Title: Pregnane X Receptor Is a Target of Farnesoid X Receptor
Abstract: The pregnane X receptor (PXR) is an essential component of the body's detoxification system. PXR is activated by a broad spectrum of xenobiotics and endobiotics, including bile acids and their precursors. Bile acids in high concentrations are toxic; therefore, their synthesis is tightly regulated by the farnesoid X receptor, and their catabolism involves several enzymes regulated by PXR. Here we demonstrate that the expression of PXR is regulated by farnesoid X receptor. Feeding mice with cholic acid or the synthetic farnesoid X receptor (FXR) agonist GW4064 resulted in a robust PXR induction. This effect was abolished in FXR knock-out mice. Long time bile acid treatment resulted in an increase of PXR target genes in wild type mice. A region containing four FXR binding sites (IR1) was identified in the mouse Pxr gene. This region was able to trigger an 8-fold induction after GW4064 treatment in transactivation studies. Deletion or mutation of single IR1 sites caused a weakened response. The importance of each individual IR1 element was assessed by cloning a triple or a single copy and was tested in transactivation studies. Two elements were able to trigger a strong response, one a moderate response, and one no response to GW4064 treatment. Mobility shift assays demonstrated that the two stronger responding elements were able to bind FXR protein. This result was confirmed by chromatin immunoprecipitation. These results strongly suggest that PXR is regulated by FXR. Bile acids activate FXR, which blocks synthesis of bile acids and also leads to the transcriptional activation of PXR, promoting breakdown of bile acids. The combination of the two mechanisms leads to an efficient protection of the liver against bile acid induced toxicity. The pregnane X receptor (PXR) is an essential component of the body's detoxification system. PXR is activated by a broad spectrum of xenobiotics and endobiotics, including bile acids and their precursors. Bile acids in high concentrations are toxic; therefore, their synthesis is tightly regulated by the farnesoid X receptor, and their catabolism involves several enzymes regulated by PXR. Here we demonstrate that the expression of PXR is regulated by farnesoid X receptor. Feeding mice with cholic acid or the synthetic farnesoid X receptor (FXR) agonist GW4064 resulted in a robust PXR induction. This effect was abolished in FXR knock-out mice. Long time bile acid treatment resulted in an increase of PXR target genes in wild type mice. A region containing four FXR binding sites (IR1) was identified in the mouse Pxr gene. This region was able to trigger an 8-fold induction after GW4064 treatment in transactivation studies. Deletion or mutation of single IR1 sites caused a weakened response. The importance of each individual IR1 element was assessed by cloning a triple or a single copy and was tested in transactivation studies. Two elements were able to trigger a strong response, one a moderate response, and one no response to GW4064 treatment. Mobility shift assays demonstrated that the two stronger responding elements were able to bind FXR protein. This result was confirmed by chromatin immunoprecipitation. These results strongly suggest that PXR is regulated by FXR. Bile acids activate FXR, which blocks synthesis of bile acids and also leads to the transcriptional activation of PXR, promoting breakdown of bile acids. The combination of the two mechanisms leads to an efficient protection of the liver against bile acid induced toxicity. A key function of the liver is the elimination of xenobiotics and endogenous catabolites from the systemic circulation. Although multiple reactions are involved, they generally are divided into three phases, hydroxylation (phase I), conjugation (phase II), and transport (phase III). The expression of many phase I, II, and III genes is regulated by transcription factors belonging to the nuclear receptor family (1Tirona R.G. Kim R.B. J. Pharm. Sci. 2005; 94: 1169-1186Abstract Full Text Full Text PDF PubMed Scopus (181) Google Scholar, 2Wang H. LeCluyse E.L. Clin. Pharmacokinet. 2003; 42: 1331-1357Crossref PubMed Scopus (256) Google Scholar, 3Handschin C. Meyer U.A. Pharmacol. Rev. 2003; 55: 649-673Crossref PubMed Scopus (404) Google Scholar). Two members of this family, the constitutive androstane receptor (CAR) 2The abbreviations used are: CAR, constitutive androstane; BSEP, bile salt export pump; receptor; CA, cholic acid; ChIP, chromatin immunoprecipitation; CYP, cytochromes P450; CYP7A1, cholesterol 7α hydroxylase; FXR, farnesoid X receptor; IR, inverted repeat; OATP, organic anion transporting peptide; MDR, multidrug resistance protein; PXR, pregnane X receptor; RXR, 9-cis retinoic acid receptor; SHP, small heterodimer partner; TK, thymidine kinase; HEK, human embryonic kidney. 2The abbreviations used are: CAR, constitutive androstane; BSEP, bile salt export pump; receptor; CA, cholic acid; ChIP, chromatin immunoprecipitation; CYP, cytochromes P450; CYP7A1, cholesterol 7α hydroxylase; FXR, farnesoid X receptor; IR, inverted repeat; OATP, organic anion transporting peptide; MDR, multidrug resistance protein; PXR, pregnane X receptor; RXR, 9-cis retinoic acid receptor; SHP, small heterodimer partner; TK, thymidine kinase; HEK, human embryonic kidney. (4Goodwin, B., and Moore, J. T. (2004) 25, 437–441Google Scholar, 5Masahiko N. Honkakoski P. Eur. J. Pharm. Sci. 2000; 11: 259-264Crossref PubMed Scopus (42) Google Scholar) and the pregnane X receptor (PXR) (6Kliewer S.A. Goodwin B. Willson T.M. Endocr. Rev. 2002; 23: 687-702Crossref PubMed Scopus (724) Google Scholar, 7Kliewer S.A. J. Nutr. 2003; 133: 2444-2447Crossref Google Scholar) have been identified as critical transcription factors for the activation of many genes involved in detoxification pathways in the liver and other tissues. Mice deficient in either of these genes have impaired capabilities of detoxifying xenobiotics and endobiotics (8Zhang J. Huang W. Qatanani M. Evans R.M. Moore D.D. J. Biol. Chem. 2004; 279: 49517-49522Abstract Full Text Full Text PDF PubMed Scopus (203) Google Scholar, 9Wei P. Zhang J. Dowhan D.H. Han Y. Moore D.D. Pharmacogenomics J. 2002; 2: 117-126Crossref PubMed Scopus (211) Google Scholar, 10Kliewer S.A. Willson T.M. J. Lipid Res. 2002; 43: 359-364Abstract Full Text Full Text PDF PubMed Google Scholar). One of the best known examples for the function of PXR and CAR is found within the regulation of the CYP3A subfamily of cytochromes P450 (CYPs). CYPs encode broad specificity heme-containing monooxygenases that catalyze the oxidation of a wide variety of structurally dissimilar compounds. In humans, the CYP3A enzymes are responsible for the oxidation of more than 60% of all prescribed drugs as well as many steroids and bile acids. CYP3A4 (Cyp3a11 in mice) expression is strongly activated by both CAR and PXR ligands and reduced in PXR–/– and CAR–/– mice (11Pascussi J.M. Gerbal-Chaloin S. Drocourt L. Maurel P. Vilarem M.J. Biochim. Biophys. Acta. 2003; 1619: 243-253Crossref PubMed Scopus (308) Google Scholar, 12Willson T.M. Kliewer S.A. Nat. Rev. Drug Discov. 2002; 1: 259-266Crossref PubMed Scopus (409) Google Scholar). PXR is activated by a broad spectrum of lipophilic substrates (7Kliewer S.A. J. Nutr. 2003; 133: 2444-2447Crossref Google Scholar, 10Kliewer S.A. Willson T.M. J. Lipid Res. 2002; 43: 359-364Abstract Full Text Full Text PDF PubMed Google Scholar, 13Jones S.A. Moore L.B. Shenk J.L. Wisely G.B. Hamilton G.A. McKee D.D. Tomkinson N.C. LeCluyse E.L. Lambert M.H. Willson T.M. Kliewer S.A. Moore J.T. Mol. Endocrinol. 2000; 14: 27-39Crossref PubMed Scopus (543) Google Scholar), including xenobiotics like antibiotics, antimycotics or herbal components, and endogenous substrates such as bile acids (14Staudinger J.L. Goodwin B. Jones S.A. Hawkins-Brown D. MacKenzie K.I. LaTour A. Liu Y. Klaassen C.D. Brown K.K. Reinhard J. Willson T.M. Koller B.H. Kliewer S.A. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 3369-3374Crossref PubMed Scopus (1125) Google Scholar) and their precursors (15Goodwin B. Gauthier K.C. Umetani M. Watson M.A. Lochansky M.I. Collins J.L. Leitersdorf E. Mangelsdorf D.J. Kliewer S.A. Repa J.J. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 223-228Crossref PubMed Scopus (176) Google Scholar). Moreover PXR is critical to the handling of bile acids (14Staudinger J.L. Goodwin B. Jones S.A. Hawkins-Brown D. MacKenzie K.I. LaTour A. Liu Y. Klaassen C.D. Brown K.K. Reinhard J. Willson T.M. Koller B.H. Kliewer S.A. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 3369-3374Crossref PubMed Scopus (1125) Google Scholar, 16Wagner M. Halilbasic E. Marschall H.U. Zollner G. Fickert P. Langner C. Zatloukal K. Denk H. Trauner M. Hepatology. 2005; 42: 420-430Crossref PubMed Scopus (269) Google Scholar, 17Karpen S.J. Hepatology. 2005; 42: 266-269Crossref PubMed Scopus (16) Google Scholar). Bile acids in high concentrations are toxic; therefore, their metabolism and transport is tightly regulated. One major governor here is the nuclear farnesoid X receptor (FXR), representing the physiological sensor for bile acids (18Forman B.M. Goode E. Chen J. Oro A.E. Bradley D.J. Perlmann T. Noonan D.J. Burka L.T. McMorris T. Lamph W.W. Evans R.M. Weinberger C. Cell. 1995; 81: 687-693Abstract Full Text PDF PubMed Scopus (964) Google Scholar). Bile acids like chenodeoxycholic, lithocholic, or deoxycholic acid as well as their taurine and glycine conjugates directly bind to FXR (19Makishima M. Okamoto A.Y. Repa J.J. Tu H. Learned R.M. Luk A. Hull M.V. Lustig K.D. Mangelsdorf D.J. Shan B. Science. 1999; 284: 1362-1365Crossref PubMed Scopus (2145) Google Scholar, 20Parks D.J. Blanchard S.G. Bledsoe R.K. Chandra G. Consler T.G. Kliewer S.A. Stimmel J.B. Willson T.M. Zavacki A.M. Moore D.D. Lehmann J.M. Science. 1999; 284: 1365-1368Crossref PubMed Scopus (1829) Google Scholar). FXR plays a critical role in the negative feedback regulation of bile acid synthesis. Bile acids activate FXR, which then induces the expression of another nuclear receptor termed small heterodimer partner (SHP). SHP itself initializes a cascade leading to the down-regulation of cholesterol 7α hydroxylase (CYP7A1) and sterol 12α-hydroxylase (CYP8B1) (21Goodwin B. Jones S.A. Price R.R. Watson M.A. McKee D.D. Moore L.B. Galardi C. Wilson J.G. Lewis M.C. Roth M.E. Maloney P.R. Willson T.M. Kliewer S.A. Mol. Cell. 2000; 6: 517-526Abstract Full Text Full Text PDF PubMed Scopus (1500) Google Scholar), thereby providing the repression of bile acid de novo synthesis. Additional roles of FXR in bile acid metabolism have been suggested by the observation that the transcriptional regulation of genes involved in the transport of bile acids also is regulated by FXR, including for example the bile acid export pump (BSEP) (22Schuetz E.G. Strom S. Yasuda K. Lecureur V. Assem M. Brimer C. Lamba J. Kim R.B. Ramachandran V. Komoroski B.J. Venkataramanan R. Cai H. Sinal C.J. Gonzalez F.J. Schuetz J.D. J. Biol. Chem. 2001; 276: 39411-39418Abstract Full Text Full Text PDF PubMed Scopus (346) Google Scholar, 23Ananthanarayanan M. Balasubramanian N. Makishima M. Mangelsdorf D.J. Suchy F.J. J. Biol. Chem. 2001; 276: 28857-28865Abstract Full Text Full Text PDF PubMed Scopus (650) Google Scholar), the organic anion transporter 1B1 and 1B3, also called organic anion transporting peptide (OATP)-C and OATP8 (24Jung D. Podvinec M. Meyer U.A. Mangelsdorf D.J. Fried M. Meier P.J. Kullak-Ublick G.A. Gastroenterology. 2002; 122: 1954-1966Abstract Full Text Full Text PDF PubMed Scopus (131) Google Scholar, 25Jung D. Kullak-Ublick G.A. Hepatology. 2003; 37: 622-631Crossref PubMed Scopus (159) Google Scholar), or the ileal bile acid binding protein (20Parks D.J. Blanchard S.G. Bledsoe R.K. Chandra G. Consler T.G. Kliewer S.A. Stimmel J.B. Willson T.M. Zavacki A.M. Moore D.D. Lehmann J.M. Science. 1999; 284: 1365-1368Crossref PubMed Scopus (1829) Google Scholar, 26Grober J. Zaghini I. Fujii H. Jones S.A. Kliewer S.A. Willson T.M. Ono T. Besnard P. J. Biol. Chem. 1999; 274: 29749-29754Abstract Full Text Full Text PDF PubMed Scopus (286) Google Scholar). Potentially toxic bile acids and bile acid precursors also can activate PXR and thereby induce cytochromes P450 of the CYP3A subfamily, which catalyze metabolism of bile acids. Furthermore PXR has been implicated in the down-regulation of CYP7A1, the mechanism remaining unknown (14Staudinger J.L. Goodwin B. Jones S.A. Hawkins-Brown D. MacKenzie K.I. LaTour A. Liu Y. Klaassen C.D. Brown K.K. Reinhard J. Willson T.M. Koller B.H. Kliewer S.A. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 3369-3374Crossref PubMed Scopus (1125) Google Scholar, 27Owsley E. Chiang J.Y. Biochem. Biophys. Res. Commun. 2003; 304: 191-195Crossref PubMed Scopus (80) Google Scholar, 28Li T. Chiang J.Y. Am. J. Physiol. Gastrointest. Liver Physiol. 2005; 288: 74-84Crossref PubMed Scopus (177) Google Scholar, 29Staudinger J. Liu Y. Madan A. Habeebu S. Klaassen C.D. Drug Metab. Dispos. 2001; 29: 1467-1472PubMed Google Scholar). Less is known about how PXR itself is regulated. Several studies demonstrated the down-regulation of PXR expression by inflammatory signals as mediated by lipopolysaccharides (30Teng S. Piquette-Miller M. J. Pharmacol. Exp. Ther. 2005; 312: 841-848Crossref PubMed Scopus (152) Google Scholar, 31Chen Y.H. Wang J.P. Wang H. Sun M.F. Wei L.Z. Wei W. Xu D.X. Toxicology. 2005; 211: 242-252Crossref PubMed Scopus (49) Google Scholar, 32Xu D.X. Chen Y.H. Wang J.P. Sun M.F. Wang H. Wei L.Z. Wei W. Toxicol. Sci. 2005; 87: 38-45Crossref PubMed Scopus (29) Google Scholar). PXR can be induced by dexamethasone through the glucocorticoid receptor in human hepatocytes, whereas PXR activators such as rifampicin and clotrimazole do not affect its expression (33Pascussi J.M. Drocourt L. Fabre J.M. Maurel P. Vilarem M.J. Mol. Pharmacol. 2000; 58: 361-372Crossref PubMed Scopus (330) Google Scholar). Whether bile acids play a role in the regulation of PXR has not been investigated so far. Because PXR is an important component of bile acid homeostasis, we investigated if there is a direct connection between PXR and FXR. Animals and Treatment—Wild type and FXR–/– mice were housed in a temperature-controlled room (22–23 °C) under a 12-h light/12-h dark cycle. The mice were maintained on a low cholesterol (0.02%) chow diet (Purina 5001, Harlan Teklad 75020, Madison, WI) until weeks 9–20 of age. Mice were either treated by oral gavaging with 450 mg of cholic acid/kg of mouse body weight (for the 3-day study fed a 0.2% cholic acid (CA) diet) or 50 mg of the selective synthetic FXR agonist GW4064/kg of mouse body weight or vehicle (polyethylene glycol 400: Tween 80, 4:1, v/v). Before each last treatment mice were fasted for 2 h, then gavaged and sacrificed after two additional hours. For long term treatment mice were fed for 7 days with an experimental diets consisting of the control diet supplemented with 1% (w/w) cholic acid. Tissues were frozen in liquid nitrogen and stored at –80 °C until further analysis. All experiments were approved by the Institutional Animal Care and Research Advisory Committee. RNA Extraction and Gene Expression Analysis—RNA extraction from mouse liver was performed using the RNA STAT-60 reagent (TEL-TEST B, Inc., Friendswood, TX) for cells using Trizol (Invitrogen). RNA was treated with RNase-free DNase (Roche Applied Science) and reverse-transcribed (Superscript II, Invitrogen) using random hexamers (Roche Applied Science) to a final concentration of 20 ng/μl. Gene-specific primers are shown in Table 1. Gene expression was investigated by real time PCR using syber-green incorporation.TABLE 1Oligonucleotides used for real time PCR, chimeric plasmid construction and mobility shift assaysTargetForward primer (5′-3′)Reverse primer (5′-3′)Quant-PxrCAAGGCCAATGGCTACCACGGGTGATCTCGCAGGTTQuant-ShpCGATCCTCTTCAACCAGATGAGGGCTCCAAGACTTCACACAQuant-CycloGGAGATGGCACAGGAGGAAGCCCGTAGTGCTTCAGCTTPXR-IntGGTATAGCTTCTTTGTCGACAGCCTGAAGGGTTCCTTACTGTACTTGAGGATCCCAAAGTCCATGCATCTK-3AAGCTGGGCCACTGGCCTTTGTGGGCCACTGGCCTTTGTGGGCCAC TGGCCTGATCAGGCCAGTGGCCCACAAAGGCCAGTGGCCCACAAAGGCCAG TGGCCCTK-3BAGCTAGCTCACTGTGCCTGGCAGCTCACTGTGCCTGGCAGCTCAC TGTGCCGATCGGCACAGTGAGCTGCCAGGCACAGTGAGCTGCCAGGCACAG TGAGCTTK-3CAGCTCGGTCAATGACCGTGTCCGGTCAATGACCGTGCTCGGTCAA TGACCGGATCCGGTCATTGACCGAGCACGGTCATTGACCGGACACGGTCAT TGACCGTK-3DAGCTCGGACACTGACCTGGTGCGGACACTGACCTGGTGCGGACAC TGACCTGATCAGGTCAGTGTCCGCACCAGGTCAGTGTCCGCACCAGGTCAG TGTCCGTK-AAGCTCTGAAGGGCCACTGGCCTTTGTAGATCTACAAAGGCCAGTGGCCCTTCAGTK-CAGCTCCATGCGGTCAATGACCGTGTCTGATCAGACACGGTCATTGACCGCATGGTK-DAGCTATCTGCGGACACTGACCTGGTGGGATCCCACCAGGTCAGTGTCCGCAGAperIR1AGCTGCTTTTAGGTCAATGACCTAGCCCTCGATCGAGGGCTAGGTCATTGACCTAAAAGCmutIR1AGCTGCTTTTAGTGCAATGAATTAGCCCTCGATCGAGGGCTAATTCATTGCACTAAAAGCSDM-ACTGAAGGGTTCTGAAGGTGCACTGGATTTTGTAGAGAGGCAGGCCTGCCTCTCTACAAAATCCAGTGCACCTTCAGAACCCTTCAGSDM-BCCGGACCCGAGACTGAGTGCACTGTATCTGGCAGGCCTGAGCTCGAGCTCAGGCCTGCCAGATACAGTGCACTCAGTCTCGGGTCCGGSDM-CCCACTGTAGCCCATGCGTGCAATGAATGTGTCTCCTGGATTGCAATCCAGGAGACACATTCATTGCACGCATGGGCTACAGTGGSDM-DCAAAGTCAGGGATCTGCGTGCACTGAATTGGTGGTCATAACTCAGCTGAGTTATGACCACCAATTCAGTGCACGCAGATCCCTGACTTTGMS-ACTGAAGGGCCACTGGCCTTTGTATACAAAGGCCAGTGGCCCTTCAGMS-BGACTGAGCTCACTGTGCCTGGCATGCCAGGCACAGTGAGCTCAGTCMS-CCCATGCGGTCAATGACCGTGTCTAGACACGGTCATTGACCGCATGGMS-mutCCCATGCGTGCAATGAATGTGTCTAGACACATTCATTGCACGCATGGMS-DATCTGCGGACACTGACCTGGTGGCCACCAGGTCAGTGTCCGCAMS-perIR1GCTTTTAGGTCAATGACCTAGCCCTCGAGGGCTAGGTCATTGACCTAAAAGCCyp3a11TGTAGATGAACTTCATGAACTGTCTAGCTAGACAGTTCATGAAGTTCATCTACACHIP AGGATGAGGAGGTTGGGAGTTCTGTAG′GGATGGCTGAGCTGTAAAGACTGGCHIP BGGGAAGCTGGCTTGGAAGGATGGGCCACCAGGGGTCTCTTATCCAGCHIP CAGGCTCGTCAGCTCAGGAGATCTCCCAAAGGCACATCAATCCAGGAGACCHIP DCCAAACCTGGGAGAGTTAGCCCCATCCTAGGGAGAGGTGCTCAG′ Open table in a new tab Plasmid Construction—A fragment of the mouse Pxr second intron gene region containing four potential IR1 sites was PCR-amplified using mouse genomic DNA as a template and Pfu-Turbo DNA polymerase (Stratagene, La Jolla, CA). The upstream primer (MoInt-for) contained an internal SalI site, and the downstream primer (Mo-Int-rev) contained an internal BamHI restriction site (Table 1). The resulting PCR product was digested and ligated into TK-Luc that had been predigested with the indicated enzymes. Deletion constructs were generated by restriction digest with HindIII. Chimeric TK-Luc constructs containing a triple or single copy of each individual IR1 element were constructed by ligating dimerized oligonucleotides (Table 1) containing a 5′-HindIII and 3′-BamHI overhang into TK-Luc plasmid predigested with HindIII and BamHI. Sequence identity of all constructs was verified by sequence analysis. Plasmid DNA was prepared using the Sigma (Rotkreuz, Switzerland) system. Site-direct Mutagenesis—ABCD-TK-derived constructs containing mutated IR1-A, -C, and -D sites were generated by PCR using complementary oligonucleotides mutated in the IR1 sites (Table 1) and PfuTurbo DNA polymerase (Stratagene). The products were digested with DpnI to remove the parental DNA template and selected for constructs containing mutations. The mutated plasmids were termed mABCD-TK, AbmCD-TK, ABCmD-TK, and AbmCmD. Cell Culture and Transfection Studies—HEK293 cells were grown in Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 10% fetal calf serum, 100 units/ml penicillin (Invitrogen), and 100 μg/ml streptomycin (Invitrogen). mhPKT cells were grown in DMEM/F-12 (Invitrogen) supplemented with 5% fetal calf serum, 50 nm dexamethasone (Sigma), 5 mg/ml insulin (Sigma), 100 units/ml penicillin (Invitrogen), and 100 μg/ml streptomycin (Invitrogen). One day before the experiment cells were changed into medium containing 5 or 10% charcoal stripped calf serum, cultivated for 24 h, and then used either for transactivation assays or RNA expression profiling. HEK293 cells were transfected by the CaCl2 precipitation method using 130 ng of plasmid DNA per well composed of 50 ng of luciferase reporter, 20 ng of β-galactosidase expression plasmid, 15 ng of FXR expression plasmid, and 45 ng of pGEM. Eight hours post-transfection cells were treated with 10–6 m GW4064 or Me2SO for 16 h. Transfection experiments were repeated 4–6 times in triplicate. Cells used for real time PCR analysis were treated for 24 h with 10–6 m GW4064 or Me2SO. Electrophoretic Mobility Shift and Chromatin Immunoprecipitation (ChIP) Assays—Mobility shift assays were preformed either with in vitro translated proteins or nuclear extracts prepared from livers using the CelLytic NuCLEAR Extraction kit (Sigma) as recently described (34Jung D. Hagenbuch B. Gresh L. Pontoglio M. Meier P.J. Kullak-Ublick G.A. J. Biol. Chem. 2001; 276: 37206-37214Abstract Full Text Full Text PDF PubMed Scopus (134) Google Scholar). Oligonucleotides used in these experiments are shown in Table 1. ChIP Assays were performed in mhPDK cells stimulated with 10–6 m GW4064 for 24 h using a commercial kit (Active Motif Europe, Rixenart, Belgium). Immunoprecipitation was done with 4 mg the antibody FXR C-20 and FXR H130 (Santa Cruz Biotechnology, Heidelberg, Germany). Activated FXR Induces Mouse PXR Expression—To investigate whether there is a cross-talk between FXR and PXR, we analyzed in a first step if PXR is affected by FXR. Wild type and FXR–/– mice were treated with the primary bile acid CA, the synthetic FXR agonist GW4064, or vehicle for 3 days. After sacrifice, mouse liver total RNA was prepared, and expression levels were analyzed by real time PCR. Because Shp is a well described FXR-activated target gene, we first studied changes in Shp gene expression to validate whether our treatment was successful. As expected, an increase in SHP mRNA was observed in wild type mice treated with CA and GW4064 (Fig. 1A). This effect reached significance only in the GW4064-treated mice, however. Induction of Shp gene expression was abolished by deletion of the Fxr gene in the FXR–/– mice; no changes in Shp expression after CA or GW4064 feeding were observed in these mice (Fig. 1A). In a next step we investigated whether PXR is affected by FXR activation or if deletion of the Fxr gene affects basal Pxr gene expression. Whereas FXR–/– mice showed a reduced amount of SHP mRNA as compared with wild type mice, PXR expression did not decrease. However, an induction of PXR mRNA expression was seen in wild type mice after CA and GW4064 treatment for 3 days. As for SHP, this effect only reached significance in the GW4064 treated wild type animals. An increase in PXR expression was not observed in FXR–/– mice, indicating that PXR might be a direct target gene of FXR (Fig. 1B). To exclude that the PXR induction is an indirect effect of long term treatment, mice were additionally treated for 14 h with CA and GW4064. This experiment demonstrated also that short term FXR activation is able to induce PXR in wild type mice, whereas no effect was observed in FXR–/– mice (Fig. 1C). The induction of PXR mRNA due to FXR activation also was observed in the ileum of wild type animals (data not shown). Long Term Exposure to Bile Acids Induces PXR and PXR Target Genes—Because genes important for the detoxification and elimination of bile acids showed only a trend to be increased after feeding CA for 14 h or 3 days (data not shown), we performed long term bile acid treatment. For this propose wild type mice were fed for 7 days with a control diet or a diet supplemented with 1% cholic acid. Again, PXR as well as the FXR target genes Shp and Bsep showed a significant increase in RNA expression (Fig. 2A). Furthermore, PXR target genes known to be involved in bile acid breakdown showed a significant increase in expression when challenged with CA. In particular, an increased expression was detected for the Cyp3a11 and Cyp2b10 as well as for Oatp1a4, Mrp2, and Mdr1α. In contrast, Mdr1β did not show any changes in gene expression (Fig. 2A). In view of the predominant role of PXR as transcriptional activator, we examined its binding to DNA. Therefore, nuclear liver extracts were prepared from mice fed a control diet with (1% CA) or without (con) bile acids and subjected to mobility shift assays for binding to the Cyp3a PXR recognition site (35Kliewer S.A. Moore J.T. Wade L. Staudinger J.L. Watson M.A. Jones S.A. McKee D.D. Oliver B.B. Willson T.M. Zetterstrom R.H. Perlmann T. Lehmann J.M. Cell. 1998; 92: 73-82Abstract Full Text Full Text PDF PubMed Scopus (1325) Google Scholar). As shown in Fig. 2B an enhanced binding was found in mice treated with 1% CA compared with untreated mice. Specificity of the complex (lower arrow) was confirmed by the addition of an RXR-specific antibody, which led to a supershift (upper arrow). Analysis of the Mouse Pxr Gene for FXR Binding Sites—Having shown that the mouse Pxr gene expression is induced by activated FXR, we investigated in a next step whether the Pxr gene contains potential FXR binding sites. Nuclear receptor DNA recognition sites contain consensus hexameric repeat motifs (AGAACA or AGGTCA) that can be organized as direct, everted, or inverted repeats, spaced by a defined number of nucleotides. FXR has been described to bind preferentially to IR1, ER7 (everted repeat 7), and DR4 (direct repeat 4) elements (36Laffitte B.A. Kast H.R. Nguyen C.M. Zavacki A.M. Moore D.D. Edwards P.A. J. Biol. Chem. 2000; 275: 10638-10647Abstract Full Text Full Text PDF PubMed Scopus (231) Google Scholar). Using a weighted matrix-based computational approach (NUBIScan) (37Podvinec M. Kaufmann M.R. Handschin C. Meyer U.A. Mol. Endocrinol. 2002; 16: 1269-1279Crossref PubMed Scopus (152) Google Scholar), we screened in a first round 10 kilobases of the 5′-flanking region including the promoter region for potential FXR bindings sites. No FXR consensus repeat motif was found within this 5′-upstream region; therefore, we continued to analyze all intronic regions of the mouse Pxr gene. As shown in Fig. 3A, a region spanning around 1250 bp that contained four highly conserved inverted hexanucleotide repeats (IR1), termed IR1-A (GGGCCAcTGGCCT), IR1-B (AGCTCAcTGTGCC), IR1-C (CGGTCAaTGACCG), and IR1-D (CGGACAcTGACCT) was identified within the second intron. This region is found at a distance of ∼40 kilobases downstream of the transcriptional start site. Effect of GW4064 on the Pxr Intronic Gene Region—To investigate whether the identified region is able to confer a bile acid response, we cloned the intronic PXR region containing the four highly conserved IR1 sites in front of a thymidine kinase promoter generating TK-ABCD, as shown in Fig. 3A. HEK235 cells cotransfected with FXR were transiently transfected with TK-ABCD and either treated with Me2SO as control or GW4064 as FXR ligand. Activation of FXR by GW4064 treatment resulted in a 7.6-fold increased luciferase activity (Fig. 3B) in TK-ABCD expression compared with Me2SO-treated cells, in contrast to the empty TK-Luc reporter construct which did not confer any response. These data indicate that indeed functional FXR binding sites are located within the proposed region. To evaluate the role of individual IR1 sites, several deletion constructs were generated by restriction digestion as shown in Fig. 2A. Deletion of the elements A and B (TK-CD) reduced activation by GW4064 by 37%, indicating that at least one of the elements (A or B) is able to respond to bile acids. Deletion of element D (TK-ABC) resulted in a massive 69% loss of activation, indicating that this element has a more prominent role than A or B. TK-C, a construct only containing element C (TK-C), also had a strongly reduced activation (65%). These data suggest that elements C and D are the functionally important bile acid response elements within the identified region. The IR1 Binding Sites A, C, and D of the Pxr Gene Confer Activation by GW4064—To assess the importance of each individual IR1 element for the bile acid-dependent activation of PXR, a triple copy of each IR1 was cloned in front of the thymidine kinase promoter of the luciferase gene vector TK-Luc. In transfected HEK235 cells all TK-Luc constructs had similar basal luciferase activities attributable to the TK promoter. Treatment with the synthetic FXR agonist GW4064 resulted in a 16.2-fold increase of TK-3A, a 76.7-fold increase of TK-3C, and a 78.3-fold increase of TK-3D luciferase activity. TK-3B, like the native TK-Luc, did not show any response. A control containing three copies of a perfect IR1 showed a 97-fold induction of luciferase activity (Fig. 4A). To further confirm the role of each individual IR1 element in mediating PXR induction by FXR activation, IR1-A, -C, and -D were cloned as a single copy in front of the thymidine kinase promoter of the vector TK-Luc. Additionally two new constructs were generated; TK-per IR1, containing a single perfect IR1 element, and TK-mutIR1, in which the IR1 site was mutated (Fig. 4B). All constructs were transfected into HEK293 cells and treated with Me2SO or GW4064. All three elements of the Pxr gene were able to confer a response after FXR activation. In particular, the single copy IR1-A showed the lowest induction, resulting in a 2.1-fold increased luciferase activity after GW4064 treatment. Similar to this, IR1-D showed a 3.3-fold increase. The highest induction (10-fold) was obtained with element IR1-C. Of note, a perfect single IR1 element (TK-perIR1) was able to produce an 18.9-fold induction of luciferase activity after FXR activation, whereas neither the mutated IR1 (TK-mutIR1) nor the native vector (TK-Luc) showed any response. These data clearly show that elements A, C, and D of the mouse Pxr gene are able to confer activation by GW4064. Mutagenesis of the IR1 Sites Result in a Loss in Induction—To assess the importance of IR1-A, -C, and -D for the bile acid-dependent activation of PXR, mutations were introduced in each individual response element as illustrated in Fig. 5A. Mutation of the IR1-A binding site (TK-mABCD) resulted in a 20% re