Publication Information

{'id': 'https://openalex.org/W2017772012', 'doi': 'https://doi.org/10.1074/jbc.m204770200', 'title': 'The Intermolecular Interaction between the PH Domain and the C-terminal Domain of Arabidopsis Dynamin-like 6 Determines Lipid Binding Specificity', 'display_name': 'The Intermolecular Interaction between the PH Domain and the C-terminal Domain of Arabidopsis Dynamin-like 6 Determines Lipid Binding Specificity', 'publication_year': 2002, 'publication_date': '2002-08-01', 'ids': {'openalex': 'https://openalex.org/W2017772012', 'doi': 'https://doi.org/10.1074/jbc.m204770200', 'mag': '2017772012', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/12105222'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m204770200', 'pdf_url': 'http://www.jbc.org/article/S0021925820700384/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S0021925820700384/pdf', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5109085304', 'display_name': 'Sung Hoon Lee', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I123900574', 'display_name': 'Pohang University of Science and Technology', 'ror': 'https://ror.org/04xysgw12', 'country_code': 'KR', 'type': 'education', 'lineage': ['https://openalex.org/I123900574']}], 'countries': ['KR'], 'is_corresponding': False, 'raw_author_name': 'Sung Hoon Lee', 'raw_affiliation_strings': ['From the Center for Plant Intracellular Trafficking and the Division of Molecular and Life Sciences, Pohang University of Science and Technology, 790-784, Korea'], 'affiliations': [{'raw_affiliation_string': 'From the Center for Plant Intracellular Trafficking and the Division of Molecular and Life Sciences, Pohang University of Science and Technology, 790-784, Korea', 'institution_ids': ['https://openalex.org/I123900574']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5033446344', 'display_name': 'Jing Bo Jin', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I123900574', 'display_name': 'Pohang University of Science and Technology', 'ror': 'https://ror.org/04xysgw12', 'country_code': 'KR', 'type': 'education', 'lineage': ['https://openalex.org/I123900574']}], 'countries': ['KR'], 'is_corresponding': False, 'raw_author_name': 'Jing Bo Jin', 'raw_affiliation_strings': ['From the Center for Plant Intracellular Trafficking and the Division of Molecular and Life Sciences, Pohang University of Science and Technology, 790-784, Korea'], 'affiliations': [{'raw_affiliation_string': 'From the Center for Plant Intracellular Trafficking and the Division of Molecular and Life Sciences, Pohang University of Science and Technology, 790-784, Korea', 'institution_ids': ['https://openalex.org/I123900574']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5085510614', 'display_name': 'Jinhee Song', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I123900574', 'display_name': 'Pohang University of Science and Technology', 'ror': 'https://ror.org/04xysgw12', 'country_code': 'KR', 'type': 'education', 'lineage': ['https://openalex.org/I123900574']}], 'countries': ['KR'], 'is_corresponding': False, 'raw_author_name': 'Jinhee Song', 'raw_affiliation_strings': ['From the Center for Plant Intracellular Trafficking and the Division of Molecular and Life Sciences, Pohang University of Science and Technology, 790-784, Korea'], 'affiliations': [{'raw_affiliation_string': 'From the Center for Plant Intracellular Trafficking and the Division of Molecular and Life Sciences, Pohang University of Science and Technology, 790-784, Korea', 'institution_ids': ['https://openalex.org/I123900574']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5021781137', 'display_name': 'Myung Ki Min', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I123900574', 'display_name': 'Pohang University of Science and Technology', 'ror': 'https://ror.org/04xysgw12', 'country_code': 'KR', 'type': 'education', 'lineage': ['https://openalex.org/I123900574']}], 'countries': ['KR'], 'is_corresponding': False, 'raw_author_name': 'Myung Ki Min', 'raw_affiliation_strings': ['From the Center for Plant Intracellular Trafficking and the Division of Molecular and Life Sciences, Pohang University of Science and Technology, 790-784, Korea'], 'affiliations': [{'raw_affiliation_string': 'From the Center for Plant Intracellular Trafficking and the Division of Molecular and Life Sciences, Pohang University of Science and Technology, 790-784, Korea', 'institution_ids': ['https://openalex.org/I123900574']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5111665179', 'display_name': 'Dae Sup Park', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I123900574', 'display_name': 'Pohang University of Science and Technology', 'ror': 'https://ror.org/04xysgw12', 'country_code': 'KR', 'type': 'education', 'lineage': ['https://openalex.org/I123900574']}], 'countries': ['KR'], 'is_corresponding': False, 'raw_author_name': 'Dae Sup Park', 'raw_affiliation_strings': ['From the Center for Plant Intracellular Trafficking and the Division of Molecular and Life Sciences, Pohang University of Science and Technology, 790-784, Korea'], 'affiliations': [{'raw_affiliation_string': 'From the Center for Plant Intracellular Trafficking and the Division of Molecular and Life Sciences, Pohang University of Science and Technology, 790-784, Korea', 'institution_ids': ['https://openalex.org/I123900574']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5101891975', 'display_name': 'Yong-Woo Kim', 'orcid': 'https://orcid.org/0000-0002-1703-7753'}, 'institutions': [{'id': 'https://openalex.org/I123900574', 'display_name': 'Pohang University of Science and Technology', 'ror': 'https://ror.org/04xysgw12', 'country_code': 'KR', 'type': 'education', 'lineage': ['https://openalex.org/I123900574']}], 'countries': ['KR'], 'is_corresponding': False, 'raw_author_name': 'Yong-Woo Kim', 'raw_affiliation_strings': ['From the Center for Plant Intracellular Trafficking and the Division of Molecular and Life Sciences, Pohang University of Science and Technology, 790-784, Korea'], 'affiliations': [{'raw_affiliation_string': 'From the Center for Plant Intracellular Trafficking and the Division of Molecular and Life Sciences, Pohang University of Science and Technology, 790-784, Korea', 'institution_ids': ['https://openalex.org/I123900574']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5083020137', 'display_name': 'Inhwan Hwang', 'orcid': 'https://orcid.org/0000-0002-1388-1367'}, 'institutions': [{'id': 'https://openalex.org/I123900574', 'display_name': 'Pohang University of Science and Technology', 'ror': 'https://ror.org/04xysgw12', 'country_code': 'KR', 'type': 'education', 'lineage': ['https://openalex.org/I123900574']}], 'countries': ['KR'], 'is_corresponding': False, 'raw_author_name': 'Inhwan Hwang', 'raw_affiliation_strings': ['From the Center for Plant Intracellular Trafficking and the Division of Molecular and Life Sciences, Pohang University of Science and Technology, 790-784, Korea'], 'affiliations': [{'raw_affiliation_string': 'From the Center for Plant Intracellular Trafficking and the Division of Molecular and Life Sciences, Pohang University of Science and Technology, 790-784, Korea', 'institution_ids': ['https://openalex.org/I123900574']}]}], 'institution_assertions': [], 'countries_distinct_count': 1, 'institutions_distinct_count': 1, 'corresponding_author_ids': [], 'corresponding_institution_ids': [], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 0.7, 'has_fulltext': True, 'fulltext_origin': 'pdf', 'cited_by_count': 33, 'citation_normalized_percentile': {'value': 0.720295, 'is_in_top_1_percent': False, 'is_in_top_10_percent': False}, 'cited_by_percentile_year': {'min': 89, 'max': 90}, 'biblio': {'volume': '277', 'issue': '35', 'first_page': '31842', 'last_page': '31849'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T10617', 'display_name': 'Cellular transport and secretion', 'score': 0.9999, 'subfield': {'id': 'https://openalex.org/subfields/1307', 'display_name': 'Cell Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, 'topics': [{'id': 'https://openalex.org/T10617', 'display_name': 'Cellular transport and secretion', 'score': 0.9999, 'subfield': {'id': 'https://openalex.org/subfields/1307', 'display_name': 'Cell Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T10407', 'display_name': 'Lipid Membrane Structure and Behavior', 'score': 0.999, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T10303', 'display_name': 'Photosynthetic Processes and Mechanisms', 'score': 0.9909, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/pleckstrin-homology-domain', 'display_name': 'Pleckstrin homology domain', 'score': 0.9051856}, {'id': 'https://openalex.org/keywords/c2-domain', 'display_name': 'C2 domain', 'score': 0.44059104}], 'concepts': [{'id': 'https://openalex.org/C49658373', 'wikidata': 'https://www.wikidata.org/wiki/Q24776397', 'display_name': 'Pleckstrin homology domain', 'level': 3, 'score': 0.9051856}, {'id': 'https://openalex.org/C156407911', 'wikidata': 'https://www.wikidata.org/wiki/Q420160', 'display_name': 'Dynamin', 'level': 4, 'score': 0.734418}, {'id': 'https://openalex.org/C55493867', 'wikidata': 'https://www.wikidata.org/wiki/Q7094', 'display_name': 'Biochemistry', 'level': 1, 'score': 0.54381996}, {'id': 'https://openalex.org/C2779491563', 'wikidata': 'https://www.wikidata.org/wiki/Q157892', 'display_name': 'Arabidopsis', 'level': 4, 'score': 0.52564895}, {'id': 'https://openalex.org/C51639874', 'wikidata': 'https://www.wikidata.org/wiki/Q167149', 'display_name': 'Plasma protein binding', 'level': 2, 'score': 0.47982955}, {'id': 'https://openalex.org/C2780610907', 'wikidata': 'https://www.wikidata.org/wiki/Q2273248', 'display_name': 'Phosphatidylinositol', 'level': 3, 'score': 0.4741922}, {'id': 'https://openalex.org/C25166345', 'wikidata': 'https://www.wikidata.org/wiki/Q4914012', 'display_name': 'Binding domain', 'level': 3, 'score': 0.4703945}, {'id': 'https://openalex.org/C185592680', 'wikidata': 'https://www.wikidata.org/wiki/Q2329', 'display_name': 'Chemistry', 'level': 0, 'score': 0.45603266}, {'id': 'https://openalex.org/C143840085', 'wikidata': 'https://www.wikidata.org/wiki/Q5008102', 'display_name': 'C2 domain', 'level': 3, 'score': 0.44059104}, {'id': 'https://openalex.org/C107824862', 'wikidata': 'https://www.wikidata.org/wiki/Q616005', 'display_name': 'Binding site', 'level': 2, 'score': 0.42388582}, {'id': 'https://openalex.org/C130316041', 'wikidata': 'https://www.wikidata.org/wiki/Q189206', 'display_name': 'Vesicle', 'level': 3, 'score': 0.41305608}, {'id': 'https://openalex.org/C12554922', 'wikidata': 'https://www.wikidata.org/wiki/Q7100', 'display_name': 'Biophysics', 'level': 1, 'score': 0.39334476}, {'id': 'https://openalex.org/C41625074', 'wikidata': 'https://www.wikidata.org/wiki/Q176088', 'display_name': 'Membrane', 'level': 2, 'score': 0.38865316}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.36646}, {'id': 'https://openalex.org/C95444343', 'wikidata': 'https://www.wikidata.org/wiki/Q7141', 'display_name': 'Cell biology', 'level': 1, 'score': 0.3353175}, {'id': 'https://openalex.org/C62478195', 'wikidata': 'https://www.wikidata.org/wiki/Q828130', 'display_name': 'Signal transduction', 'level': 2, 'score': 0.15532717}, {'id': 'https://openalex.org/C170493617', 'wikidata': 'https://www.wikidata.org/wiki/Q208467', 'display_name': 'Receptor', 'level': 2, 'score': 0.15068024}, {'id': 'https://openalex.org/C143065580', 'wikidata': 'https://www.wikidata.org/wiki/Q3285695', 'display_name': 'Mutant', 'level': 3, 'score': 0.12197968}, {'id': 'https://openalex.org/C28005876', 'wikidata': 'https://www.wikidata.org/wiki/Q189814', 'display_name': 'Endocytosis', 'level': 3, 'score': 0.11804071}, {'id': 'https://openalex.org/C104317684', 'wikidata': 'https://www.wikidata.org/wiki/Q7187', 'display_name': 'Gene', 'level': 2, 'score': 0.080274016}], 'mesh': [{'descriptor_ui': 'D017360', 'descriptor_name': 'Arabidopsis', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D029681', 'descriptor_name': 'Arabidopsis Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': True}, {'descriptor_ui': 'D034281', 'descriptor_name': 'Dynamins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': True}, {'descriptor_ui': 'D020558', 'descriptor_name': 'GTP Phosphohydrolases', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D050356', 'descriptor_name': 'Lipid Metabolism', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': True}, {'descriptor_ui': 'D010940', 'descriptor_name': 'Plant Proteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D000595', 'descriptor_name': 'Amino Acid Sequence', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D017360', 'descriptor_name': 'Arabidopsis', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D001483', 'descriptor_name': 'Base Sequence', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D001665', 'descriptor_name': 'Binding Sites', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D017931', 'descriptor_name': 'DNA Primers', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D020558', 'descriptor_name': 'GTP Phosphohydrolases', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D020558', 'descriptor_name': 'GTP Phosphohydrolases', 'qualifier_ui': 'Q000737', 'qualifier_name': 'chemistry', 'is_major_topic': False}, {'descriptor_ui': 'D020558', 'descriptor_name': 'GTP Phosphohydrolases', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D005982', 'descriptor_name': 'Glutathione Transferase', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D005982', 'descriptor_name': 'Glutathione Transferase', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D007295', 'descriptor_name': 'Inositol Phosphates', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D007295', 'descriptor_name': 'Inositol Phosphates', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D008969', 'descriptor_name': 'Molecular Sequence Data', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D010940', 'descriptor_name': 'Plant Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D010940', 'descriptor_name': 'Plant Proteins', 'qualifier_ui': 'Q000737', 'qualifier_name': 'chemistry', 'is_major_topic': False}, {'descriptor_ui': 'D010940', 'descriptor_name': 'Plant Proteins', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D016133', 'descriptor_name': 'Polymerase Chain Reaction', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011993', 'descriptor_name': 'Recombinant Fusion Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011993', 'descriptor_name': 'Recombinant Fusion Proteins', 'qualifier_ui': 'Q000737', 'qualifier_name': 'chemistry', 'is_major_topic': False}, {'descriptor_ui': 'D011993', 'descriptor_name': 'Recombinant Fusion Proteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D016415', 'descriptor_name': 'Sequence Alignment', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D017386', 'descriptor_name': 'Sequence Homology, Amino Acid', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D013379', 'descriptor_name': 'Substrate Specificity', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}], 'locations_count': 2, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m204770200', 'pdf_url': 'http://www.jbc.org/article/S0021925820700384/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/12105222', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m204770200', 'pdf_url': 'http://www.jbc.org/article/S0021925820700384/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 49, 'referenced_works': ['https://openalex.org/W107621778', 'https://openalex.org/W1566581202', 'https://openalex.org/W1857386042', 'https://openalex.org/W1964520368', 'https://openalex.org/W1967965496', 'https://openalex.org/W1970909818', 'https://openalex.org/W1978627586', 'https://openalex.org/W1990134601', 'https://openalex.org/W1994063020', 'https://openalex.org/W1997784032', 'https://openalex.org/W1999079263', 'https://openalex.org/W2000426427', 'https://openalex.org/W2006416359', 'https://openalex.org/W2013112818', 'https://openalex.org/W2018032056', 'https://openalex.org/W2022658714', 'https://openalex.org/W2026740840', 'https://openalex.org/W2028863549', 'https://openalex.org/W2031234701', 'https://openalex.org/W2037956598', 'https://openalex.org/W2039873071', 'https://openalex.org/W2040987875', 'https://openalex.org/W2042438158', 'https://openalex.org/W2042776102', 'https://openalex.org/W2044005459', 'https://openalex.org/W2054922048', 'https://openalex.org/W2060934876', 'https://openalex.org/W2070634601', 'https://openalex.org/W2078748790', 'https://openalex.org/W2082186646', 'https://openalex.org/W2082530736', 'https://openalex.org/W2082688327', 'https://openalex.org/W2092081030', 'https://openalex.org/W2093139459', 'https://openalex.org/W2101693034', 'https://openalex.org/W2108264768', 'https://openalex.org/W2124540225', 'https://openalex.org/W2125206853', 'https://openalex.org/W2132021366', 'https://openalex.org/W2137521656', 'https://openalex.org/W2141345634', 'https://openalex.org/W2149897005', 'https://openalex.org/W2152928502', 'https://openalex.org/W2153507794', 'https://openalex.org/W2157510237', 'https://openalex.org/W2162446789', 'https://openalex.org/W4231183555', 'https://openalex.org/W4376453135', 'https://openalex.org/W50192545'], 'related_works': ['https://openalex.org/W2149897005', 'https://openalex.org/W2094123735', 'https://openalex.org/W2093299463', 'https://openalex.org/W2087613179', 'https://openalex.org/W2086463901', 'https://openalex.org/W2078748790', 'https://openalex.org/W2000426427', 'https://openalex.org/W1993177200', 'https://openalex.org/W1987246337', 'https://openalex.org/W1533641569'], 'abstract_inverted_index': {'Dynamin': [0, 201], 'and': [1, 54, 99, 120, 145, 180, 195, 202, 255, 300, 321, 346, 381, 396, 464, 954, 1139, 1279, 1587, 1660, 1680, 1706, 1717, 1754, 1765, 1783, 1800, 1806, 1821, 1823, 1825, 1828, 1837, 1850, 1852, 1854, 1859, 1872, 1874, 1876, 1881, 1887, 1899, 1914, 2017, 2031, 2108, 2162, 2264, 2273, 2320, 2335, 2382, 2404, 2418, 2440, 2509, 2538, 2544, 2574, 2616, 2646, 2663, 2682, 2898, 3001, 3144, 3286, 3365, 3582, 3832, 3922, 4057, 4302, 4348, 4396, 4418, 4440, 4454, 4493], 'its': [2, 203, 1641, 2899], 'related': [3, 204, 2900], 'proteins': [4, 10, 205, 211, 453, 958, 996, 1042, 1259, 1356, 1481, 1593, 1960, 2118, 2356, 2499, 2550, 2573, 2583, 2656, 2694, 2901, 3091, 3368, 3775, 4069, 4379], 'are': [5, 206, 3082, 3092, 3369], 'a': [6, 77, 138, 207, 278, 339, 420, 591, 733, 750, 1488, 1692, 1695, 1701, 1721, 1728, 1773, 2037, 2421, 2477, 2675, 2840, 2864, 3005, 3085, 3275, 3453, 3464, 3504, 3568, 3821, 3887, 3927, 3942, 3968, 3977, 4035, 4167, 4187, 4402], 'group': [7, 208], 'of': [8, 15, 27, 30, 61, 129, 152, 165, 199, 209, 216, 228, 231, 262, 330, 353, 366, 400, 448, 741, 827, 844, 957, 992, 994, 1013, 1053, 1066, 1129, 1254, 1257, 1272, 1354, 1591, 1632, 1640, 1666, 1703, 1709, 1736, 1787, 1809, 1818, 1840, 1847, 1862, 1869, 1917, 1958, 2062, 2072, 2234, 2237, 2254, 2285, 2424, 2427, 2547, 2569, 2580, 2589, 2677, 2692, 2731, 2734, 2832, 2847, 2850, 2858, 2874, 2881, 2896, 3013, 3035, 3060, 3117, 3120, 3132, 3137, 3228, 3259, 3284, 3524, 3579, 3657, 3789, 3793, 3805, 4020, 4066, 4117, 4121, 4129, 4144, 4149, 4190, 4199, 4207, 4216, 4279, 4289, 4309, 4318, 4373, 4461, 4470, 4489, 4499, 4507, 4566], 'mechanochemical': [9, 210, 734, 2679], 'involved': [11, 36, 212, 237, 819, 1005, 1588, 2688], 'in': [12, 18, 37, 67, 161, 213, 219, 238, 268, 362, 428, 440, 593, 820, 822, 837, 908, 1006, 1149, 1360, 1589, 1601, 1634, 1691, 1720, 1999, 2240, 2282, 2410, 2502, 2505, 2535, 2586, 2689, 2728, 2869, 2878, 2893, 3004, 3015, 3026, 3032, 3038, 3050, 3062, 3084, 3101, 3106, 3114, 3147, 3230, 3281, 3477, 3483, 3528, 3554, 3573, 3576, 4177, 4299, 4329, 4345, 4356, 4370, 4436, 4514], 'the': [13, 25, 31, 41, 45, 59, 101, 110, 125, 130, 142, 146, 153, 157, 166, 182, 189, 192, 196, 214, 226, 232, 242, 246, 260, 302, 311, 326, 331, 343, 347, 354, 358, 367, 383, 390, 393, 397, 446, 739, 746, 813, 828, 960, 989, 1011, 1063, 1067, 1130, 1252, 1263, 1273, 1492, 1585, 1595, 1598, 1630, 1638, 1662, 1667, 1677, 1681, 1745, 1758, 1762, 1766, 1810, 1829, 1835, 1896, 1900, 1907, 1912, 1950, 2306, 2311, 2338, 2342, 2407, 2414, 2506, 2520, 2536, 2545, 2678, 2696, 2700, 2729, 2735, 2833, 2845, 2855, 2872, 2879, 2894, 3033, 3039, 3051, 3058, 3063, 3095, 3102, 3115, 3121, 3130, 3133, 3225, 3231, 3246, 3249, 3257, 3260, 3282, 3494, 3500, 3521, 3532, 3537, 3555, 3562, 3577, 3655, 3659, 3763, 3774, 3787, 3790, 3931, 4010, 4049, 4067, 4071, 4080, 4085, 4118, 4140, 4150, 4160, 4179, 4196, 4204, 4273, 4280, 4286, 4295, 4315, 4326, 4330, 4363, 4371, 4374, 4381, 4391, 4397, 4408, 4442, 4458, 4471, 4481, 4487, 4495, 4500, 4517, 4563], 'modulation': [14, 215, 1012, 1362], 'lipid': [16, 85, 183, 217, 286, 384, 1663, 2169, 2173, 3835, 3932, 4072, 4119, 4364, 4496, 4564], 'membranes': [17, 66, 218, 267, 1148, 2248, 3241, 3549], 'various': [19, 220, 458, 1007, 2235, 3946, 4200], 'biological': [20, 221, 839, 1008], 'processes.': [21, 222], 'Here': [22, 223], 'we': [23, 224, 1577, 1636, 1648, 2843, 2853, 3462, 3795, 3812, 4123], 'investigate': [24, 225, 3798, 4126], 'nature': [26, 227, 1253, 1639, 2846, 3788], 'membrane': [28, 229, 748, 926, 1014, 1018, 1039, 1051, 1255, 1361, 2848, 3090, 3791], 'binding': [29, 86, 94, 128, 164, 184, 230, 287, 295, 329, 365, 385, 1664, 2170, 2174, 3665, 3836, 3890, 3933, 3954, 4017, 4038, 4043, 4120, 4134, 4365, 4405, 4423, 4449, 4459, 4488, 4497, 4525, 4565], 'Arabidopsis': [32, 233, 1602, 1685], 'dynamin-like': [33, 234, 1135], '6': [34, 235], '(ADL6)': [35, 236], 'vesicle': [38, 239, 441, 751], 'trafficking': [39, 240, 956, 1590, 2691], 'from': [40, 241, 457, 1269, 1594, 2695, 3472, 3817, 4159, 4181, 4505], 'trans-Golgi': [42, 243, 402, 961, 2697], 'network': [43, 244, 403, 962, 2698], 'to': [44, 95, 117, 133, 169, 178, 245, 296, 318, 334, 370, 379, 435, 730, 834, 998, 1003, 1046, 1048, 1059, 1072, 1145, 1147, 1219, 1222, 1485, 1584, 1597, 1654, 1932, 1936, 2244, 2391, 2420, 2519, 2665, 2686, 2699, 3108, 3142, 3507, 3666, 3730, 3732, 3759, 3772, 3779, 3784, 3797, 3803, 3891, 3955, 4018, 4031, 4039, 4070, 4125, 4135, 4146, 4195, 4203, 4214, 4385, 4425, 4428, 4451, 4463, 4491], 'central': [46, 247, 1599, 2701], 'vacuole.': [47, 248], 'Fractionation': [48, 249], 'experiments': [49, 250], 'by': [50, 137, 188, 251, 338, 389, 586, 1062, 1744, 1778, 1983, 2048, 2099, 2121, 2178, 2398, 2485, 2524, 2542, 2553, 2634, 2660, 2836, 2861, 3009, 3020, 3088, 3762, 3957, 4075, 4220], 'continuous': [51, 252, 3006], 'sucrose': [52, 253, 2865, 3007, 3037, 3049, 3064, 3086, 3103, 3119, 3229], 'gradients': [53, 254], 'gel': [55, 256, 3465], 'filtration': [56, 257, 3466], 'revealed': [57, 73, 258, 274, 4313], 'that': [58, 74, 89, 100, 174, 181, 259, 275, 290, 301, 375, 382, 736, 1069, 1580, 1651, 1661, 2822, 2885, 2987, 3078, 3221, 3235, 3251, 3269, 3363, 3542, 3564, 4027, 4164, 4314, 4469, 4506], 'majority': [60, 261, 2873], 'ADL6': [62, 75, 90, 175, 263, 276, 291, 376, 1581, 1633, 1652, 1737, 1788, 1902, 2673, 2823, 2838, 2875, 2886, 2988, 3014, 3029, 3061, 3111, 3138, 3222, 3270, 3447, 3480, 3509, 3525, 3552, 3565, 3800, 3815, 4028, 4130, 4145, 4165, 4290, 4319, 4376, 4410, 4417, 4490, 4567], 'is': [63, 186, 264, 387, 818, 1260, 1266, 1363, 1582, 1670, 2674, 2820, 2824, 2989, 3770, 4131, 4484, 4503, 4510, 4521], 'associated': [64, 265, 2825, 2889, 2990, 3242, 3550], 'with': [65, 266, 1643, 1657, 1727, 1906, 1963, 2033, 2069, 2112, 2251, 2276, 2304, 2310, 2498, 2618, 2626, 2650, 2826, 2890, 2991, 2998, 3043, 3047, 3073, 3243, 3518, 3551, 3776, 3781, 3972, 4380], 'vivo.': [68, 269], 'Amino': [69, 270, 4153, 4305], 'acid': [70, 271, 1739, 1770, 1790, 4142, 4154, 4183, 4192, 4306], 'sequence': [71, 272, 4143, 4155, 4193, 4307], 'analysis': [72, 273, 2182, 2556, 2668, 3961, 4078, 4156], 'has': [76, 277, 432, 595, 727, 1056, 1216, 2683, 3727, 4166, 4320], 'putative': [78, 279], 'pleckstrin': [79, 280, 405], 'homology': [80, 281, 406, 4194], '(PH)': [81, 282], 'domain.': [82, 283], 'In': [83, 149, 284, 350, 1645, 3654, 3935, 4008, 4173, 4432, 4456], 'vitro': [84, 285, 1224], 'assays': [87, 288, 2175, 3837], 'demonstrated': [88, 289], 'showed': [91, 292, 3951, 3967, 4186, 4401, 4420, 4446], 'high': [92, 126, 162, 293, 327, 363, 421, 1364, 1658, 3276, 3372, 3454, 3569, 3663, 3888, 3952, 3969, 4036], 'affinity': [93, 127, 163, 294, 328, 364, 1659, 3664, 3889, 3953, 3970, 4037, 4424, 4450, 4460], 'phosphatidylinositol': [96, 121, 297, 322, 413, 1073, 1655, 2155, 2159, 2163, 3667, 3671, 3733, 4094, 4097, 4100, 4102, 4104, 4106], '3-phosphate': [97, 298, 1656], '(PtdIns-3-P)': [98, 299], 'PH': [102, 111, 131, 143, 158, 167, 193, 303, 312, 332, 344, 359, 368, 394, 1064, 1264, 1668, 1678, 1734, 1763, 1811, 3660, 3764, 4168, 4197, 4205, 4287, 4296, 4311, 4316, 4331, 4382, 4398, 4443, 4482, 4501, 4518], 'domain': [103, 112, 132, 144, 159, 168, 194, 198, 304, 313, 333, 345, 360, 369, 395, 399, 408, 418, 1065, 1265, 1669, 1679, 1683, 1735, 1764, 1768, 1812, 3661, 3765, 4169, 4288, 4297, 4317, 4332, 4383, 4399, 4444, 4483, 4502, 4519], 'was': [104, 135, 305, 336, 1689, 1742, 1776, 1793, 1930, 1961, 2045, 2067, 2308, 2332, 2349, 2480, 2496, 2551, 2876, 3018, 3030, 3066, 3112, 3139, 3361, 3481, 3489, 3526, 3535, 3826, 3920, 3939, 4045, 4073, 4212, 4291, 4367, 4466], 'responsible': [105, 306, 4132, 4485, 4522], 'for': [106, 307, 1249, 1357, 1884, 1966, 1973, 1989, 2054, 2089, 2105, 2168, 2294, 2314, 2324, 2351, 2490, 2511, 2530, 2623, 2640, 3834, 3924, 3930, 4133, 4486, 4523], 'this': [107, 308, 1646, 3109, 3460, 3810, 4210, 4336], 'interaction.': [108, 309], 'However,': [109, 310, 1247, 3105, 4285, 4389], 'alone': [113, 314, 3938, 4445, 4520], 'binds': [114, 176, 315, 377, 1070, 1653, 3802, 4029], 'equally': [115, 316], 'well': [116, 317], 'both': [118, 319, 4452], 'PtdIns-3-P': [119, 134, 179, 320, 335, 380, 3956, 4386, 4426, 4453], '4-phosphate': [122, 323, 3734], '(PtdIns-4-P).': [123, 324], 'Interestingly,': [124, 325, 3057], 'restored': [136, 337], 'protein-protein': [139, 340], 'interaction': [140, 190, 341, 391, 1494, 1642, 1675, 3971], 'between': [141, 191, 342, 392, 1495, 1676, 4325, 4394], 'C-terminal': [147, 197, 348, 398, 407, 1682, 1767, 1807, 1838, 1860, 1882], 'region.': [148, 349], 'addition,': [150, 351, 3936, 4174, 4457], 'deletion': [151, 352, 1897, 1928, 4339], 'inserted': [154, 355, 4324], 'regions': [155, 356, 1808, 1839, 1861], 'within': [156, 357], 'results': [160, 172, 361, 373, 3559, 4024, 4476], 'PtdIns-3-P.': [170, 371, 4040, 4136], 'These': [171, 372, 1480, 3558, 4023], 'suggest': [173, 374, 4026, 4477], 'specifically': [177, 378, 1071, 1221, 4030], 'specificity': [185, 386, 1665, 4498], 'determined': [187, 388, 1671], 'ADL6.': [200, 401, 2851, 3244, 4473, 4508], 'Arabidopsisdynamin-like': [404], 'maltose-binding': [409, 1908], 'protein': [410, 425, 1068, 1909, 2281, 2590, 2651, 2680, 2994, 3070, 3469, 3514, 3816, 3980, 4274, 4393, 4411], 'phosphatidylcholine': [411, 2151], 'phosphatidylethanolamine': [412, 2149], 'phospholipase': [414, 4303], 'C': [415], 'GTPase': [416], 'effector': [417], 'Dynamin,': [419], 'molecular': [422, 1365, 2834, 3277, 3373, 3455, 3570], 'weight': [423, 1366, 3278, 3374, 3456, 3571], 'GTP-binding': [424], 'originally': [426], 'found': [427, 2877, 3093, 3146, 3370, 3482, 4298], 'rat': [429], 'brain': [430], 'tissue,': [431], 'been': [433, 455, 596, 728, 832, 1057, 1143, 1217, 1483, 2684, 3728], 'shown': [434, 729, 1058, 1144, 1218, 1484, 1579, 2685, 2868, 3025, 3362, 3476, 3729, 4176, 4344, 4355, 4435], 'play': [436, 835], 'an': [437, 1673, 2086, 2670, 3076, 3508, 4221], 'important': [438, 1351], 'role': [439, 592, 1359, 1631], 'formation': [442, 907, 1368], 'during': [443], 'endocytosis.': [444], 'Since': [445], 'discovery': [447], 'dynamin': [449, 588, 725, 814, 829, 1054, 1131, 1250, 1274, 2681, 2736, 2897, 3285, 4151, 4300], 'I,': [450, 1251], 'numerous': [451, 723], 'dynamin-related': [452, 1258, 3367], 'have': [454, 831, 1142, 1482, 1578, 3239, 3547], 'identified': [456], 'organisms': [459], 'such': [460, 841, 1016, 1133, 1276, 2147, 3669], 'as': [461, 732, 749, 842, 1017, 1277, 2148, 2341, 2892, 3274, 3280, 3371, 3452, 3575, 3670, 3820, 3926, 3941, 3976, 4060, 4084, 4175, 4343, 4350, 4354, 4434], 'yeasts,': [462], 'plants,': [463], 'humans': [465], '(1Obar': [466], 'R.A.': [467, 510, 640], 'Collins': [468], 'C.A.': [469, 516], 'Hammarback': [470], 'J.A.': [471], 'Shpetner': [472, 2452], 'H.S.': [473, 2453], 'Vallee': [474, 519, 641], 'R.B.': [475, 520, 642], 'Nature.': [476, 521, 677, 695, 756, 774, 1373], '1990;': [477, 496, 1292], '347:': [478], '256-261Crossref': [479], 'PubMed': [480, 502, 525, 540, 554, 579, 630, 649, 668, 681, 699, 716, 760, 778, 807, 859, 880, 900, 920, 949, 983, 1032, 1105, 1121, 1172, 1186, 1208, 1242, 1298, 1323, 1345, 1377, 1403, 1425, 1453, 1475, 1521, 1543, 1571, 1622, 2200, 2222, 2466, 2722, 2767, 2793, 2814, 2931, 2957, 2979, 3171, 3193, 3214, 3310, 3332, 3354, 3397, 3419, 3441, 3605, 3627, 3649, 3703, 3720, 3753, 3857, 3879, 3915, 4003, 4252, 4555], 'Scopus': [481, 503, 526, 541, 555, 580, 631, 650, 669, 682, 700, 717, 761, 779, 808, 860, 881, 901, 921, 950, 984, 1033, 1106, 1122, 1173, 1187, 1209, 1243, 1299, 1324, 1346, 1378, 1404, 1426, 1454, 1476, 1522, 1544, 1572, 1623, 2201, 2223, 2467, 2723, 2768, 2794, 2815, 2932, 2958, 2980, 3172, 3194, 3215, 3311, 3333, 3355, 3398, 3420, 3442, 3606, 3628, 3650, 3704, 3721, 3754, 3858, 3880, 3916, 4004, 4253, 4556], '(286)': [482], 'Google': [483, 505, 528, 543, 557, 582, 633, 652, 671, 684, 702, 719, 763, 781, 810, 862, 883, 903, 923, 952, 986, 1035, 1108, 1124, 1175, 1189, 1211, 1245, 1301, 1326, 1348, 1380, 1406, 1428, 1456, 1478, 1524, 1546, 1574, 1625, 2203, 2225, 2469, 2725, 2770, 2796, 2817, 2934, 2960, 2982, 3174, 3196, 3217, 3313, 3335, 3357, 3400, 3422, 3444, 3608, 3630, 3652, 3706, 3723, 3756, 3860, 3882, 3918, 4006, 4255, 4558], 'Scholar,': [484, 506, 529, 544, 558, 634, 653, 672, 685, 703, 764, 782, 863, 884, 1176, 1190, 1302, 1327, 1381, 1407, 1429, 1457, 1525, 1547, 2204, 2771, 2935, 2961, 3175, 3314, 3336, 3401, 3423, 3609, 3631, 3707, 3861, 4256], '2Rothman': [485], 'J.H.': [486, 570, 931, 1282, 1314], 'Raymond': [487, 1283], 'C.K.': [488, 1284], 'Gilbert': [489, 1285], 'T.': [490, 657, 1286], "O'Hara": [491, 1287], 'P.J.': [492, 1288], 'Stevens': [493, 1289], 'T.H.': [494, 1290], 'Cell.': [495, 623, 798, 876, 979, 1028, 1116, 1182, 1291, 1618, 2718, 3715, 4267], '61:': [497, 1293], '1063-1074Abstract': [498, 1294], 'Full': [499, 627, 802, 804, 1295, 1448, 1450, 1470, 1472, 1516, 1518, 1538, 1540, 1566, 1568, 2217, 2219, 3209, 3211, 3349, 3351, 3436, 3438, 3644, 3646, 3874, 3876], 'Text': [500, 628, 803, 805, 1296, 1449, 1451, 1471, 1473, 1517, 1519, 1539, 1541, 1567, 1569, 2218, 2220, 3210, 3212, 3350, 3352, 3437, 3439, 3645, 3647, 3875, 3877], 'PDF': [501, 629, 806, 1297, 1452, 1474, 1520, 1542, 1570, 2221, 3213, 3353, 3440, 3648, 3878], '(214)': [504, 1300], '3Chen': [507], 'M.S.': [508], 'Obar': [509, 639], 'Schroeder': [511], 'C.C.': [512, 638], 'Austin': [513], 'T.W.': [514], 'Poodry': [515], 'Wadsworth': [517], 'S.C.': [518, 1196, 1230, 1333, 1413, 2188, 2802, 2967, 3181, 3320, 3407, 3615, 3741, 3845], '1991;': [522], '351:': [523], '583-586Crossref': [524], '(441)': [527], '4Dombrowski': [530], 'J.E.': [531, 674, 753, 1370, 3200, 3340, 3427, 3635], 'Raikhel': [532], 'N.V.': [533], 'Plant': [534, 573, 978, 1167, 1181, 1203, 1237, 1317, 1340, 1398, 1420, 1617, 2195, 2717, 2788, 2809, 2952, 2974, 3166, 3188, 3305, 3327, 3392, 3414, 3600, 3622, 3748, 3852], 'Mol.': [535, 574, 874, 1026, 1115, 1318, 3714], 'Biol.': [536, 575, 645, 664, 712, 855, 875, 1027, 1117, 1319, 1443, 1465, 1511, 1533, 1561, 2212, 3204, 3344, 3431, 3639, 3716, 3869], '1995;': [537, 678, 696, 757, 775, 1374, 3912, 4000], '28:': [538], '1121-1126Crossref': [539], '(35)': [542], '5Gu': [545], 'X.': [546, 912, 1178], 'Verma': [547, 913, 1179, 1462, 1530], 'D.P.S.': [548, 914], 'EMBO': [549, 915, 944, 1100, 2762, 2926, 3698, 4247, 4550], 'J.': [550, 616, 643, 662, 710, 853, 916, 945, 1101, 1442, 1464, 1510, 1532, 1560, 2211, 2447, 2763, 2927, 3203, 3343, 3430, 3638, 3699, 3868, 4248, 4266, 4551], '1996;': [551, 917, 1102, 2764, 2928, 3206, 3346, 3433, 3641, 3700, 4249, 4552], '15:': [552, 918, 1103, 2765, 2929, 3701, 4250, 4553], '695-704Crossref': [553, 919], '(141)': [556, 922], '6Kang': [559, 1303], 'S.G.': [560, 933, 1154, 1304, 1385, 2775, 2939, 3153, 3292, 3379, 3587], 'Jin': [561, 1305], 'J.B.': [562, 965, 1306, 1604, 2704], 'Piao': [563, 938, 1159, 1307, 1390, 2780, 2944, 3158, 3297, 3384, 3592], 'H.L.': [564, 939, 1160, 1308, 1391, 2781, 2945, 3159, 3298, 3385, 3593], 'Pih': [565, 936, 1155, 1309, 1386, 2776, 2940, 3154, 3293, 3380, 3588], 'K.T.': [566, 937, 1156, 1310, 1387, 2777, 2941, 3155, 3294, 3381, 3589], 'Jang': [567, 934, 1157, 1311, 1388, 2778, 2942, 3156, 3295, 3382, 3590], 'H.J.': [568, 935, 1158, 1312, 1389, 2779, 2943, 3157, 3296, 3383, 3591], 'Lim': [569, 1313], 'Hwang': [571, 942, 976, 1165, 1201, 1235, 1315, 1338, 1396, 1418, 1615, 2193, 2715, 2786, 2807, 2950, 2972, 3164, 3186, 3303, 3325, 3390, 3412, 3598, 3620, 3746, 3850], 'I.': [572, 600, 943, 977, 1085, 1166, 1202, 1236, 1316, 1339, 1397, 1419, 1616, 2194, 2716, 2747, 2787, 2808, 2911, 2951, 2973, 3165, 3187, 3304, 3326, 3391, 3413, 3599, 3621, 3683, 3747, 3851, 4232, 4535], '1998;': [576, 799, 946, 1320, 2214, 3871], '38:': [577, 1321], '437-447Crossref': [578, 1322], '(52)': [581, 1325], 'Scholar).': [583, 720, 811, 987, 1036, 1125, 1212, 1246, 1349, 1479, 1575, 1626, 2470, 2726, 2983, 3218, 3358, 3445, 3653, 3724, 3757, 3883, 4007, 4559], 'The': [584, 1050, 1733, 1785, 1857, 1879, 1979, 1995, 2095, 2116, 2172, 2247, 2345, 2471, 2629, 2654, 3011, 3135, 3219, 3486, 4041, 4415], 'mechanism': [585, 991, 2835], 'which': [587, 817, 2837, 3885, 4127], 'I': [589, 726, 815, 1055, 4301], 'plays': [590, 2839], 'endocytosis': [594, 821], 'extensively': [597], 'studied': [598], '(7Gout': [599], 'Dhand': [601], 'R.': [602, 1087, 1091, 2749, 2753, 2913, 2917, 3685, 3689, 3896, 3984, 4234, 4238, 4537, 4541], 'Hiles': [603], 'I.D.': [604, 620], 'Fry': [605], 'M.J.': [606, 941, 1083, 1164, 1395, 2745, 2785, 2909, 2949, 3163, 3302, 3389, 3597, 3681, 3910, 3998, 4230, 4533], 'Panayotou': [607, 1098, 2760, 2924, 3696, 4245, 4548], 'G.': [608, 1099, 2761, 2925, 3697, 4246, 4549], 'Das': [609], 'P.': [610, 694, 773, 797, 3894, 3982], 'Truong': [611], 'O.': [612], 'Totty': [613], 'N.F.': [614], 'Husan': [615], 'Booker': [617], 'G.W.': [618, 975, 1200, 1234, 1337, 1417, 1614, 2192, 2714, 2806, 2971, 3185, 3324, 3411, 3619, 3745, 3849], 'Campbell': [619], 'Waterfield': [621, 1096, 2758, 2922, 3694, 4243, 4546], 'M.D.': [622, 1097, 2759, 2923, 3695, 4244, 4547], '1993;': [624, 646], '75:': [625], '25-36Abstract': [626], '(485)': [632], '8Herskovits': [635], 'J.S.': [636], 'Burgess': [637], 'Cell': [644, 663, 711, 854, 2043], '122:': [647], '565-578Crossref': [648], '(398)': [651], '9Damke': [654], 'H.': [655, 707, 794, 1433, 1435, 1501, 1503], 'Baba': [656], 'Warnock': [658], 'D.E.': [659, 3198, 3338, 3425, 3633], 'Schmid': [660, 675, 690, 708, 754, 769, 1371, 3201, 3341, 3428, 3636], 'S.L.': [661, 676, 691, 709, 755, 770, 1372, 3202, 3342, 3429, 3637], '1994;': [665], '127:': [666, 1206, 1240, 1343, 1423, 2198, 2812, 2977, 3191, 3330, 3417, 3625, 3751, 3855], '915-934Crossref': [667], '(1046)': [670], '10Hinshaw': [673], '374:': [679, 697, 758, 776, 1375], '190-192Crossref': [680, 759, 1376], '(665)': [683, 762, 1379], '11Takei': [686, 765], 'K.': [687, 766, 784, 790, 1077, 1439, 1441, 1507, 1509, 2739, 2903, 3675, 4224, 4527], 'McPherson': [688, 767], 'P.S.': [689, 768], 'De': [692, 771, 795], 'Camilli': [693, 772, 796], '186-190Crossref': [698, 777], '(657)': [701, 780], '12Sever': [704], 'S.': [705, 887, 895, 2455, 2461, 3898, 3904, 3908, 3986, 3992, 3996], 'Damke': [706], '2000;': [713, 856, 1467, 1535], '150:': [714], '1137-1148Crossref': [715], '(196)': [718], 'From': [721], 'these': [722, 995, 1041, 1355, 1927, 3016, 3760, 3777, 3806, 4021, 4310, 4360, 4464, 4475], 'studies,': [724], 'function': [731], 'enzyme': [735], 'pinches': [737], 'off': [738], 'neck': [740], 'invaginated': [742], 'membranes,': [743, 2891, 2992, 3081], 'thereby': [744], 'releasing': [745], 'budding': [747], '(10Hinshaw': [752, 1369], '13Takei': [783], 'Haucke': [785], 'V.': [786, 788, 2445, 3906, 3994], 'Slepnev': [787], 'Farsad': [789], 'Salazar': [791], 'M.': [792, 1110, 3709, 4262], 'Chen': [793], '94:': [800, 2464], '131-141Abstract': [801], '(294)': [809], 'Unlike': [812], 'protein,': [816, 4377], 'animal': [823], 'cells,': [824], 'other': [825, 838, 1127, 2732, 3366, 3501, 4147, 4208], 'members': [826, 1128, 1271, 2733, 4148], 'family': [830, 2737], 'proposed': [833], 'roles': [836], 'processes,': [840, 1009], 'maintenance': [843], 'mitochondrial': [845], 'morphology': [846], '(14Mozdy': [847], 'A.D.': [848], 'McCaffery': [849], 'J.M.': [850, 852, 873, 929, 1152, 1383, 2206, 2773, 2937, 3151, 3290, 3377, 3585, 3863], 'Shaw': [851, 872], '151:': [857], '367-380Crossref': [858], '(542)': [861], '15Fukushima': [864], 'N.H.': [865], 'Brisch': [866], 'E.': [867, 1081, 1437, 1505, 1549, 2743, 2907, 3679, 4228, 4531], 'Keegan': [868], 'B.R.': [869], 'Bleazard': [870], 'W.': [871], '2001;': [877, 980, 1029, 1205, 1239, 1342, 1422, 1619, 2197, 2719, 2811, 2976, 3190, 3329, 3416, 3624, 3750, 3854], '12:': [878, 1030], '2756-2766Crossref': [879], '(83)': [882], '16Arimura': [885], 'Si': [886], 'Tsutsumi': [888], 'N.': [889], 'Proc.': [890, 2456], 'Natl.': [891, 2457], 'Acad.': [892, 2458], 'Sci.': [893, 2459], 'U.': [894, 2460], 'A.': [896, 2462], '2002;': [897], '99:': [898], '5727-5731Crossref': [899], '(161)': [902], 'Scholar),': [904, 924, 953, 2818, 3919], 'cell': [905], 'plate': [906], 'plant': [909, 3148], 'cells': [910, 3149], '(5Gu': [911], 'thylakoid': [925], 'biogenesis': [927], '(17Park': [928], 'Cho': [930, 940, 1163, 1394, 2784, 2948, 3162, 3301, 3388, 3596], 'Kang': [932, 1153, 1384, 2774, 2938, 3152, 3291, 3378, 3586], '17:': [947], '859-867Crossref': [948], '(50)': [951], 'vacuolar': [955], 'at': [959, 1700, 1724, 1911, 1969, 1976, 1985, 1992, 2036, 2040, 2050, 2057, 2092, 2101, 2270, 2297, 2317, 2385, 2406, 2487, 2514, 2526, 2620, 2636, 2643, 3094, 3129, 3224, 3256, 3503, 3536], '(TGN)1': [963], '(18Jin': [964, 1603, 2703], 'Kim': [966, 968, 972, 1197, 1231, 1334, 1414, 1605, 1607, 1611, 2189, 2705, 2707, 2711, 2803, 2968, 3182, 3321, 3408, 3616, 3742, 3846], 'Y.A': [967, 1606, 2706], 'S.J.': [969, 1608, 2708], 'Lee': [970, 1609, 2709], 'S.H.': [971, 1198, 1232, 1335, 1415, 1610, 2190, 2710, 2804, 2969, 3183, 3322, 3409, 3617, 3743, 3847], 'D.H.': [973, 1612, 2712], 'Cheong': [974, 1199, 1233, 1336, 1416, 1613, 2191, 2713, 2805, 2970, 3184, 3323, 3410, 3618, 3744, 3848], '13:': [981, 1620, 2720], '1511-1526Crossref': [982, 1621, 2721], '(304)': [985, 1624, 2724], 'Although': [988], 'exact': [990], 'action': [993], 'remains': [997], 'be': [999, 1004, 1044, 1060, 2687, 2888, 3272, 3450, 3567], 'elucidated,': [1000], 'they': [1001], 'appear': [1002], 'including': [1010], 'structures': [1015, 4328], 'fission': [1019], '(19Yoon': [1020], 'Y.': [1021], 'Pitts': [1022], 'K.R.': [1023], 'McNiven': [1024], 'M.A.': [1025], '2894-2905Crossref': [1031], '(242)': [1034], 'To': [1037, 1627, 1756, 1802, 1943, 2828, 2984, 3458, 3808, 4113, 4560], 'modulate': [1038], 'structure,': [1040], 'must': [1043], 'able': [1045], 'bind': [1047, 1146, 1220, 3731], 'membranes.': [1049, 1644, 2246, 2827, 3782], 'association': [1052, 1256, 2849, 3792], 'mediated': [1061], '4,5-bisphosphate': [1074, 2156, 3672], '(PtdIns-4,5-P2)': [1075], '(20Salim': [1076, 2738, 2902, 3674, 4223, 4526], 'Bottomley': [1078, 2740, 2904, 3676, 4225, 4528], 'M.J': [1079, 2741, 2905, 3677, 4226, 4529], 'Querfurth': [1080, 2742, 2906, 3678, 4227, 4530], 'Zvelebil': [1082, 2744, 2908, 3680, 4229, 4532], 'Gout': [1084, 2746, 2910, 3682, 4231, 4534], 'Scaife': [1086, 2748, 2912, 3684, 4233, 4536], 'Margolis': [1088, 2750, 2914, 3686, 4235, 4538], 'R.L.': [1089, 2751, 2915, 3687, 4236, 4539], 'Gigg': [1090, 2752, 2916, 3688, 4237, 4540], 'Smith': [1092, 2754, 2918, 3690, 4239, 4542], 'C.I.': [1093, 2755, 2919, 3691, 4240, 4543], 'Driscoll': [1094, 2756, 2920, 3692, 4241, 4544], 'P.C.': [1095, 2757, 2921, 3693, 4242, 4545], '6241-6250Crossref': [1104, 2766, 2930, 3702, 4251, 4554], '(495)': [1107, 2769, 2933, 3705, 4254, 4557], 'Scholar,21Achiriloaie': [1109], 'Barylko': [1111, 3710], 'B.': [1112, 1555, 3711], 'Albanesi': [1113, 3712], 'J.P.': [1114, 3713], '1999;': [1118, 1445, 1513, 1563, 3717], '19:': [1119, 3718], '1410-1415Crossref': [1120, 3719], '(145)': [1123, 3722], 'Also,': [1126, 1711, 1924, 3725], 'family,': [1132, 1275], 'asArabidopsis': [1134], '1': [1136, 1974, 2011, 2014, 2018, 2028, 2106, 2295, 2315, 2367, 2369, 2372, 2374, 2601, 2604, 2607, 2624, 2641], '(ADL1),': [1137], 'ADL2,': [1138], 'phragmoplastin': [1140], 'also': [1141, 3449, 3801], 'vivo': [1150, 2860], '(22Park': [1151, 3150, 3289, 3376, 3584], 'Yoon': [1161, 1392, 2782, 2946, 3160, 3299, 3386, 3594], 'H.W.': [1162, 1393, 1431, 1499, 2783, 2947, 3161, 3300, 3387, 3595], 'Physiol.': [1168, 1204, 1238, 1341, 1399, 1421, 2196, 2789, 2810, 2953, 2975, 3167, 3189, 3306, 3328, 3393, 3415, 3601, 3623, 3749, 3853], '1997;': [1169, 1183, 1400, 2463, 2790, 2954, 3168, 3307, 3394, 3602], '115:': [1170, 1401, 2791, 2955, 3169, 3308, 3395, 3603], '763-771Crossref': [1171, 1402, 2792, 2956, 3170, 3309, 3396, 3604], '(40)': [1174, 1405, 2795, 2959, 3173, 3312, 3399, 3607], '23Gu': [1177], 'D.P.': [1180, 1463, 1531], '9:': [1184], '157-169Crossref': [1185], '(118)': [1188], '24Kim': [1191, 1328, 1408, 2962, 3176, 3315, 3402, 3610], 'Y.W.': [1192, 1226, 1329, 1409, 2184, 2798, 2963, 3177, 3316, 3403, 3611, 3737, 3841], 'Park': [1193, 1195, 1227, 1229, 1330, 1332, 1410, 1412, 2185, 2187, 2799, 2801, 2964, 2966, 3178, 3180, 3317, 3319, 3404, 3406, 3612, 3614, 3738, 3740, 3842, 3844], 'D.S.': [1194, 1228, 1331, 1411, 2186, 2800, 2965, 3179, 3318, 3405, 3613, 3739, 3843], '1243-1255Crossref': [1207, 1241, 1344, 1424, 2199, 2813, 2978, 3192, 3331, 3418, 3626, 3752, 3856], '(49)': [1210, 1244, 1347, 1427, 2202, 2816, 2981, 3195, 3334, 3421, 3629, 3755, 3859], 'Among': [1213, 3945], 'these,': [1214], 'ADL2': [1215, 1280, 3145, 3583, 3726], 'PtdIns-4-Pin': [1223], '(24Kim': [1225, 2183, 3736, 3840], 'except': [1248], 'unclear': [1261], 'because': [1262, 4513], 'apparently': [1267], 'absent': [1268], 'certain': [1270], 'Vsp1p': [1278], '(2Rothman': [1281], 'Another': [1350], 'biochemical': [1352], 'characteristic': [1353], 'their': [1358], 'complex': [1367, 3279, 3496, 3572], '22Park': [1382, 2772, 2936], '25Shin': [1430], 'Takatsu': [1432, 1500], 'Mukai': [1434, 1502], 'Munekata': [1436, 1504], 'Murakami': [1438, 1506], 'Nakayama': [1440, 1508], 'Chem.': [1444, 1466, 1512, 1534, 1562, 2213, 3205, 3345, 3432, 3640, 3870], '274:': [1446, 1514, 1564], '2780-2785Abstract': [1447, 1515], '(61)': [1455, 1523], '26Zhang': [1458, 1526], 'Z.': [1459, 1461, 1527, 1529], 'Hong': [1460, 1528], '275:': [1468, 1536], '8779-8784Abstract': [1469, 1537], '(37)': [1477, 1545], 'self-assemble': [1486], 'into': [1487, 1955], 'homopolymeric': [1489], 'form': [1490], 'through': [1491, 1672, 2863], 'intermolecular': [1493, 1674], 'self-assembly': [1496], 'domains': [1497, 3769, 3778, 4198, 4206, 4312], '(25Shin': [1498], '27Smirnova': [1548], 'Shurland': [1550], 'D.L.': [1551], 'Newman-Smith': [1552], 'E.D.': [1553], 'Pishvaee': [1554], 'van': [1556], 'der': [1557], 'Bliek': [1558], 'A.M.': [1559], '14942-14947Abstract': [1565], '(116)': [1573], 'Previously,': [1576, 3359], 'localized': [1583], 'TGN': [1586, 1596], 'cargo': [1592, 2693], 'vacuole': [1600, 2702], 'further': [1628, 2985, 3785, 4561], 'understand': [1629, 3786], 'vivo,': [1635, 2842, 3574], 'characterized': [1637], 'study,': [1647], 'present': [1649, 2534, 3273, 3451, 3553], 'evidence': [1650], '(CTD).': [1684], 'thaliana': [1686], '(ecotype': [1687], 'Columbia)': [1688], 'grown': [1690, 1714], 'greenhouse': [1693], 'under': [1694, 2337, 2416, 4062], '16/8': [1696, 1729], 'h': [1697, 1730, 1968, 1975, 2296, 2316, 2625], 'light/dark': [1698, 1731], 'cycle': [1699], 'temperature': [1702, 2319], '20': [1704, 1725, 2257, 2267, 2325, 2578], '°C': [1705, 1726, 1971, 2272, 2622, 2645], 'relative': [1707], 'humidity': [1708], '70%.': [1710], 'plants': [1712], 'were': [1713, 1813, 1832, 1842, 1864, 1889, 1903, 1953, 1981, 1997, 2097, 2119, 2166, 2176, 2242, 2249, 2357, 2396, 2474, 2483, 2522, 2540, 2584, 2631, 2657, 2996, 3516, 4341], 'on': [1715, 2085], 'Murashige': [1716], 'Skoog': [1718], 'plates': [1719], 'growth': [1722], 'chamber': [1723], 'cycle.': [1732], '(amino': [1738, 1769, 1789], 'residues': [1740, 1771, 1791, 4184], '558–759)': [1741], 'amplified': [1743, 1777, 1814, 1843], 'polymerase': [1746], 'chain': [1747], 'reaction': [1748], 'using': [1749, 1795, 1815, 1844, 1866, 2227, 2557, 2669, 3468, 3828, 4048, 4079, 4157, 4272], 'two': [1750, 1779, 1796, 1816, 1845, 1867, 3484, 4478], 'specific': [1751, 1780, 1797], 'primers': [1752, 1781], '(GAGACGCCGGAGGTCTCTGG': [1753, 1782], 'GGATCCGAACAACAGCCTTTGG).': [1755], 'generate': [1757, 1803, 1937], '1877': [1759, 4419], 'mutant': [1760], 'containing': [1761, 2022, 2256, 2287, 2378, 2431, 2566, 2577], '558–914),': [1772], 'DNA': [1774, 1892, 1925], 'fragment': [1775], 'ATACCTGTAAGCTGAACC).': [1784], 'CTD': [1786], '760–914)': [1792], 'PCR-amplified': [1794, 1865], 'primers,': [1798], 'TGTCAAGTAGAGAAAGCAAA': [1799], 'ATACCTGTAAGCTGAACC.': [1801], 'PHD(ΔI1),': [1804, 1885], 'N-': [1805, 1836, 1858, 1880], 'sets': [1817, 1846, 1868], 'primers:': [1819, 1848, 1870], 'GAGACGCCGGAGGTCTCTGG': [1820, 1849, 1871], 'AATAGTGCATTCCTCC': [1822], 'AAGGACCAGGCCTTGT': [1824], 'GGATCCGAACAACAGCCTTTGG,': [1826, 1855], 'respectively,': [1827], 'resulting': [1830], 'fragments': [1831, 1883, 1893], 'ligated.': [1833, 1891], 'Similarly,': [1834], 'PHD(ΔI2)': [1841, 1886], 'AAGGGCATTGTGAGCTT': [1851], 'AACGAGTGGATTAATA': [1853], 'respectively.': [1856, 1878], 'PHD(ΔI3)': [1863, 1888], 'tccacgagcctggat': [1873], 'GGATCCGAACAACAGCCTTTGG': [1875], 'CCAGAAGAGGAGCTC,': [1877], 'then': [1890, 2046, 2274, 2333, 2383, 2632, 3002], 'encoding': [1894, 1926], 'all': [1895], 'mutants': [1898, 1929, 4340], 'full-length': [1901, 4375, 4409, 4472], 'ligated': [1904, 1931], 'in-frame': [1905], '(MBP)': [1910], 'XbaI': [1913], 'EcoRI': [1915], 'sites': [1916], 'pMAL-c2': [1918], '(New': [1919], 'England': [1920], 'Biolabs,': [1921], 'Beverly,': [1922], 'MA).': [1923], 'pGEX-5X-1': [1933], '(Amersham': [1934, 2353], 'Biosciences)': [1935], 'glutathione': [1938], 'S-transferase': [1939], '(GST)': [1940], 'fusion': [1941, 1948, 2117, 2549, 2572, 2582, 3823, 3979, 4352, 4378, 4392], 'proteins.': [1942, 2230, 2394, 4201], 'express': [1944], 'MBP': [1945, 2083, 2143, 2548, 2581, 3822, 3937, 3978, 4013, 4055, 4351, 4395], 'or': [1946, 1972, 2079, 2134, 3766], 'GST': [1947, 2077, 2132, 2561, 2571], 'proteins,': [1949, 2064, 4052, 4209, 4353, 4362], 'expression': [1951], 'constructs': [1952], 'introduced': [1954], 'JM109.': [1956], 'Expression': [1957], 'recombinant': [1959, 2063, 2229, 2280, 2570, 3814, 4051, 4068, 4361], 'induced': [1962], '0.3': [1964], 'mmisopropyl-d-thiogalactopyranoside': [1965], '4': [1967, 1993, 2041, 2058, 2093, 2271, 2621, 2644], '28': [1970], '37': [1977], '°C.': [1978, 1994, 2042, 2059, 2094], 'cultures': [1980], 'harvested': [1982], 'centrifugation': [1984, 2049, 2100, 2486, 2525, 2635], '5,000': [1986], '×': [1987, 2052, 2103, 2387, 2528, 2638], 'g': [1988, 2053, 2104, 2529, 2639], '5': [1990, 2123], 'min': [1991, 2056, 2091, 2107, 2326, 2390, 2513, 2642], 'pellets': [1996], 'resuspended': [1998, 2472], 'ice-cold': [2000, 2113], 'resuspension': [2001], 'buffer': [2002, 2255, 2361, 2430, 2592], '(20': [2003, 2593], 'mm': [2004, 2009, 2012, 2015, 2019, 2124, 2127, 2136, 2262, 2363, 2370, 2375, 2380, 2433, 2438, 2442, 2594, 2599, 2602, 2605, 2608], 'Tris-HCl,': [2005, 2128, 2595], 'pH': [2006, 2129, 2140, 2259, 2365, 2596], '7.4,': [2007, 2597], '200': [2008], 'NaCl,': [2010, 2263, 2439, 2600], 'EDTA,': [2013, 2603], 'dithiothreitol,': [2016, 2609], 'phenylmethylsulfonyl': [2020, 2376], 'fluoride)': [2021, 2377], 'protease': [2023], 'inhibitors': [2024], '(1': [2025], 'μg/ml': [2026, 2029, 2278], 'aprotinin,': [2027], 'antipain)': [2030], 'sonicated': [2032, 2475], '30-s': [2034], 'bursts': [2035], 'maximal': [2038], 'setting': [2039], 'debris': [2044], 'removed': [2047, 3240, 3548], '18,000': [2051, 2386], '15': [2055, 2389, 2512], 'For': [2060, 2560], 'purification': [2061], 'cleared': [2065, 2564, 2575], 'supernatant': [2066, 2539, 2565, 2576], 'incubated': [2068, 2275, 2309, 2334, 2510, 2617], '1/100': [2070], 'volume': [2071], 'pre-equilibrated': [2073], 'glutathione-Sepharose': [2074, 2627], 'beads': [2075, 2096, 2630, 3831], '(for': [2076, 2082, 2131, 2142], 'fusions)': [2078, 2084], 'amylose': [2080, 3829], 'resin': [2081, 3830], 'orbital': [2087], 'shaker': [2088], '30': [2090, 2531], 'collected': [2098, 2484], '1,000': [2102], 'washed': [2109, 2321, 2336, 2647], 'three': [2110, 2302, 2322], 'times': [2111, 2303, 2323, 2649], 'suspension': [2114, 2479], 'buffer.': [2115, 2653], 'eluted': [2120, 3490, 3502, 3527], 'adding': [2122], 'glutathione,': [2125], '50': [2126, 2138, 2432, 2503], '8.0': [2130, 2141], 'fusions),': [2133], '10': [2135, 2252, 2283, 2491, 2567, 2587], 'maltose,': [2137], 'mmTris-HCl,': [2139, 2258], 'fusions).': [2144], 'Various': [2145], 'lipids,': [2146], '(PE),': [2150], '(PC),': [2152], 'PtdIns,': [2153], 'PtdIns-4-P,': [2154], '(PtdIns-4,5-P2),': [2157], 'PtdIns-3-P,': [2158, 2403], '3,4-bisphosphate': [2160], '(PtdIns-3,4-P2),': [2161], '3,4,5-trisphosphate': [2164], '(PtdIns-3,4,5-P3),': [2165], 'used': [2167, 2350, 3833, 3975], 'analysis.': [2171, 3023], 'done': [2177], 'Fat': [2179, 3958], 'Western': [2180, 2554, 2666, 3021, 3959, 4076], 'blot': [2181, 2307, 2555, 2667, 3022, 3960, 4077], '28Stevenson': [2205, 3862], 'Perera': [2207, 3864], 'I.Y.': [2208, 3865], 'Boss': [2209, 3866], 'W.F.': [2210, 3867], '273:': [2215, 3872], '22761-22767Abstract': [2216, 3873], '(128)': [2224, 3881], 'Scholar)': [2226, 4271], 'affinity-purified': [2228, 3827], 'Briefly,': [2231], '10-μl': [2232], 'volumes': [2233], 'concentrations': [2236], 'lipids': [2238, 2473, 4465], 'dissolved': [2239], 'chloroform': [2241], 'applied': [2243], 'nitrocellulose': [2245], 'blocked': [2250], 'ml': [2253, 2284, 2588], '7.5,': [2260, 2366], '140': [2261], '0.1%': [2265, 2613], 'Tween': [2266], '(TTBS)': [2268], 'overnight': [2269], '0.5': [2277, 2441], 'purified': [2279, 3923, 4050], 'TTBS': [2286], '3%': [2288], 'fatty': [2289], 'acid-free': [2290], 'bovine': [2291], 'serum': [2292], 'albumin': [2293], 'room': [2298, 2318, 2515], 'temperature.': [2299, 2516], 'After': [2300], 'washing': [2301], 'TTBS,': [2305], 'primary': [2312, 2343, 4086], 'antibody': [2313, 2331, 4083], 'each': [2327, 2411], 'time.': [2328], 'A': [2329], 'secondary': [2330, 4275], 'same': [2339, 2507, 3247, 3538], 'conditions': [2340], 'antibody.': [2344, 2559, 2672, 4087], 'ECL': [2346], 'detection': [2347], 'system': [2348], 'visualization': [2352], 'Biosciences).': [2354], 'Purified': [2355], 'dialyzed': [2358], 'against': [2359], 'HP': [2360], '(10': [2362], 'Hepes,': [2364], 'mmdithiothreitol,': [2368], 'MgCl2,': [2371], 'mmEGTA,': [2373], '100': [2379, 2437], 'NaCl': [2381], 'centrifuged': [2384], 'gfor': [2388], 'remove': [2392], 'aggregated': [2393], 'Liposomes': [2395, 2482], 'prepared': [2397, 3813], 'mixing': [2399], 'phosphatidylcholine,': [2400], 'phosphatidylethanolamine,': [2401], 'phosphatidylinositol,': [2402], 'PtdIns-4-P': [2405, 4429], 'ratio': [2408], 'indicated': [2409], 'experiment,': [2412], 'drying': [2413], 'mixture': [2415], 'nitrogen,': [2417], 'resuspending': [2419], 'final': [2422], 'concentration': [2423], '2': [2425], 'mg': [2426], 'total': [2428, 2993], 'phospholipid/ml': [2429], 'Hepes-NaOH': [2434], '(pH': [2435], '7.4),': [2436], 'EDTA': [2443], '(29Patki': [2444], 'Virbasius': [2446], 'Lane': [2448], 'W.S.': [2449], 'Toh': [2450], 'B.H.': [2451], 'Corvera': [2454], '7326-7330Crossref': [2465], '(203)': [2468], 'until': [2476], 'homogenous': [2478], 'formed.': [2481], '16,000': [2488, 2527], '×g': [2489], 'min.': [2492, 2532], 'Liposome': [2493], '(50': [2494], 'μl)': [2495], 'mixed': [2497, 2585], '(5': [2500], 'μg': [2501, 2568, 2579], 'μl': [2504], 'buffer)': [2508], 'Proteins': [2517, 2533], 'bound': [2518, 2655, 4384], 'liposomes': [2521], 'sedimented': [2523], 'pellet': [2537], 'fractionated': [2541, 2659, 3003, 3083], 'SDS-PAGE': [2543], 'presence': [2546, 3012], 'detected': [2552, 3031, 3113, 4074], 'anti-MBP': [2558, 2671, 4082], 'pull-down': [2562, 2591, 2652], 'assays,': [2563], '150': [2598], 'EGTA,': [2606], '0.2%': [2610], 'Triton': [2611, 2999, 3044, 3054, 3074, 3124, 3236, 3265, 3519, 3543], 'X-100,': [2612, 3045, 3075, 3520], 'Nonidet': [2614], 'P-40)': [2615], 'agitation': [2619], 'beads.': [2628], 'pelleted': [2633], '2,000': [2637], 'four': [2648], 'eluted,': [2658], '10%': [2661], 'SDS-PAGE,': [2662], 'subjected': [2664], 'homolog': [2676], 'intracellular': [2690], 'As': [2727, 2867, 3024, 3475, 3964, 4369], 'case': [2730, 2895, 3283, 3578, 3656, 4372], 'Scholar,24Kim': [2797], 'it': [2819, 3252, 3360], 'likely': [2821], 'enhance': [2829, 4114], 'our': [2830, 4115], 'understanding': [2831, 4116], 'rolein': [2841], 'investigated': [2844, 2854], 'First': [2852], 'subcellular': [2856], 'distribution': [2857], 'ADL6in': [2859], 'ultracentrifugation': [2862], 'gradient.': [2866, 3104, 3134], 'Fig.': [2870, 3027, 3478, 4346, 4357, 4437], '1,': [2871], 'region': [2880, 3034, 3116, 4128, 4180, 4211], '37–41%': [2882, 3048], 'sucrose,': [2883], 'indicating': [2884, 3541], 'may': [2887, 3238, 3271, 3448, 3546, 3566], 'confirm': [2986, 4562], 'extracts': [2995, 3071, 3470, 3515], 'treated': [2997, 3072, 3517], 'X-100': [3000, 3055, 3125, 3237, 3266, 3544], 'gradient': [3008, 3040, 3052, 3065, 3087, 3122, 3232, 3261], 'ultracentrifugation.': [3010], 'fractions': [3017, 3097], 'examined': [3019], '1A,': [3028], '30–37%': [3036, 3118], 'after': [3041, 3123, 3264], 'treatment': [3042, 3126, 3267, 3545], 'compared': [3046, 4139], 'without': [3053], 'treatment.': [3056], 'behavior': [3059, 3136], 'rather': [3067], 'unusual.': [3068], 'When': [3069, 3513], 'agent': [3077], 'can': [3079], 'solubilize': [3080], 'ultracentrifugation,': [3089], 'top': [3096, 3131, 3258], '(the': [3098], 'soluble': [3099], 'fractions)': [3100], 'contrast': [3107], 'notion,': [3110], 'but': [3127], 'not': [3128, 3254, 4015, 4171], 'quite': [3140, 4511], 'similar': [3141, 3767], 'ADL1': [3143, 3364], 'Scholar,30Warnock': [3197], 'Hinshaw': [3199, 3339, 3426, 3634], '271:': [3207, 3347, 3434, 3642], '22310-22314Abstract': [3208, 3348, 3435, 3643], '(208)': [3216, 3356, 3443, 3651], 'fact': [3220, 3250], 'migrated': [3223], 'low': [3226], 'percentage': [3227], 'strongly': [3233, 3560, 4025], 'suggests': [3234, 3268], 'At': [3245], 'time,': [3248], 'did': [3253, 4014], 'migrate': [3255], '(soluble': [3262], 'fraction)': [3263], 'ADL': [3287], 'isoforms': [3288], '30Warnock': [3337, 3424, 3632], 'complexes': [3375], 'Thus,': [3446, 3783, 4474], 'complex.': [3457], 'examine': [3459], 'possibility,': [3461], 'performed': [3463], 'assay': [3467, 4044, 4366], 'obtained': [3471], 'leaf': [3473], 'tissues.': [3474], '1B,': [3479], 'positions.': [3485], 'first': [3487, 3522, 3556, 4138], 'peak': [3488, 3523, 3534], 'much': [3491], 'earlier': [3492], 'than': [3493, 4294, 4407, 4427, 4468], 'rubisco': [3495], '(560': [3497], 'kDa),': [3498], 'whereas': [3499, 3531], 'position': [3505], 'corresponding': [3506], 'dimer': [3510, 3539], '(200': [3511], 'kDa).': [3512], 'later': [3529], 'fractions,': [3530], 'second': [3533], 'position,': [3540], 'peak.': [3557], 'support': [3561], 'notion': [3563], 'dynamin,': [3580, 3658], 'ADL1,': [3581], 'shows': [3662, 3886, 4034], 'phosphates': [3668], 'PtdIns-4,5-P2': [3673, 3892, 3973], '21Achiriloaie': [3708], '(PtdIns-4-P)': [3735], 'Binding': [3758, 4065], 'phospholipids': [3761, 4492], 'lipid-binding': [3768], 'thought': [3771], 'allow': [3773], 'associate': [3780], 'ADL6,': [3794, 4122], 'wanted': [3796, 4124], 'whether': [3799], 'any': [3804, 4019], 'phospholipids.': [3807, 4022], 'address': [3809], 'question,': [3811], 'Escherichia': [3818], 'coli': [3819], 'protein.': [3824], 'MBP:ADL6': [3825, 3950], '(Fig.': [3838, 3962, 4333, 4387, 4412, 4430], '2)': [3839, 4494], 'MBP:PHD(PLC-δ),': [3884], '(31Garcia': [3893, 3981], 'Gupta': [3895, 3983], 'Shah': [3897, 3985], 'Morris': [3899, 3987], 'A.J.': [3900, 3988], 'Rudge': [3901, 3989], 'S.A.': [3902, 3990], 'Scarlata': [3903, 3991], 'Petrova': [3905, 3993], 'McLaughlin': [3907, 3995], 'Rebecchi': [3909, 3997], 'Biochemistry.': [3911, 3999], '34:': [3913, 4001], '16228-16234Crossref': [3914, 4002], '(255)': [3917, 4005], 'expressed': [3921, 4349], 'use': [3925], 'positive': [3928], 'control': [3929, 4012], 'assays.': [3934], 'included': [3940], 'negative': [3943, 4011], 'control.': [3944], 'phospholipid': [3947, 4042, 4524], 'molecules': [3948], 'examined,': [3949], '3).': [3963], 'expected,': [3965], 'PHD(PLC-δ)': [3966], 'when': [3974], 'contrast,': [4009, 4433], 'show': [4016], 'PtdIns-3-P.FIG.': [4032], '3ADL6': [4033], 'carried': [4046], 'out': [4047], 'MBP·ADL6': [4053], '(a),': [4054], '(b),': [4056], 'MBP·PHD(PLC-δ)': [4058], '(c),': [4059], 'described': [4061], '“Experimental': [4063], 'Procedures.”': [4064], 'polyclonal': [4081], 'PC,': [4088], 'phosphatidylcholine;': [4089], 'PE,': [4090], 'phosphatidylethanolamine;PI,': [4091], 'phosphatidylinositol;': [4092], '3P,': [4093], '3-phosphate;': [4095], '4P,': [4096], '4-phosphate;': [4098], '3,4P,': [4099], '3,4-bisphosphate;3,5P,': [4101], '3,5-bisphosphate;4,5P,': [4103], '4,5-bisphosphate;3,4,5P,': [4105], '3,4,5-trisphosphate.View': [4107], 'Large': [4108], 'Image': [4109], 'Figure': [4110], 'ViewerDownload': [4111], '(PPT)': [4112], 'We': [4137], 'amino': [4141, 4182, 4191, 4322], 'family.': [4152], 'Blastp': [4158], 'NCBI': [4161], 'server': [4162], 'suggested': [4163], '(data': [4170], 'shown).': [4172], 'Fig.4,': [4178], '558–759': [4185], 'significant': [4188], 'degree': [4189], 'Similar': [4202], 'predicted': [4213], 'consist': [4215], '7': [4217], 'β-sheets': [4218], 'followed': [4219], 'α-helix': [4222], '32Soisson': [4257], 'S.M.': [4258], 'Nimnual': [4259], 'A.S.': [4260], 'Uy': [4261], 'Bar-Sagi': [4263], 'D.': [4264], 'Kuriyan': [4265], '1988;': [4268], '16:': [4269], '259-268Google': [4270], 'structure': [4276], 'prediction': [4277], 'program': [4278], 'ExPASy': [4281], 'Molecular': [4282], 'Biology': [4283], 'Server.': [4284], 'slightly': [4292, 4403], 'larger': [4293], 'C-δ.': [4304], 'alignment': [4308], 'additional': [4321], 'acids': [4323], 'β-sheet': [4327], '4).': [4334], 'With': [4335], 'information,': [4337], 'several': [4338], 'generated,': [4342], '5A,': [4347], '2.': [4358], 'Using': [4359], 'performed.': [4368], '5B).': [4388], 'interestingly,': [4390], '(MBP:PHD)': [4400], 'different': [4404, 4504], 'pattern': [4406], '6,': [4413], 'PHD).': [4414], 'wild-type': [4416], '∼4-fold': [4421], 'higher': [4422], '5C).': [4431], '5,': [4438], 'B': [4439], 'C,': [4441], 'nearly': [4447], 'equal': [4448], 'PtdIns-4-P.': [4455], 'MBP:PHD': [4462], 'lower': [4467], 'points:': [4479], '1)': [4480], 'This': [4509], 'unexpected': [4512], 'most': [4515], 'cases': [4516]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W2017772012', 'counts_by_year': [{'year': 2022, 'cited_by_count': 1}, {'year': 2019, 'cited_by_count': 1}, {'year': 2018, 'cited_by_count': 1}, {'year': 2017, 'cited_by_count': 1}, {'year': 2015, 'cited_by_count': 1}, {'year': 2014, 'cited_by_count': 3}, {'year': 2013, 'cited_by_count': 2}, {'year': 2012, 'cited_by_count': 2}], 'updated_date': '2025-01-12T21:05:29.801400', 'created_date': '2016-06-24'}