W. Wu X. Gonzalez-DeWhitt P.A. Gelfanova V. Hale J.E. May P.C. Paul S.M. Ni B. Science. 2003; 302: 1215-1217Crossref PubMed Scopus (309) Google Scholar). Using APPswe-expressing Neuro2a mouse neuroblastoma cells, it was demonstrated that ROCK modulates shedding of sAPPα induced by statins. Constitutively active ROCK mutant attenuated sAPPα shedding from both untreated and statin-treated cells, whereas a ROCK mutant without kinase activity activated sAPPα shedding (29Pedrini S. Carter T.L. Prendergast G. Petanceska S. Ehrlich M.E. Gandy S. PLoS Med. 2005; 2: e18Crossref PubMed Scopus (133) Google Scholar). Calorie restriction (CR)-induced SIRT1 expression promotes α-secretase activity, sAPPα generation, and diminishes Aβ generation by neurons from Tg2576 mice and CHO cells expressing APPswe. This effect of SIRT1 appears to be dependent on ROCK1 (30Qin W. Yang T. Ho L. Zhao Z. Wang J. Chen L. Zhao W. Thiyagarajan M. MacGrogan D. Rodgers J.T. Puigserver P. Sadoshima J. Deng H. Pedrini S. Gandy S. Sauve A.A. Pasinetti G.M. J. Biol. Chem. 2006; 281: 21745-21754Abstract Full Text Full Text PDF PubMed Scopus (538) Google Scholar). The inhibition of ROCK activation was reported to be also an efficacious approach for the treatment of acute ischemic stroke (31Satoh S. Toshima Y. Hitomi A. Ikegaki I. Seto M. Asano T. Brain Res. 2008; 1193: 102-108Crossref PubMed Scopus (48) Google Scholar). Blocking the RhoA/ROCK pathway has been shown to markedly inhibit the polyQ protein aggregation and decrease its toxicity in cellular and Drosophila model of HD (32Pollitt S.K. Pallos J. Shao J. Desai U.A. Ma A.A.K. Thompson L.M. Marsh J.L. Diamond M.I. Neuron. 2003; 40: 685-694Abstract Full Text Full Text PDF PubMed Scopus (134) Google Scholar). ROCK1 and protein kinase C-related protein kinase-2 (PRK-2) have been identified to be the mediators of aggregation inhibition by Y-27632 (33Shao J. Welch W.J. Diamond M.I. FEBS Lett. 2008; 582: 1637-1642Crossref PubMed Scopus (25) Google Scholar). Moreover, a downstream effector of ROCK1, actin-binding factor profilin, was reported to inhibit the mutant htt aggregation by direct interaction via its polyproline-binding domain (34Shao J. Welch W.J. Dispropero N.A. Diamond M.I. Mol. Cell Biol. 2008; 28: 5196-5208Crossref PubMed Scopus (126) Google Scholar). Unlike htt, the inhibition of the mutant androgen receptor (AR) aggregation by profilin was not mediated by direct interaction (34Shao J. Welch W.J. Dispropero N.A. Diamond M.I. Mol. Cell Biol. 2008; 28: 5196-5208Crossref PubMed Scopus (126) Google Scholar). We tested the effect of Y-27632 on several proteins with expanded polyQ and it was able to efficiently reduce the aggregation of these proteins. In addition to htt and AR, the tested proteins included mutant full-length and truncated ataxin-3 and full-length atrophin-1 with expanded polyQ (Fig. 1). Therefore in this study we investigated whether there might be a common mechanism by which the chemical ROCK inhibition leads to the reduced polyQ aggregation. We found that enhanced degradation of expanded polyQ protein largely contributes to this effect. Surprisingly, both major degradation systems, UPS and macroautophagy (hereafter referred to as autophagy), appeared to be activated by ROCK inhibition, and involved in reducing the polyQ aggregation. Materials—The ROCK inhibitors Y-27632, HA1077, and H89 were obtained from Sigma. H-1152, propidium iodide (PI), and the autophagy activator, rapamycin (35Ravikumar B. Vacher C. Berger Z. Davies J.E. Luo S. Oroz L.G. Scaravilli F. Easton D.F. Duden R. O'Kane C.J. Rubinsztein D.C. Nat. Genet. 2004; 36: 585-595Crossref PubMed Scopus (1989) Google Scholar) were from Calbiochem. Fluorescent nucleic acid stain Hoechst 33258 was from Molecular Probes. MG-132 (Z-Leu-Leu-Leu-aldehyde) was from Wako Chemicals and 3-methyladenine (3MA) was from Sigma. Mouse monoclonal antibody specific for N-terminal of huntingtin (EM48) and rat monoclonal anti-β-tubulin antibodies were from Chemicon. Anti-LC3, anti-GFP, and anti-RFP antibodies were from MBL and anti-ubiquitin antibody was from DAKO. Mouse monoclonal anti-ROCK1 and anti-ROCK2 antibodies were purchased from BD Transduction Laboratories and anti-ATG5 antibody was kindly provided by Dr. Mizushima. All other chemicals were from Sigma or Nacalai tesque unless otherwise specified. Plasmids—Plasmids encoding the truncated N-terminal of human huntingtin (tNhtt) with 16, 60, and 150 glutamine repeats were introduced in pEGFP-N1 vector as previously described (36Wang G.H. Mitsui K. Kotliarova S. Yamashita A. Nagao Y. Tokuhiro S. Iwatsubo T. Kanazawa I. Nukina N. Neuroreport. 1999; 10: 2435-2438Crossref PubMed Scopus (82) Google Scholar). The construction of plasmids encoding human truncated or full-length ataxin-3 containing 130Q (in pEGFP-N1 vector) was described previously (37Wang G.H. Sawai N. Kotliarova S. Kanazawa I. Nukina N. Hum. Mol. Genet. 2000; 9: 1795-1803Crossref PubMed Scopus (135) Google Scholar). Human androgen receptor with 23Q (AR23Q) was amplified from human brain cDNA library by PCR using a set of primers BglII-AR-Fw (5′-AAAAGATCTATGGAAGTGCAGTTAGGGCT-3′) and SalI-AR-Rv (5′-AAAAAAGTCGACCTGGGTGTGGAAATAGATGG-3′), cleaved by BglII and SalI, and introduced into the BglII-SalI sites of the pEGFP-C1 vector (EGFP-AR23Q). The CAG repeat tract of EGFP-AR23Q was expanded via a method previously described (38Peters M.F. Ross C.A. Neurosci. Lett. 1999; 275: 129-132Crossref PubMed Scopus (16) Google Scholar). A primer set, BglII-AR-Fw and MmeI-AR-exp-Rv (CATCCTCACCCTGCTGCTGCTCCAACTGCCTGGGG) was used to amplify the 5′-coding sequence including the CAG repeat tract. Another primer set, MmeI-AR-exp-Fw (AGGCCGCGAGCGCAGCACCTTCCGACGCCAGTTTG) and AR-630Rv (TCTCCCGCTGCTGCTGCCTT) was used to amplify the CAG tract and its 3′-flanking region. These two fragments were digested by MmeI (New England Biolabs), gel-purified, and treated with T4 DNA ligase to connect them at their CAG repeat tracts. The ligated fragment was gel-purified and amplified by PCR using BglII-AR-Fw and AR-630Rv primers, and digested by BglII and AflII. The resulting fragment was ligated with EGFP-AR. By two cycles of expansion, EGFP-AR45Q and EGFP-AR99Q were obtained. The N terminus fragment of AR99Q, was amplified by PCR using primers BglII-AR-Fw and SalI-AR-396Rv (AAAAAAGTCGACGACGCAACCTCTCTCGGGGT), cleaved by BglII and SalI, and subcloned into the BglII-SalI sites of the pEGFP-C1. EGFP-DRPLA construct encoding atrophin-1 with Gln-71 was described previously (39Tadokoro K. Yamazaki-Inoue M. Tachibana M. Fujishiro M. Nagao K. Toyoda M. Ozaki M. Ono M. Miki N. Miyashita T. Yamada M. J. Hum. Genet. 2005; 50: 382-394Crossref PubMed Scopus (53) Google Scholar) and was kindly provided by Dr. Masao Yamada. To prepare pcDNA3.1-tNhtt-60Q-EGFP for transient transfection, tNhtt-polyQ-EGFP fragment was cut from pIND-tNhtt-polyQ-EGFP (40Zemskov E.A. Jana N.R. Kurosawa M. Miyazaki H. Sakamoto N. Nekooki M. Nukina N. J. Neurochem. 2003; 87: 395-406Crossref PubMed Scopus (20) Google Scholar) with HindIII-XbaI digestion, and the resulting fragment was inserted into pcDNA3.1-v5/His plasmid. The monomeric red fluorescence protein (mRFP) (41Machida Y. Okada T. Kurosawa M. Oyama F. Ozawa K. Nukina N. Biochem. Biophys. Res. Commun. 2006; 343: 190-197Crossref PubMed Scopus (117) Google Scholar) and the ubiquitinated (Ub) Discosoma Red fluorescent protein (dsRed)2/N1 plasmids (42Khan L.A. Bauer P.O. Miyazaki H. Lindenberg K.S. Landwehrmeyer B.G. Nukina N. J. Neurochem. 2006; 98: 576-587Crossref PubMed Scopus (48) Google Scholar) were previously described. Cell Culture and Treatment—Mouse neuroblastoma (Neuro2a; N2a) cells lines stably transfected with inducible expression of tNhtt-16Q-EGFP, tNhtt-60Q-EGFP, tNhtt-150Q-EGFP, and tNhtt-150Q-NLS-EGFP, which express a cDNA encoding htt exon 1 containing 16, 60 or 150 CAG repeats and fused with EGFP and eventually nuclear localization signal (NLS) (43Doi H. Mitsui K. Kurosawa M. Machida Y. Kuroiwa Y. Nukina N. FEBS Lett. 2004; 571: 171-176Crossref PubMed Scopus (84) Google Scholar), were previously established using the ecdysone-inducible mammalian expression system (Invitrogen) (36Wang G.H. Mitsui K. Kotliarova S. Yamashita A. Nagao Y. Tokuhiro S. Iwatsubo T. Kanazawa I. Nukina N. Neuroreport. 1999; 10: 2435-2438Crossref PubMed Scopus (82) Google Scholar, 40Zemskov E.A. Jana N.R. Kurosawa M. Miyazaki H. Sakamoto N. Nekooki M. Nukina N. J. Neurochem. 2003; 87: 395-406Crossref PubMed Scopus (20) Google Scholar). Neuro2a and mouse embryonic fibroblasts (MEFs) were maintained in Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 10% heat-inactivated fetal bovine serum (Sigma), 100 units/ml penicillin, and 100 μg/ml streptomycin (Invitrogen) at 37 °C in an atmosphere containing 5% CO2 and 95% air. Neuro2a cells were induced to express tNhtt-polyQ with 1 μm ponasterone A (ponA, Invitrogen) and differentiated to neuronal phenotype with 5 mm N6, 2′-O-dibutyryladenosine-3′, 5′-cyclic monophosphate sodium salt (dbcAMP) (Nacalai tesque). The differentiation status of the Neuro2 cells treated with dbcAMP is shown in supplemental Fig. S1. Except for the chase experiments, the cells were incubated with drugs at the time of differentiation and induction. MEFs were induced to ATG5(-/-) phenotype with 10 ng/ml doxycycline for 5 days as previously described (44Hosokawa N. Hara Y. Mizushima N. FEBS Lett. 2006; 580: 2623-2629Crossref PubMed Scopus (232) Google Scholar). Cells were transfected when they reached about 70-80% confluence. Transfection by Lipofectamine 2000 (Invitrogen) was done in accordance to the manufacturer's protocol in 24-well plates. Cells were used for experiments at indicated times after transfection. Cell Death Assay—For quantification of cell death, 5 μg/ml each of Hoechst 33342 and PI were added to differentiated and induced Neuro2a cultures incubated with ROCK inhibitors. After 10 min at 37 °C, the PI-positive cells were quantified with ArrayScan (Cellomics). RNA Interference—Each sense and antisense template short hairpin RNA (shRNA) for ROCK1 and ROCK2 was purchased from Operon, annealed and ligated into pSilencer1.0 vector with U6 promotor according to the manufacturer's instructions (Ambion). The target sequences were as follows: ROCK1, 5′-AAGTAGTGACATTGATACTAG-3′; ROCK2, 5′-AACAATAGAGATCTACAAGAT-3′. The plasmids containing shRNA were sequence-verified. Plasmids were transfected into Neuro2a cells using Lipofectamine 2000. Ater 2 days of silencing, cells were induced. ArrayScan Quantification—For the inclusions (visible aggregates) quantification, cells were grown in 24-well plates for indicated periods, fixed in 4% paraformaldehyde, washed, and incubated with Hoechst 33258 at 1:1000 dilution in PBS. Cells were analyzed with ArrayScan®VTI High Content Screening (HCS) Reader using Target Activation BioApplication (TABA). TABA analyzes images acquired with an HCS Reader and provides measurements of the intracellular fluorescence intensity and localization on a cell-by-cell basis. In each well, more than 10,000 cells were counted and quantified for the presence of the inclusions. Nuclei stained by Hoechst 33285 provided the autofocus target and a count gave the exact number of the quantified cells. The screening itself consisted of two scans using Hoechst and fluorescein isothiocyanate (for GFP) fluorescence. First, the number of inclusions was calculated when fluorescent spots of at least 5 pixels (magnification 20× for cytoplasmic and 40× for nuclear aggregates) and an average GFP intensity of more than 1500 were labeled as inclusions. Nuclei were then defined as the objects of interest and their number determined. The percentage of the cells with inclusions was then calculated. The reliability of the inclusion quantification by ArraScan was validated by test-counting of inclusions by eyes (supplemental Fig. S2). The number of mRFP- or Ub-dsRED-positive cells and fluorescent intensity was quantified by single scan by detecting the red fluorescence of each cell in the perinuclear region within a distance of 3 pixels from the nucleus. When the average intensity exceeded 50, the cell was considered mRFP/Ub-dsRED-positive. Scanning was performed with three or four times in each experimental condition. Data were generated from the quantification of more than 250,000 cells in each experimental set-up. TaqMan Reverse Transcriptase-PCR (RT-PCR)—Total RNA and cDNAs were prepared from Neuro2a cells as described previously (45Oyama F. Kotliarova S. Harada A. Ito M. Miyazaki H. Ueyama Y. Hirokawa N. Nukina N. Ihara Y. J. Biol. Chem. 2004; 279: 27272-27277Abstract Full Text Full Text PDF PubMed Scopus (25) Google Scholar). The TaqMan primer and probe sets were designed and synthesized based on Primer Express Software (Applied Biosystems). The nucleotide sequences of the primers for EGFP were as follows: forward 5′-AGCAAAGACCCCAACGAGAA-3′, reverse 5′-GGCGGCGGTCACGAA-3′, TaqMan probe 5′-CGCGATCACATGGTCCTGCTGG-3′; TaqMan RT-PCR was performed as described previously (46Kotliarova S. Jana N.R. Sakamoto N. Kurosawa M. Miyazaki H. Nekooki M. Doi H. Machida Y. Wong H.K. Suzuki T. Uchikawa C. Kotliarov Y. Uchida K. Nagao Y. Nagaoka U. Tamaoka A. Oyanagi K. Oyama F. Nukina N. J. Neurochem. 2005; 93: 641-653Crossref PubMed Scopus (67) Google Scholar). All values obtained were normalized against the levels of β-actin using the following primers: forward 5′-TCTTTGCAGCTCCTTCGTTG-3′, reverse 5′-ATCGTCATCCATGGCGAAC-3′, TaqMan probe 5′-CGGTCCACACCCGCCACC-3′. Chase Experiments—To determine whether soluble tNhtt-polyQ degrades faster in the presence of ROCK inhibitors, chase experiments were performed. Neuro2a cells were first differentiated and induced to express tNhtt-polyQ for 24 h in case of 16Q and 60Q and 16 h in case of 150Q cells. Thereafter, ponA was removed, the cells were washed, and incubated in a medium containing dbcAMP (for maintaining differentiation status) with either water (control) or ROCK inhibitors at 20 μm concentration for 4 or 5 days. Medium was replaced every 2 days with the same concentration of the drugs, and cells were collected everyday. The cells were subsequently lysed, and the levels of tNhtt-polyQ analyzed using Western blotting. Western Blot Analysis—Cells were washed twice with ice-cold PBS, scraped, and resuspended in lysis buffer (0.5% Triton X-100 in PBS, 0.5 mm phenylmethylsulfonyl fluoride, Complete protease inhibitor mixture (Roche Applied Sciences). After incubating on ice for 30 min lysates were briefly sonicated. Protein concentrations were determined according to the method of Bradford using Bio-Rad protein assay reagent (Bio-Rad). Equal amounts of protein were boiled for 5 min in 2× SDS-sample buffer and then separated by 5-12% gradient SDS-PAGE and electrophoretically transferred to a polyvinylidene difluoride (polyvinylidene difluoride) membrane. The membranes were blocked in 5% skim milk in 0.05% Tween 20/Tris-buffered saline (TBS-T) and then incubated with primary antibody (dilutions in accordance with manufacturer's recommendations) overnight at 4 °C. The membranes were washed three times in TBS-T and incubated for 1 h with horseradish peroxidase-conjugated secondary antibody (dilution 1:5000). Immunoreactive proteins were detected with enhanced chemiluminescence reagents (Amersham Biosciences). Filter Trap Assay (FTA)—FTA was performed using a Hybri-Dot manifold (Bio-Rad) and cellulose acetate membrane filter with a pore size of 0.2 μm (Advantec). The cell lysates were prepared as for Western blotting. The same amount of protein from each experimental condition was diluted to 100 μl of PBS with 2% SDS and applied to the membrane. Soluble proteins were removed by vacuum suction while the SDS-resistant aggregates stayed trapped. Wells were washed three times with 2% SDS/PBS, and suction was maintained for 20 min to allow thorough and complete trapping of SDS insoluble material. Membranes were subsequently blocked with 5% skim milk, and immunostaining was performed. In Vitro UPS Activity Assay—Neuro2a cells were transfected with ROCK1 and/or ROCK2 shRNA and 2 days later, 10 μm MG-132 was added. Eighteen hours later, cells were collected, and 5 μg of total protein from each lysate was pipetted to 96-well plate and 100 μl of fluorogenic UPS substrate I (trypsin-like activity) or II (peptidyl glutamyl peptide hydrolase (PGPH)-like activity) (Calbiochem). Plates were placed in the Arvo MX 1420 Multilabel Counter (Perkin Elmer), and absorbance was detected at 460 nm. Statistical Analysis—We used the unpaired Student's t test for comparison between two samples. One-way ANOVA Fisher's test followed by Tukey's HSD test or two-way ANOVA test with pairwise contrast were performed using XLSTAT or Partek Genomic Solution Software. The statistical significance was confirmed by the non-parametric Mann-Whitney test where indicated. We considered the difference between comparisons to be significant when p < 0.05 for all the statistical analyses. ROCK Inhibitors Inhibit PolyQ Aggregation—First, we investigated whether the effect of Y-27632 on polyQ aggregation is limited to htt and AR or if it is also able to inhibit the aggregation of other polyQ-containing proteins. We found that beside htt and AR, Y-27632 decreased the aggregation of truncated and full-length ataxin-3 and atrophin-1 in a dose-dependent manner (Fig. 1). To test whether the polyQ aggregation is decreased by more ROCK inhibitors or whether it is a specific effect of Y-27632, we examined four different drugs inhibiting ROCK. The ArrayScan analysis revealed that all of them were able to decrease the polyQ aggregation in 150Q and 150Q-NLS Neuro2a cells after 1 or 2 days of differentiation and induction in a dose-dependent manner (Fig. 2, A-D). The 150Q-NLS cell line was examined after 2 days because the nuclear inclusion formation sufficient for ArrayScan analysis did not appear earlier. Y-27632, H-1152, and HA1077 were very efficient in both cell lines, while H89 did not have so strong effect after 2 days of treatment. These results were confirmed by Western blot, as shown in a representative Western blot in Fig. 2E for Y-27632 and H-1152. Next, we examined the effect of Y-27632 on the polyQ-mediated cytotoxicity. After 3 days of 150Q and 150Q-NLS expression in Neuro2a cells, Y-27632 was able to decrease the percentage of propidium iodide-positive cells in both cell lines (Fig. 2F). These data confirmed the inhibitory effect of ROCK inhibitors on polyQ aggregation and polyQ cytotoxicity. Y-27632 Decreases the Level of PolyQ Protein—Because the decrease in insoluble form of p