Title: Translocation of N-WASP by Nuclear Localization and Export Signals into the Nucleus Modulates Expression of HSP90
Abstract: N-WASP regulates the actin cytoskeleton through activation of the Arp2/3 complex. N-WASP localizes at the cell periphery, where it controls actin polymerization downstream of signal molecules such as adapter proteins, Cdc42, Src family kinases, and phosphoinositides. N-WASP also localizes in the nucleus; however, the role of N-WASP in the nucleus is unclear. Here, we show that localization of N-WASP is controlled through phosphorylation by Src family kinases in which phosphorylated N-WASP is exported from the nucleus in a nuclear export signal (NES) and leptomycin B-dependent manner. N-WASP had nuclear localization signal (NLS) at its basic region and NES close to the phosphorylation site by Src family kinases, indicating that phosphorylation controls the accessibility to the NES through conformational changes. Increased levels of unphosphorylated N-WASP in the nucleus suppressed expression of HSP90 and transcription from a heat shock element (HSE). N-WASP bound heat shock transcription factor (HSTF) and enhanced the HSTF association with HSE. In addition, nuclear N-WASP was present in the protein complex that associates with HSE, suggesting that N-WASP participates in suppression of HSP90 transcription. Increased levels of unphosphorylated N-WASP also decreased the activities of Src family kinases in cells but not in experiments in vitro with pure N-WASP and Fyn. Because HSP90 is essential for the activities of Src family kinases, these results suggest that localization of N-WASP modulates Src kinase activity by regulating HSP90 expression. N-WASP regulates the actin cytoskeleton through activation of the Arp2/3 complex. N-WASP localizes at the cell periphery, where it controls actin polymerization downstream of signal molecules such as adapter proteins, Cdc42, Src family kinases, and phosphoinositides. N-WASP also localizes in the nucleus; however, the role of N-WASP in the nucleus is unclear. Here, we show that localization of N-WASP is controlled through phosphorylation by Src family kinases in which phosphorylated N-WASP is exported from the nucleus in a nuclear export signal (NES) and leptomycin B-dependent manner. N-WASP had nuclear localization signal (NLS) at its basic region and NES close to the phosphorylation site by Src family kinases, indicating that phosphorylation controls the accessibility to the NES through conformational changes. Increased levels of unphosphorylated N-WASP in the nucleus suppressed expression of HSP90 and transcription from a heat shock element (HSE). N-WASP bound heat shock transcription factor (HSTF) and enhanced the HSTF association with HSE. In addition, nuclear N-WASP was present in the protein complex that associates with HSE, suggesting that N-WASP participates in suppression of HSP90 transcription. Increased levels of unphosphorylated N-WASP also decreased the activities of Src family kinases in cells but not in experiments in vitro with pure N-WASP and Fyn. Because HSP90 is essential for the activities of Src family kinases, these results suggest that localization of N-WASP modulates Src kinase activity by regulating HSP90 expression. The Wiskott-Aldrich syndrome protein (WASP) 1The abbreviations used are: WASP, Wiskott-Aldrich syndrome protein; N-WASP, neural WASP; HSP90, heat shock protein 90; HSE, heat shock element; HSTF/HSF, heat shock transcription factor/heat shock factor; Arp2/3, actin-related protein 2/3; GST, glutathione S-transferase; GFP, green fluorescent protein; VCA, verprolin-homology, cofilin-homology, and acidic domain; CA, constitutively active; DN, dominant negative; LMB, leptomycin B; NLS, nuclear localization signal; NES, nuclear export signal; CMV, cytomegalovirus; EF, elongation factor; EGF, epidermal growth factor; IQ motif, calmodulin binding motif; CRIB, Cdc42/Rac interactive binding. family of proteins includes two WASP proteins, WASP, which is restricted to the hematopoietic cells, and ubiquitous neural Wiskott-Aldrich syndrome Invitrogenrotein (N-WASP) (1Derry J.M. Ochs H.D. Francke U. Cell. 1994; 78: 635-644Abstract Full Text PDF PubMed Scopus (839) Google Scholar, 2Miki H. Miura K. Takenawa T. EMBO J. 1996; 15: 5326-5335Crossref PubMed Scopus (556) Google Scholar) and three WASP family verprolin-homologous proteins (WAVEs) (3Miki H. Suetsugu S. Takenawa T. EMBO J. 1998; 17: 6932-6941Crossref PubMed Scopus (576) Google Scholar, 4Suetsugu S. Miki H. Takenawa T. Biochem. Biophys. Res. Commun. 1999; 260: 296-302Crossref PubMed Scopus (211) Google Scholar), which transmit signals for de novo actin nucleation mediated by Arp2/3 complex at the cell periphery (5Rohatgi R. Ma L. Miki H. Lopez M. Kirchhausen T. Takenawa T. Kirschner M.W. Cell. 1999; 97: 221-231Abstract Full Text Full Text PDF PubMed Scopus (1082) Google Scholar, 6Machesky L.M. Mullins R.D. Higgs H.N. Kaiser D.A. Blanchoin L. May R.C. Hall M.E. Pollard T.D. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 3739-3744Crossref PubMed Scopus (617) Google Scholar). These proteins participate in actin reorganization processes involving formation of filopodia and lamellipodia (7Suetsugu S. Miki H. Takenawa T. Cell Motil. Cytoskeleton. 2002; 51: 113-122Crossref PubMed Scopus (55) Google Scholar, 8Takenawa T. Miki H. J. Cell Sci. 2001; 114: 1801-1809Crossref PubMed Google Scholar). Interestingly, N-WASP and WASP are also localized in the nucleus (2Miki H. Miura K. Takenawa T. EMBO J. 1996; 15: 5326-5335Crossref PubMed Scopus (556) Google Scholar). WASP-interacting protein (WIP) recruits nuclear N-WASP to cytoplasm to induce filopodium formation (9Vetterkind S. Miki H. Takenawa T. Klawitz I. Scheidtmann K.H. Preuss U. J. Biol. Chem. 2002; 277: 87-95Abstract Full Text Full Text PDF PubMed Scopus (35) Google Scholar). The VCA (verprolin-homology, cofilin-homology, and acidic) domain of N-WASP and WASP not only associates with actin and Arp2/3 complex but also with the middle region of N-WASP or WASP, by intramolecular interactions. It has been postulated that the association between the VCA region and the middle region of N-WASP yields an autoinhibited structure (10Miki H. Sasaki T. Takai Y. Takenawa T. Nature. 1998; 391: 93-96Crossref PubMed Scopus (567) Google Scholar, 11Rohatgi R. Ho H.Y. Kirschner M.W. J. Cell Biol. 2000; 150: 1299-1310Crossref PubMed Scopus (499) Google Scholar, 12Prehoda K.E. Scott J.A. Mullins D.R. Lim W.A. Science. 2000; 290: 801-806Crossref PubMed Scopus (417) Google Scholar, 13Higgs H.N. Pollard T.D. J. Cell Biol. 2000; 150: 1311-1320Crossref PubMed Scopus (419) Google Scholar). Upon association with Cdc42 and/or phosphoinositides or phosphorylation of N-WASP by Src family kinases, the autoinhibition of N-WASP is released. However, the relation between N-WASP conformation and localization is not clear. Src family kinases have roles in controlling the actin cytoskeleton, but they also promote proliferation of cells. Therefore, mutations that activate Src family kinases induce transformation of cells. The activity of Src family kinases is controlled in a variety of ways, including phosphorylation, dephosphorylation (14Brown M.T. Cooper J.A. Biochim. Biophys. Acta. 1996; 1287: 121-149Crossref PubMed Scopus (1086) Google Scholar, 15Thomas S.M. Brugge J.S. Annu. Rev. Cell Dev. Biol. 1997; 13: 513-609Crossref PubMed Scopus (2175) Google Scholar), and ubiquitin-dependent protein degradation by proteasomes (16Harris K.F. Shoji I. Cooper E.M. Kumar S. Oda H. Howley P.M. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 13738-13743Crossref PubMed Scopus (144) Google Scholar, 17Oda H. Kumar S. Howley P.M. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 9557-9562Crossref PubMed Scopus (138) Google Scholar, 18Hakak Y. Martin G.S. Curr. Biol. 1999; 9: 1039-1042Abstract Full Text Full Text PDF PubMed Scopus (108) Google Scholar). Molecular chaperones, such as HSP90, also play the important roles in proper activation of Src family kinases. Loss of HSP90 activity due to a specific inhibitor of HSP90, geldanamycin, results in the loss of Src family kinase activity. Src and HSP90 form a complex that promotes transformation of cells (19Uehara Y. Hori M. Takeuchi T. Umezawa H. Mol. Cell Biol. 1986; 6: 2198-2206Crossref PubMed Scopus (234) Google Scholar, 20Whitesell L. Mimnaugh E.G. De Costa B. Myers C.E. Neckers L.M. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 8324-8328Crossref PubMed Scopus (1337) Google Scholar). In the present study, we investigated the role of N-WASP in the nucleus. Localization of N-WASP is affected by its phosphorylation by Src family kinases (21Suetsugu S. Hattori M. Miki H. Tezuka T. Yamamoto T. Mikoshiba K. Takenawa T. Dev. Cell. 2002; 3: 645-658Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar). Phosphorylated N-WASP tends to localize in the cytoplasm, whereas unphosphorylated N-WASP localizes predominantly in the nucleus. Comparison of the amounts of transcripts from cells expressing an N-WASP mutant lacking a phosphorylation site and those from cells expressing a phosphorylation-mimic mutant of N-WASP revealed that N-WASP is involved in transcription of HSP90. Analysis of several cell lines expressing mutant N-WASP and transcription from a heat shock element (HSE) suggest that N-WASP is a negative regulator of HSP90 expression. This effect of N-WASP appears to be inhibited when N-WASP is phosphorylated and exported from the nucleus. Cell Culture—COS-7 cells were cultured as described previously (22Suetsugu S. Miki H. Takenawa T. EMBO J. 1998; 17: 6516-6526Crossref PubMed Scopus (194) Google Scholar). Transfection was done with LipofectAMINE 2000 (Invitrogen) according to the manufacture's instructions. Localization of N-WASP was analyzed by GFP fluorescence or indirect immunofluorescence with anti-N-WASP antibody. Heat shock was performed at 44°C for 30 min followed by the recovery of cells at 37°C for 90 min. Tet-off HEK293 cells were purchased from Clontech. The stably transfected HEK293 cell lines were established according to the manufacturer's instruction. Doxycycline (1 μg/ml) was used as an alternative to tetracycline to suppress transgene expression. DNA Microarray—HEK293 cells were transfected with GFP-Y253F N-WASP or GFP-Y253E N-WASP. About 10 μg of plasmid was introduced by electroporation (Bio-Rad). Transfected cells were harvested, and mRNA was purified with the RNeasy kit (Qiagen) followed by the Quickprep micro mRNA purification kit (Amersham Biosciences). After checking the quality of mRNA by electrophoresis, Cy3- and Cy5-labeled cDNA probes were generated with a Fluorescence Labeling core kit (Takara). The qualities of these probes for hybridization on microarrays were confirmed with Test Array (Takara). The probes were then hybridized on IntelliGene Human CHIP 1K Set I version 1.0 (Takara). Microarray signals were acquired with Scan Array Lite (Packard BioChip Technologies). Signals were calibrated to housekeeping genes spotted on the chip (see "DNA Microassay Analysis of Cells Expressing Y253F N-WASP or Y253E N-WASP"). Spots with signal intensities more than twice the level of the standard deviation of background signal were selected for further analysis (23Phimister B. Nat. Genet. 1999; 22: 318Crossref PubMed Scopus (1) Google Scholar). Statistical significance of expressional changes was determined by using Student's t test of signal intensities against standard genes (p < 0.05). Luciferase Assay—The sequence from the promoter region of HSP89alpha (HSP90alpha) with heat shock element (HSE) and TATA box was cloned into pGL-basic vector (Promega). The sequence is as follows: ggttcttccggaagttggggaggcttctggaaaaagcgccgcgcgctgggcgggcccgtggctatataaggcaggcgcgggggtggcgcg. After co-transfection of plasmids for N-WASP expression and HSE reporter plasmids at a ratio of 3:1, cells were harvested, and the luciferase activity was determined with a Luciferase Assay kit (Stratagene). The luciferase activity was normalized to the total amount of protein determined by Bradford assay (Bio-Rad). Proteins—Full-length or truncated (1-204 amino acids) human heat-shock transcription factor/heat-shock factor 1 (HSTF1) was subcloned into pGEX (Amersham Biosciences). GST fusion proteins were expressed in Escherichia coli BL21 (Stratagene), purified, and the GST tag was removed as described previously (22Suetsugu S. Miki H. Takenawa T. EMBO J. 1998; 17: 6516-6526Crossref PubMed Scopus (194) Google Scholar). Fyn and N-WASP were obtained as described previously (21Suetsugu S. Hattori M. Miki H. Tezuka T. Yamamoto T. Mikoshiba K. Takenawa T. Dev. Cell. 2002; 3: 645-658Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar). Gel-mobility Shift Assay—Nuclear fractions for gel shift assays was prepared as described previously (24Fukami K. Takenaka K. Nagano K. Takenawa T. Eur. J. Biochem. 2000; 267: 28-36Crossref PubMed Scopus (14) Google Scholar). The sequence of the probe was the same as that used in luciferase reporter plasmid. Kinase Assay—In vitro kinase assay with purified Fyn, N-WASP, and/or poly-Glu:Tyr 4:1 substrate (Sigma) was performed as follows. Proteins were purified as described previously (21Suetsugu S. Hattori M. Miki H. Tezuka T. Yamamoto T. Mikoshiba K. Takenawa T. Dev. Cell. 2002; 3: 645-658Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar). Fyn (final 0.1 μg/μl) and N-WASP (final 1 μg/μl) was mixed with poly-Glu:Tyr (4:1) (Sigma) (final 0.4 μg/μl) in kinase buffer containing 20 mm Hepes (pH 7.2), 10 mm MgCl2, 3 mm MnCl2, 150 mm KCl, and 5 mm ATP with 20 μCi/ml [γ-32P]ATP. The mixture was incubated for 10 min at 30°C. Addition of SDS-PAGE sample buffer followed by boiling stopped the reaction. Phosphorylation was monitored by SDS-PAGE and autoradiography. For kinase assays with Fyn immunoprecipitated from COS-7 cells, wild-type Fyn and GFP-tagged wild-type N-WASP, Y253F N-WASP, or Y253E N-WASP were co-transfected and cultured in medium containing serum for 1 day. Cells were then serum-starved for overnight and harvested into buffer containing 40 mm Hepes (pH 7.2), 150 mm NaCl, 5 mm EDTA, 1 mm dithiothreitol, 1 mm phenylmethylsulfonyl fluoride, 0.5% Triton X-100, 0.1 mg/ml aprotinin, and 0.1 mg/ml leupeptin. After immunoprecipitation with anti-Fyn monoclonal antibody (generous gift of Drs. Tezuka and Yamamoto, University of Tokyo), the kinase reaction was performed with 0.2 μg/μl poly-Glu:Tyr in the kinase buffer. The mixture was incubated for 10 min at 30°C. Addition of SDS-PAGE sample buffer followed by boiling stopped the reaction. Phosphorylation was monitored by SDS-PAGE and autoradiography. Focus Assay—NIH-3T3 cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% calf serum (Invitrogen). Cells (1.8 × 105) were seeded into a 6-cm dish. After overnight culture, cells were transfected with 1 μg of plasmid expressing constitutively active (CA) Y531F Fyn or dominant negative (DN) K299M Fyn and 2 μg of plasmid expressing GFP-tagged wild-type N-WASP, Y253F N-WASP, or Y253E N-WASP. The following day, the cells were divided into four 6-cm dishes. Cells were then cultured for 2 weeks. Culture medium was replaced every 3 days. Focus formation was analyzed by Giemsa staining (Sigma). Localization of N-WASP Is Determined by Its Phosphorylation Status—We previously reported that phosphorylation of N-WASP by Src family kinases releases the autoinhibited structure and activates the Arp2/3 complex (21Suetsugu S. Hattori M. Miki H. Tezuka T. Yamamoto T. Mikoshiba K. Takenawa T. Dev. Cell. 2002; 3: 645-658Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar). We made phosphorylation site mutants of N-WASP. In Y253F N-WASP, the tyrosine of the phosphorylation site is replaced with phenylalanine and cannot be phosphorylated. In contrast, Y253E N-WASP has a positively charged glutamic acid instead of tyrosine, mimicking phosphorylation. We examined localization of these N-WASP mutants and of wild-type N-WASP in COS-7 cells with GFP. Wild-type N-WASP was localized in the cytoplasm and in nucleus during serum starvation (Fig. 1, A and B). Both Y253F and Y253E N-WASP localized in the nucleus and the cytoplasm; however, the localization patterns were different. Y253F N-WASP was preferentially localized in the nucleus (Fig. 1, A and B), whereas Y253E N-WASP was preferentially localized in the cytoplasm (Fig. 1, A and B). We then investigated localization of endogenous N-WASP in the presence of constitutively active (CA) or dominant-negative (DN; kinase-negative) Fyn. Expression of CA Fyn decreased the amount of N-WASP in the nucleus, whereas DN Fyn had no effect on localization of N-WASP (Fig. 1C). To confirm the phosphorylation-dependent localization of N-WASP, we examined the localization of Y253F N-WASP in the presence of CA Fyn. Y253F N-WASP preferentially localized in the nucleus even in the presence of CA Fyn (Fig. 1D). These results indicate that the phosphorylation of N-WASP influences localization of N-WASP. N-WASP Is Exported from the Nucleus in a Leptomycin B-dependent Manner—Localization of proteins in the nucleus is actively regulated by nuclear localization signal (NLS) or nuclear export signal (NES) sequences present in the protein itself. NLS is a basic amino acid sequence that is also in N-WASP. The IQ motif was originally found as calmodulin binding site. But its role in N-WASP function remains unclear. The IQ motif is composed of basic amino acids. Besides IQ motif, N-WASP has another basic amino acid cluster, the basic region (2Miki H. Miura K. Takenawa T. EMBO J. 1996; 15: 5326-5335Crossref PubMed Scopus (556) Google Scholar, 25Suetsugu S. Miki H. Yamaguchi H. Obinata T. Takenawa T. J. Cell Sci. 2001; 114: 4533-4542PubMed Google Scholar). Deletion of the IQ motif (amino acids 126-145) or both IQ motif and basic region (amino acids 126-194) results in localization of N-WASP predominantly in cytoplasm. These cytoplasmic localizations of N-WASP mutants were observed in 93% of ΔIQ mutant-expressing cells and 95% of Δbasic mutant-expressing cells, indicating that the IQ motif and the basic region are the NLS for N-WASP (Figs. 1A and 2A). In contrast, deletion of the proline-rich region did not affect the nuclear localization of N-WASP. An NES-like sequence with several leucines is also present in N-WASP around the phosphorylation site of N-WASP (Fig. 2A) (26Wen W. Meinkoth J.L. Tsien R.Y. Taylor S.S. Cell. 1995; 82: 463-473Abstract Full Text PDF PubMed Scopus (1006) Google Scholar). To examine the mechanism underlying the cytoplasmic localization of N-WASP, we treated cells expressing a GFP fusion Y253E N-WASP with leptomycin B (LMB), which specifically blocks export of proteins with NES from the nucleus within minutes (27Wolff B. Sanglier J.J. Wang Y. Chem. Biol. 1997; 4: 139-147Abstract Full Text PDF PubMed Scopus (577) Google Scholar). LMB treatment of cells resulted in increased Y253E N-WASP levels in the nucleus within 30 min. After 120 min treatment of LMB, cytoplasmic localization of Y253E N-WASP was drastically decreased (Fig. 2, B and C), indicating that N-WASP is exported actively from the nucleus by an NES-dependent mechanism to the cytoplasm when phosphorylated. To examine the NES of N-WASP, we substituted leucines (Leu-222, Leu-225, Leu-229, and Leu-232) in the putative NES sequence with alanine (Fig. 2A). The resulting mutant N-WASP with Y253E mutation and NES mutation (Y253E LA N-WASP) predominantly localized in the nucleus, whereas Y253E N-WASP preferentially localized in the cytoplasm (Fig. 2, B and C). Therefore, Y253E N-WASP is transported into the nucleus by an NLS-dependent mechanism and is also exported in an NES-dependent manner. Phosphorylation of N-WASP probably releases the autoinhibitory interaction and exposes the NES sequence, resulting in export of N-WASP from the nucleus. DNA Microarray Analysis of Cells Expressing Y253F N-WASP or Y253E N-WASP—We then examined changes in gene expression that accompany changes in nuclear N-WASP level by DNA microarray. To compensate for the effect of increased levels of N-WASP due to ectopic expression, we compared the cells expressing Y253F N-WASP, which was localized preferentially in the nucleus, and cells expressing Y253E N-WASP, which was localized preferentially in the cytoplasm. Weak signals with intensities similar to that of the background were excluded from further analysis. We analyzed ∼180 genes that gave signal intensities more than twice the level of the standard deviation of background signal (Fig. 3 and Table I). The ratios of control gene expression were 0.94 ± 0.07 for β-actin, 1.09 ± 0.15 for ATP synthetase, 0.90 ± 0.03 for glyceraldehyde-3-phosphate dehydrogenase, 0.89 ± 0.02 for α-tubulin, and 0.88 ± 0.03 for ribosomal protein S5. Expression of most genes appeared to be elevated in cells with Y253E, but these differences were not statistically significant (p > 0.05 by t test) (Fig. 3). Some genes showed statistically higher expression in cells expressing Y253E N-WASP than in cells expressing Y253F N-WASP (p < 0.05). Genes with elevated expression included HSP90 with a ratio of 1.9 ± 0.3, activated leukocyte cell adhesion molecule with 2.6 ± 0.3, ATP-binding cassette, sub-family E with 2.2 ± 0.2, heterogeneous nuclear ribonucleoprotein U with 2.6 ± 0.02, human clone 23722 mRNA sequence with 1.9 ± 0.03, and protein-tyrosine phosphatase type IVA with 2.0 ± 0.1 (Table I).Table IList of genes analyzed on DNA microarrayGenBack AccessionGene Nameaverage of ratio Y253E/Y253 Fstandard deviation of ratioS70154acetyl-Coenzyme A acetyltransferase 2 (acetoacetyl (1.405614570.09584358AF093096aconitase 2, mitochondrial1.122655930.3033137X00351actin, beta0.94943290.07839523X16940actin, gamma 2, smooth muscle, enteric1.278708280.08487689Y10183activated leucocyte cell adhesion molecule2.57278230.29340684NM_004024activating transcription factor 31.306521060.0967373AF067853adenylosuccinate lyase1.02569490.34389144M95627angio-associated, migratory cell protein1.159206570.27403694X05908annexin A11.186925140.03159709NM_004034annexin A71.680871770.20408774AK000379asparagine synthetase1.14960310.15265438J05032aspartyl-tRNA synthetase1.293418040.19533316X64330ATP citrate lyase1.20202550.35768274X60221ATP synthase, H+ transporting, mitochondrial F0 comp1.092086410.15643094D16562ATP synthase, H+ transporting, mitochondrial F1 comp1.247273040.26565911L78207ATP-binding cassette, sub-family C (CFTR/MRP), meml1.302490850.10777863X76388ATP-binding cassette, sub-family E (OABP), member 12.240547330.2053788X53280basic transcription factor 31.055286920.02737936X61123B-cell translocation gene 1, anti-proliferative1.169603220.24852181L38932beclin 1 (coiled-coil, myosin-like BCL2-interacting prot1.432293470.07739947D42040bromodomain-containing 21.232433720.27623573M84349CD59 antigen p18-20 (antigen identified by monoclon1.327416920.14206835M33680CD81 antigen (target of antiproliferative antibody 1)1.183442930.05038984U77949CDC6 (cell division cycle 6, S. cerevisiae) homolog1.526345720.06899938M81933cell division cycle 25A1.348032240.22781111AL121735cell division cycle 42 (GTP-binding protein, 25kD)1.620939120.01812087D43950chaperonin containing TCP1, subunit 5 (epsilon)1.029931630.00994976AJ012008chloride intracellular channel 11.001460410.53404101U45976Clathrin assembly lymphoid-myeloid leukemia gene1.567322710.67612718D83174collagen-binding protein 2 (colligen 2)1.15977990.40853143U51205COP9 homolog1.62409690.15017717D16611coproporphyrinogen oxidase (coproporphyria, hardero1.378418180.05715595L20298core-binding factor, beta subunit1.736758010.74100256X52142CTP synthase1.261817820.08267152U63289CUG triplet repeat, RNA-binding protein 11.302137310.01581062U37022cyclin-dependent kinase 41.096119040.59467367AL021546cytochrome c oxidase subunit Vla polypeptide 10.859246270.21033796X06994cytochrome c-11.444905340.12815829U32986damage-specific DNA binding protein 1 (127kD)1.036251190.40366474AB015051death-associated protein 61.176901660.14013747D15057defender against cell death 11.088921090.11859939U41668deoxyguanosine kinase1.323288930.00078318X80754developmentally regulated GTP-binding protein 21.241205880.23047832D29643dolichyl-diphosphooligosaccharide-protein glycosyltran1.170605410.37276435AL034553dolicyl-phosphate mannosyltransferase polypeptide 11.582442380.14089923U41843DR1-associated protein 1 (negative cofactor 2 alpha)1.047197810.47578011NM_000120epoxide hydrolase 1, microsomal (xenobiotic)1.410422310.24004554AF000987eukaryotic translation initiation factor 1A, Y chromoso1.263665350.09362826AF035280eukaryotic translation initiation factor 2B, subunit 2 (b1.297282570.0673947AF012072eukaryotic translation initiation factor 4 gamma, 31.405518380.02760406D13748eukaryotic translation initiation factor 4A, isoform 11.262223440.02667543M15353eukaryotic translation initiation factor 4E1.793442330.12449281X69141famesyl-diphosphate famesyltransferase 11.406115870.19823132X56597fibrillarin0.777411350.22157511U74612forkhead box M11.046973410.36791558M55150fumarylacetoacetate1.261117510.32532588AF036613general transcription factor II, I, pseudogene 11.267557230.38087962U14193general transcription factor IIA, 2 (12kD subunit)1.648875250.06621775X59268general transcription factor IIB1.447193130.0613415D13636general transcription factor IIIC, polypeptide 2 (beta su1.129869910.09931654M22632glutamic-oxaloacetic transaminase 2, mitochondrial (a1.243667890.1461038M33197glyceraldehyde-3-phosphate dehydrogenase0.895252410.03252775AF007551Golgi vesicular membrane trafficking protein p181.607739920.08648435M96995growth factor receptor-bound protein 21.355480850.01086588L20859heat shock 90kD protein 1, alpha1.891621460.3241274D16431hepatoma-derived growth factor (high-mobility group1.196545480.24539708S63912heterogeneous nuclear protein similar to rat helix dest1.307617550.08415796AK001364heterogeneous nuclear ribonucleoprotein F1.488151520.15591184AF068846heterogeneous nuclear ribonucleoprotein U (scaffold a2.56957740.02033591AF016365hexokinase 10.987077780.56068591M23294hexosaminidase B (beta polypeptide)1.778698260.46476056X89887HIR (histone cell cycle regulation defective, S. cerevisit1.260249240.10041927AF030424histone acetyltransferase 12.230992340.46161926AF005482histone deacetylase 31.151663250.24027574U90909Human clone 23722 mRNA sequence1.914397640.03718591NM_015966hypothetical 43.2 Kd protein1.041980530.53940302M31642hypoxanthine phosphoribosyltransferase 1 (Lesch-Nyl1.687822910.13182394Y08915immunoglobulin (CD79A) binding protein 11.208875730.27614682Y10659interleukin 13 receptor, alpha 11.51626170.05901819U10323interleukin enhancer binding factor 2, 45kD1.21766540.08887575U07681isocitrate dehydrogenase 3 (NAD+) alpha1.724338460.22263092L38951karyopherin (importin) beta 10.802666580.24760103M88458KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein1.517469320.16694772AF215935KIAA0107 gene product1.576589550.0733236AB006624KIAA0286 protein1.4923990.02710567D32129major histocompatibility complex, class I, A0.89482010.03330141X68836methionine adenosyltransferase II, alpha1.367592910.28691931L35263mitogen-activated protein kinase 141.457629250.00247244L11284mitogen-activated protein kinase kinase 11.394765990.16023511AK001659N-acetylneuraminic acid phosphate synthase; sialic aci1.328770240.1803439M22538NADH dehydrogenase (ubiquinone) flavoprotein 2 (241.205066730.36591378U61849neuronal pentraxin I1.25769020.19494833D50420non-histone chromosome protein 2 (S. cerevisiae)-like1.017911660.52815944X17620non-metastatic cells 1, protein (NM23A) expressed in0.671037820.22258748X95592nuclear DNA-binding protein1.585240820.01230688J03827nuclease sensitive element binding protein 10.816820570.12152737Y12065nucleolar protein (KKE/D repeat)1.015208870.09322946M60858nucleolin0.963295280.21762793AL162068nucleosome assembly protein 1-like 11.439648020.12939817X66363PCTAIRE protein kinase 11.346049030.63105197U78310pescadillo (zebrafish) homolog 1, containing BRCT dor1.371178710.41513921D90070phorbol-12-myristate-13-acetate-induced protein 11.294823280.2069056NM_006214phytanoyl-CoA hydroxylase (Refsum disease)1.319591720.51452668X57398pM5 protein1.040287210.50515409X78136poly(rC)-binding protein 20.960197670.26958343X63563polymerase (RNA) II (DNA directed) polypeptide B (141.676743460.1065411L37127polymerase (RNA) II (DNA directed) polypeptide J (131.048009070.37498138D89667prefoldin 50.959997730.32679468X67337pre-mRNA cleavage factor lm (68kD)1.279590820.2020645J03191profilin 10.888547330.28731921X61970proteasome (prosome, macropain) subunit, alpha type1.117451170.13590692D00761proteasome (prosome, macropain) subunit, beta type,1.083535520.44557459D29012proteasome (prosome, macropain) subunit, beta type,1.054125120.49295833M33336protein kinase, cAMP-dependent, regulatory, type I, alp1.758893110.45329231L42373protein phosphatase 2, regulatory subunit B (B56), alp1.493007850.23208664AF051160protein tyrosine phosphatase type IVA, member 12.052040410.05399874U94836protein with polyglutamine repeat; calcium (ca2+) hon1.111809360.32841068X95263PWP2 (periodic tryptophan protein, yeast) homolog1.31442920.08209377Z97074Rab9 effector p401.20705920.46044679D21090RAD23 (S. cerevisiae) homolog B1.585244720.0569111NM_002882RAN binding protein 11.584783090.15711283U32519Ras-GTPase-activating protein SH3-domain-binding pro1.45454550.47585162U41654Ras-related GTP-binding protein1.339074810.08958481AJ005579RD element1.312171780.13994648L07541replication factor C (activator 1) 3 (38kD)1.499658130.16450074D83767reproduction B1.38137570.04483355X74262retinoblastoma-binding protein 41.537177430.07561509U72066retinoblastoma-binding protein 81.530550110.11037644X59543ribonucleotide reductase M1 polypeptide1.527193940.17056889X03342ribosomal protein L321.158850980.19989975U66589ribosomal protein L50.911071980.05443532X69391ribosomal protein L60.84730070.19722704U14970ribosomal protein S50.875452770.04345486BE513192ribosomal protein S60.960030760.03164158U28686RNA binding motif protein 31.518817620.1206