Publication Information

{'id': 'https://openalex.org/W2013289541', 'doi': 'https://doi.org/10.1074/jbc.273.48.31644', 'title': 'Regulation of RNA Polymerase II-dependent Transcription by Poly(ADP-ribosyl)ation of Transcription Factors', 'display_name': 'Regulation of RNA Polymerase II-dependent Transcription by Poly(ADP-ribosyl)ation of Transcription Factors', 'publication_year': 1998, 'publication_date': '1998-11-01', 'ids': {'openalex': 'https://openalex.org/W2013289541', 'doi': 'https://doi.org/10.1074/jbc.273.48.31644', 'mag': '2013289541', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/9822623'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.273.48.31644', 'pdf_url': 'http://www.jbc.org/article/S0021925819589943/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S0021925819589943/pdf', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5025657474', 'display_name': 'Shiao Li Oei', 'orcid': 'https://orcid.org/0000-0002-5772-550X'}, 'institutions': [{'id': 'https://openalex.org/I75951250', 'display_name': 'Freie Universität Berlin', 'ror': 'https://ror.org/046ak2485', 'country_code': 'DE', 'type': 'education', 'lineage': ['https://openalex.org/I75951250']}], 'countries': ['DE'], 'is_corresponding': False, 'raw_author_name': 'Shiao Li Oei', 'raw_affiliation_strings': ['Institut für Biochemie, Freie Universität Berlin-Dahlem, Thielallee 63, D-14195 Berlin, Germany'], 'affiliations': [{'raw_affiliation_string': 'Institut für Biochemie, Freie Universität Berlin-Dahlem, Thielallee 63, D-14195 Berlin, Germany', 'institution_ids': ['https://openalex.org/I75951250']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5052150269', 'display_name': 'Joachim Griesenbeck', 'orcid': 'https://orcid.org/0000-0002-7817-6095'}, 'institutions': [{'id': 'https://openalex.org/I75951250', 'display_name': 'Freie Universität Berlin', 'ror': 'https://ror.org/046ak2485', 'country_code': 'DE', 'type': 'education', 'lineage': ['https://openalex.org/I75951250']}], 'countries': ['DE'], 'is_corresponding': False, 'raw_author_name': 'Joachim Griesenbeck', 'raw_affiliation_strings': ['Institut für Biochemie, Freie Universität Berlin-Dahlem, Thielallee 63, D-14195 Berlin, Germany'], 'affiliations': [{'raw_affiliation_string': 'Institut für Biochemie, Freie Universität Berlin-Dahlem, Thielallee 63, D-14195 Berlin, Germany', 'institution_ids': ['https://openalex.org/I75951250']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5105143854', 'display_name': 'Manfred Schweiger', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I75951250', 'display_name': 'Freie Universität Berlin', 'ror': 'https://ror.org/046ak2485', 'country_code': 'DE', 'type': 'education', 'lineage': ['https://openalex.org/I75951250']}], 'countries': ['DE'], 'is_corresponding': False, 'raw_author_name': 'Manfred Schweiger', 'raw_affiliation_strings': ['Institut für Biochemie, Freie Universität Berlin-Dahlem, Thielallee 63, D-14195 Berlin, Germany'], 'affiliations': [{'raw_affiliation_string': 'Institut für Biochemie, Freie Universität Berlin-Dahlem, Thielallee 63, D-14195 Berlin, Germany', 'institution_ids': ['https://openalex.org/I75951250']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5036605757', 'display_name': 'Mathias Ziegler', 'orcid': 'https://orcid.org/0000-0001-6961-2396'}, 'institutions': [{'id': 'https://openalex.org/I75951250', 'display_name': 'Freie Universität Berlin', 'ror': 'https://ror.org/046ak2485', 'country_code': 'DE', 'type': 'education', 'lineage': ['https://openalex.org/I75951250']}], 'countries': ['DE'], 'is_corresponding': False, 'raw_author_name': 'Mathias Ziegler', 'raw_affiliation_strings': ['Institut für Biochemie, Freie Universität Berlin-Dahlem, Thielallee 63, D-14195 Berlin, Germany'], 'affiliations': [{'raw_affiliation_string': 'Institut für Biochemie, Freie Universität Berlin-Dahlem, Thielallee 63, D-14195 Berlin, Germany', 'institution_ids': ['https://openalex.org/I75951250']}]}], 'institution_assertions': [], 'countries_distinct_count': 1, 'institutions_distinct_count': 1, 'corresponding_author_ids': [], 'corresponding_institution_ids': [], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 3.337, 'has_fulltext': True, 'fulltext_origin': 'pdf', 'cited_by_count': 119, 'citation_normalized_percentile': {'value': 0.929053, 'is_in_top_1_percent': False, 'is_in_top_10_percent': True}, 'cited_by_percentile_year': {'min': 96, 'max': 97}, 'biblio': {'volume': '273', 'issue': '48', 'first_page': '31644', 'last_page': '31647'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T10123', 'display_name': 'DNA Repair Mechanisms', 'score': 0.999, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, 'topics': [{'id': 'https://openalex.org/T10123', 'display_name': 'DNA Repair Mechanisms', 'score': 0.999, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T11914', 'display_name': 'PARP inhibition in cancer therapy', 'score': 0.9988, 'subfield': {'id': 'https://openalex.org/subfields/2730', 'display_name': 'Oncology'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, {'id': 'https://openalex.org/T10604', 'display_name': 'RNA Research and Splicing', 'score': 0.9944, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/rna-polymerase-ii', 'display_name': 'RNA polymerase II', 'score': 0.7911432}, {'id': 'https://openalex.org/keywords/transcription', 'display_name': 'Transcription', 'score': 0.7177138}, {'id': 'https://openalex.org/keywords/general-transcription-factor', 'display_name': 'General transcription factor', 'score': 0.45554677}, {'id': 'https://openalex.org/keywords/rna-polymerase-i', 'display_name': 'RNA polymerase I', 'score': 0.4220919}], 'concepts': [{'id': 'https://openalex.org/C64350747', 'wikidata': 'https://www.wikidata.org/wiki/Q15334993', 'display_name': 'RNA polymerase II', 'level': 5, 'score': 0.7911432}, {'id': 'https://openalex.org/C179926584', 'wikidata': 'https://www.wikidata.org/wiki/Q207714', 'display_name': 'Transcription (linguistics)', 'level': 2, 'score': 0.7177138}, {'id': 'https://openalex.org/C172768829', 'wikidata': 'https://www.wikidata.org/wiki/Q14817959', 'display_name': 'Transcription factor II D', 'level': 5, 'score': 0.67467666}, {'id': 'https://openalex.org/C154816499', 'wikidata': 'https://www.wikidata.org/wiki/Q21120535', 'display_name': 'Transcription factor II F', 'level': 5, 'score': 0.66539884}, {'id': 'https://openalex.org/C196117886', 'wikidata': 'https://www.wikidata.org/wiki/Q21110340', 'display_name': 'RNA polymerase II holoenzyme', 'level': 5, 'score': 0.66181356}, {'id': 'https://openalex.org/C82381507', 'wikidata': 'https://www.wikidata.org/wiki/Q416878', 'display_name': 'Polymerase', 'level': 3, 'score': 0.53820586}, {'id': 'https://openalex.org/C156951783', 'wikidata': 'https://www.wikidata.org/wiki/Q21110793', 'display_name': 'Transcription factor II E', 'level': 5, 'score': 0.52725494}, {'id': 'https://openalex.org/C2776449523', 'wikidata': 'https://www.wikidata.org/wiki/Q272631', 'display_name': 'RNA polymerase', 'level': 4, 'score': 0.49566472}, {'id': 'https://openalex.org/C144825837', 'wikidata': 'https://www.wikidata.org/wiki/Q2316030', 'display_name': 'General transcription factor', 'level': 5, 'score': 0.45554677}, {'id': 'https://openalex.org/C25281209', 'wikidata': 'https://www.wikidata.org/wiki/Q3502188', 'display_name': 'RNA polymerase I', 'level': 5, 'score': 0.4220919}, {'id': 'https://openalex.org/C95444343', 'wikidata': 'https://www.wikidata.org/wiki/Q7141', 'display_name': 'Cell biology', 'level': 1, 'score': 0.41390926}, {'id': 'https://openalex.org/C185592680', 'wikidata': 'https://www.wikidata.org/wiki/Q2329', 'display_name': 'Chemistry', 'level': 0, 'score': 0.39125875}, {'id': 'https://openalex.org/C153911025', 'wikidata': 'https://www.wikidata.org/wiki/Q7202', 'display_name': 'Molecular biology', 'level': 1, 'score': 0.37493932}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.33502147}, {'id': 'https://openalex.org/C67705224', 'wikidata': 'https://www.wikidata.org/wiki/Q11053', 'display_name': 'RNA', 'level': 3, 'score': 0.31519085}, {'id': 'https://openalex.org/C41258723', 'wikidata': 'https://www.wikidata.org/wiki/Q2919111', 'display_name': 'RNA-dependent RNA polymerase', 'level': 4, 'score': 0.31447166}, {'id': 'https://openalex.org/C54355233', 'wikidata': 'https://www.wikidata.org/wiki/Q7162', 'display_name': 'Genetics', 'level': 1, 'score': 0.24355441}, {'id': 'https://openalex.org/C101762097', 'wikidata': 'https://www.wikidata.org/wiki/Q224093', 'display_name': 'Promoter', 'level': 4, 'score': 0.22514483}, {'id': 'https://openalex.org/C150194340', 'wikidata': 'https://www.wikidata.org/wiki/Q26972', 'display_name': 'Gene expression', 'level': 3, 'score': 0.20090929}, {'id': 'https://openalex.org/C104317684', 'wikidata': 'https://www.wikidata.org/wiki/Q7187', 'display_name': 'Gene', 'level': 2, 'score': 0.16077554}, {'id': 'https://openalex.org/C41895202', 'wikidata': 'https://www.wikidata.org/wiki/Q8162', 'display_name': 'Linguistics', 'level': 1, 'score': 0.0}, {'id': 'https://openalex.org/C138885662', 'wikidata': 'https://www.wikidata.org/wiki/Q5891', 'display_name': 'Philosophy', 'level': 0, 'score': 0.0}], 'mesh': [{'descriptor_ui': 'D036002', 'descriptor_name': 'ADP Ribose Transferases', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D011065', 'descriptor_name': 'Poly(ADP-ribose) Polymerases', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': True}, {'descriptor_ui': 'D012319', 'descriptor_name': 'RNA Polymerase II', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D014157', 'descriptor_name': 'Transcription Factors', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D014158', 'descriptor_name': 'Transcription, Genetic', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': True}, {'descriptor_ui': 'D036002', 'descriptor_name': 'ADP Ribose Transferases', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D000246', 'descriptor_name': 'Adenosine Diphosphate Ribose', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D000246', 'descriptor_name': 'Adenosine Diphosphate Ribose', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D003001', 'descriptor_name': 'Cloning, Molecular', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D004260', 'descriptor_name': 'DNA Repair', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D004268', 'descriptor_name': 'DNA-Binding Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D004268', 'descriptor_name': 'DNA-Binding Proteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D050981', 'descriptor_name': 'Erythroid-Specific DNA-Binding Factors', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D006801', 'descriptor_name': 'Humans', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D012319', 'descriptor_name': 'RNA Polymerase II', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011994', 'descriptor_name': 'Recombinant Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011994', 'descriptor_name': 'Recombinant Proteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D016385', 'descriptor_name': 'TATA Box', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D035181', 'descriptor_name': 'TATA-Box Binding Protein', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D014157', 'descriptor_name': 'Transcription Factors', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D016159', 'descriptor_name': 'Tumor Suppressor Protein p53', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D016159', 'descriptor_name': 'Tumor Suppressor Protein p53', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D050986', 'descriptor_name': 'YY1 Transcription Factor', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}], 'locations_count': 2, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.273.48.31644', 'pdf_url': 'http://www.jbc.org/article/S0021925819589943/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/9822623', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.273.48.31644', 'pdf_url': 'http://www.jbc.org/article/S0021925819589943/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 30, 'referenced_works': ['https://openalex.org/W114154610', 'https://openalex.org/W115179221', 'https://openalex.org/W1514077182', 'https://openalex.org/W1670619327', 'https://openalex.org/W1824125043', 'https://openalex.org/W1969177701', 'https://openalex.org/W1970184435', 'https://openalex.org/W1977694232', 'https://openalex.org/W1980483123', 'https://openalex.org/W1980725360', 'https://openalex.org/W1983795887', 'https://openalex.org/W1990846117', 'https://openalex.org/W1993243592', 'https://openalex.org/W2014300705', 'https://openalex.org/W2032205501', 'https://openalex.org/W2035657750', 'https://openalex.org/W2040891334', 'https://openalex.org/W2041639550', 'https://openalex.org/W2060407931', 'https://openalex.org/W2070940247', 'https://openalex.org/W2073373002', 'https://openalex.org/W2075174658', 'https://openalex.org/W2077559325', 'https://openalex.org/W2079284704', 'https://openalex.org/W2081135713', 'https://openalex.org/W2092451011', 'https://openalex.org/W2099140001', 'https://openalex.org/W2136280919', 'https://openalex.org/W2165432409', 'https://openalex.org/W2325814368'], 'related_works': ['https://openalex.org/W4391431841', 'https://openalex.org/W4388253090', 'https://openalex.org/W2409667009', 'https://openalex.org/W2047588687', 'https://openalex.org/W2005097302', 'https://openalex.org/W2004796688', 'https://openalex.org/W1977439656', 'https://openalex.org/W1564650554', 'https://openalex.org/W1547956301', 'https://openalex.org/W1493079944'], 'abstract_inverted_index': {'Poly(ADP-ribosyl)': [0, 203], 'transferase': [1, 204, 407], '(ADPRT)': [2, 205], 'is': [3, 65, 85, 123, 182, 206, 268, 288, 326, 385, 426, 556, 567, 1959, 2467, 2619, 2655, 2673, 3223, 3337, 3361, 3457, 3848, 3863, 3904], 'a': [4, 46, 188, 207, 249, 391, 429, 559, 623, 663, 1007, 1030, 1352, 1411, 1493, 1525, 1584, 1608, 1671, 1719, 1870, 1963, 2005, 2192, 2326, 2339, 2346, 2460, 2518, 2623, 2766, 2855, 3103, 3196, 3212, 3362, 3548, 3662, 3905, 3973, 4005], 'nuclear': [5, 208, 627, 1317, 1355, 1423, 1786, 2143, 2285, 3645, 3667], 'protein': [6, 89, 209, 292, 415, 771, 1965, 2551, 2911, 2950, 3350, 4014], 'that': [7, 68, 184, 210, 271, 387, 553, 770, 1053, 1115, 2076, 2231, 2657, 2678, 2718, 3199, 3355, 3378, 3441, 3460, 3590, 3752, 3768, 3791, 3852, 3900, 3919], 'modifies': [8, 211], 'proteins': [9, 212, 613, 628, 1364, 1757, 2429, 2877, 3668], 'by': [10, 213, 569, 847, 964, 1088, 1185, 1644, 1665, 1698, 1737, 1747, 1762, 1853, 2085, 2093, 2120, 2190, 2226, 2238, 2275, 2418, 2626, 3011, 3072, 3159, 3452, 3650, 3654, 3773, 3787, 4012], 'forming': [11, 214], 'and': [12, 29, 40, 94, 116, 177, 193, 215, 232, 243, 297, 319, 380, 396, 659, 842, 852, 873, 905, 1084, 1123, 1127, 1237, 1295, 1313, 1404, 1545, 1580, 1600, 1636, 1650, 1689, 1754, 1793, 1846, 1866, 1968, 2032, 2060, 2313, 2549, 2586, 2694, 2792, 3027, 3059, 3069, 3114, 3146, 3156, 3209, 3220, 3229, 3267, 3275, 3278, 3325, 3358, 3419, 3534, 3536, 3661, 3700, 3705, 3722, 3730, 4029, 4041, 4043], 'attaching': [13, 216], 'to': [14, 92, 145, 151, 160, 164, 172, 197, 217, 295, 348, 354, 363, 367, 375, 400, 510, 652, 661, 734, 844, 896, 909, 1029, 1063, 1104, 1132, 1441, 1536, 1604, 1669, 1731, 1897, 1922, 1924, 1961, 1969, 1972, 2292, 2294, 2299, 2320, 2381, 2430, 2442, 2463, 2472, 2576, 2616, 2675, 2784, 2816, 2836, 2845, 2870, 2958, 2996, 3080, 3167, 3232, 3296, 3346, 3399, 3402, 3448, 3496, 3498, 3506, 3522, 3571, 3613, 3616, 3716, 3739, 3837, 3850, 3955, 3967], 'them': [15, 218], 'poly(ADP-ribose)': [16, 219, 774, 900, 2088, 2555, 2800, 2973, 3353], 'chains.': [17, 220, 901], 'Poly(ADP-ribosyl)ation': [18, 221], 'represents': [19, 222, 4004], 'an': [20, 223, 736, 776, 1070, 1434, 2215, 2711, 2737, 3573], 'event': [21, 224], 'of': [22, 34, 49, 52, 59, 71, 75, 98, 105, 128, 132, 139, 157, 195, 200, 225, 237, 252, 255, 262, 274, 278, 301, 308, 331, 335, 342, 360, 398, 403, 432, 494, 502, 505, 516, 523, 528, 558, 614, 626, 657, 673, 726, 738, 779, 830, 839, 899, 962, 1017, 1033, 1042, 1046, 1069, 1078, 1095, 1245, 1360, 1407, 1414, 1433, 1492, 1539, 1543, 1548, 1587, 1596, 1647, 1674, 1712, 1722, 1740, 1756, 1790, 1796, 1874, 1882, 1893, 1901, 1906, 1910, 1919, 1940, 1947, 1966, 2038, 2047, 2058, 2064, 2079, 2100, 2103, 2116, 2171, 2180, 2195, 2214, 2217, 2222, 2245, 2258, 2268, 2271, 2279, 2302, 2352, 2364, 2385, 2394, 2412, 2421, 2427, 2445, 2468, 2476, 2482, 2521, 2552, 2602, 2605, 2614, 2661, 2667, 2680, 2689, 2704, 2713, 2724, 2743, 2749, 2756, 2760, 2769, 2779, 2789, 2795, 2797, 2806, 2821, 2834, 2848, 2857, 2878, 2972, 2980, 3008, 3017, 3024, 3030, 3089, 3095, 3098, 3111, 3117, 3176, 3182, 3185, 3200, 3224, 3237, 3255, 3288, 3313, 3327, 3349, 3372, 3384, 3405, 3412, 3466, 3487, 3492, 3510, 3527, 3538, 3575, 3619, 3629, 3634, 3657, 3666, 3691, 3734, 3771, 3780, 3797, 3826, 3832, 3855, 3873, 3902, 3911, 3925, 3960, 3970, 3980, 3986, 3990, 4001, 4008, 4038], 'major': [23, 226, 430], 'importance': [24, 227, 3991], 'in': [25, 31, 228, 234, 423, 435, 630, 654, 1006, 1136, 1177, 1351, 1379, 1410, 1429, 1448, 1524, 1565, 1583, 1623, 1709, 1718, 1728, 1828, 1869, 1930, 1974, 2055, 2134, 2168, 2234, 2242, 2282, 2376, 2599, 2620, 2734, 2765, 2854, 2994, 3086, 3102, 3173, 3202, 3264, 3282, 3424, 3643, 3688, 3759, 3834, 3840, 3859, 3908, 3983], 'perturbed': [26, 229], 'cell': [27, 230], 'nuclei': [28, 231], 'participates': [30, 233], 'the': [32, 76, 235, 279, 499, 519, 529, 617, 655, 667, 670, 680, 724, 763, 825, 836, 1011, 1015, 1036, 1039, 1043, 1054, 1067, 1107, 1140, 1215, 1246, 1425, 1449, 1483, 1517, 1537, 1591, 1614, 1645, 1710, 1729, 1732, 1738, 1797, 1849, 1891, 1894, 1908, 1938, 1945, 2056, 2077, 2086, 2114, 2117, 2169, 2229, 2235, 2239, 2243, 2276, 2283, 2300, 2350, 2377, 2419, 2428, 2443, 2473, 2577, 2600, 2658, 2681, 2687, 2701, 2721, 2725, 2740, 2747, 2754, 2770, 2786, 2790, 2793, 2819, 2832, 2858, 2945, 2970, 2981, 3036, 3041, 3081, 3087, 3123, 3128, 3168, 3174, 3203, 3256, 3291, 3305, 3334, 3340, 3394, 3403, 3439, 3461, 3490, 3499, 3503, 3565, 3586, 3617, 3632, 3635, 3689, 3706, 3760, 3769, 3798, 3830, 3871, 3898, 3916, 3942, 3968, 3984], 'regulation': [33, 236, 656, 3985], 'fundamental': [35, 238], 'processes': [36, 239], 'including': [37, 109, 240, 312], 'DNA': [38, 93, 103, 137, 165, 174, 179, 196, 241, 296, 306, 340, 368, 377, 382, 399, 424, 495, 563, 1076, 1105, 1302, 1440, 1656, 2045, 2062, 2080, 2164, 2181, 2256, 2269, 2304, 2392, 2414, 2487, 2594, 2665, 2693, 2702, 2817, 2954, 3032, 3119, 3316, 3323, 3382, 3400, 3540, 3614, 3781, 3958, 3995], 'repair': [39, 194, 242, 397, 425, 564], 'transcription.': [41, 63, 244, 266, 3912, 3932], 'Although': [42, 245], 'ADPRT': [43, 185, 246, 388, 433, 524, 570, 647, 682, 730, 831, 913, 1018, 1118, 1143, 1620, 1703, 1902, 1967, 1973, 2040, 2059, 2241, 2280, 2321, 2382, 2464, 2483, 2522, 2662, 2714, 2835, 2987, 3009, 3085, 3172, 3297, 3659, 3704, 3774, 3971], 'serves': [44, 186, 247, 389], 'as': [45, 187, 248, 390, 428, 620, 622, 679, 1146, 1183, 1322, 1437, 1487, 2335, 2337, 2489, 3422, 3857, 3972], 'positive': [47, 250], 'cofactor': [48, 251], 'transcription,': [50, 253, 1907], 'initiation': [51, 131, 254, 334, 2679, 3236, 3618], 'its': [53, 170, 256, 373, 727, 2295, 3449, 3539], 'catalytic': [54, 257, 837, 2659, 2741], 'activity': [55, 258, 501, 522, 571, 838, 2278, 2322, 2484, 2660, 2742, 2988, 3010, 3016, 3298], 'may': [56, 259, 525, 1022, 1119, 1903, 3443, 3988], 'cause': [57, 260, 526, 1904, 2686], 'repression': [58, 261, 1905, 2078, 2179, 2411], 'RNA': [60, 263], 'polymerase': [61, 264, 783], 'II-dependent': [62, 265, 784, 3512], 'It': [64, 267, 550, 1050, 3456, 3582, 3913], 'demonstrated': [66, 269, 733], 'here': [67, 270, 3589], 'ADPRT-dependent': [69, 272, 1044, 2474, 3464, 3508, 3853, 3909], 'silencing': [70, 273, 781, 961, 1045, 2475, 3465, 3509, 3648, 3854, 3910], 'transcription': [72, 100, 107, 129, 140, 147, 158, 192, 275, 303, 310, 332, 343, 350, 361, 395, 419, 658, 674, 740, 785, 833, 854, 963, 1047, 1059, 1072, 1080, 1096, 1125, 1707, 1765, 1829, 1913, 1920, 2477, 2669, 2695, 2706, 2732, 2757, 2813, 2838, 2983, 3012, 3037, 3091, 3124, 3178, 3218, 3238, 3328, 3342, 3395, 3467, 3513, 3566, 3639, 3856, 3927, 3936, 3943, 3961, 3987, 4002], 'involves': [73, 276], 'ADP-ribosylation': [74, 277, 1094, 2805, 3411], 'TATA-binding': [77, 88, 280, 291, 414], 'protein.': [78, 281], 'This': [79, 282, 2178, 2611, 2826, 3222, 3783], 'modification': [80, 283, 772, 1090, 1108, 1755, 2553, 3351, 3371, 3453, 3486, 3526, 3593, 3656, 3733, 3772], 'occurs': [81, 284], 'only': [82, 285, 1010, 3331, 3356, 3375, 3703, 3744, 3793], 'if': [83, 143, 286, 346, 1100, 2288, 2436, 2811, 3333], 'poly(ADP-ribosyl)ation': [84, 133, 154, 287, 336, 357, 615, 965, 1055, 1911, 2353, 2682, 2750, 2771, 2946, 2959, 3001, 3306, 3335, 3366, 3620, 3636, 3651, 3753, 3799, 3901, 3922, 3951, 4000], 'initiated': [86, 289], 'before': [87, 290, 1106, 2818, 3339], 'has': [90, 293, 648, 731, 2401, 2492], 'bound': [91, 144, 294, 347, 1103, 2815, 3345, 3398, 3612], 'thereby': [95, 298, 1128], 'prevents': [96, 155, 166, 299, 358, 369, 2663, 3923, 3952, 3963], 'formation': [97, 300, 1068, 3287, 3326, 3421, 3924], 'active': [99, 302, 671, 1071, 1943], 'complexes.': [101, 304], 'Specific': [102, 305, 2162], 'binding': [104, 138, 156, 163, 307, 341, 359, 366, 1062, 1077, 1131, 1353, 1426, 1445, 1484, 1518, 1592, 1624, 2046, 2063, 2081, 2165, 2182, 2257, 2270, 2305, 2393, 2415, 2426, 2488, 2595, 2666, 2703, 2955, 3324, 3383, 3447, 3541, 3758, 3954, 3959], 'other': [106, 309, 764, 1124, 2874, 3090, 3177, 3692], 'factors': [108, 148, 159, 311, 351, 362, 857, 903, 1060, 1081, 1097, 1126, 1708, 1914, 1921, 2707, 2717, 2733, 3038, 3092, 3125, 3179, 3219, 3343, 3396, 3944, 3962, 4003], 'Yin': [110, 313, 416], 'Yang': [111, 314, 417], '1,': [112, 315, 2309, 2582], 'p53,': [113, 316, 3058, 3145], 'NFκB,': [114, 317], 'Sp1,': [115, 318, 2591], 'CREB': [117, 320, 2347], 'but': [118, 321, 2356], 'not': [119, 135, 322, 338, 2042, 2112, 2251, 2390, 2685, 2809, 3309, 3359, 3580, 3755], 'c-Jun': [120, 323, 2951], 'or': [121, 324, 827, 1362, 1942, 2371, 2396, 2590, 2752, 2850, 2909, 3695, 3711], 'AP-2': [122, 325, 2372], 'similarly': [124, 327], 'affected.': [125, 328], 'After': [126, 329, 1134, 1612, 1676, 1749], 'assembly': [127, 330], 'complexes': [130, 333, 1521, 2691, 3312, 3329, 3928, 3938], 'does': [134, 337, 2684], 'influence': [136, 339, 829, 1016, 2113, 2254, 2391, 3310], 'factors.': [141, 344, 855, 2670, 2696, 2758, 3640], 'Accordingly,': [142, 345], 'DNA,': [146, 161, 349, 364, 1064, 3956], 'are': [149, 352, 1880, 3252, 3262, 3330, 3945], 'inaccessible': [150, 353, 3946], 'poly(ADP-ribosyl)ation.': [152, 355, 3965], 'Thus,': [153, 356, 2653, 3322], 'whereas': [162, 365, 2054, 3577, 3957], 'their': [167, 370, 1130, 1925, 2431, 3953, 3964], 'modification.': [168, 371, 4015], 'Considering': [169, 372], 'ability': [171, 374, 1918, 2833], 'detect': [173, 376], 'strand': [175, 378, 496], 'breaks': [176, 379, 497], 'stimulate': [178, 381], 'repair,': [180, 383], 'it': [181, 384, 766, 1889, 2437, 2654, 2672, 3609, 3847], 'proposed': [183, 386], 'molecular': [189, 392, 1040], 'switch': [190, 393], 'between': [191, 394, 2692, 3216], 'avoid': [198, 401], 'expression': [199, 402, 1021, 4011], 'damaged': [201, 404], 'genes.': [202, 405, 1034], 'poly(ADP-ribosyl)': [406], 'electromobility': [408], 'shift': [409], 'assay': [410], 'polyacrylamide': [411, 1527, 1610], 'gel': [412], 'electrophoresis': [413, 1613, 1750], '1': [418, 1391, 2050, 2070, 2123, 2132, 2174, 2186, 2246, 2261, 2331, 2367, 2407, 2448, 2962, 3022, 3109, 3208, 3763], 'factor': [420, 675, 2814, 2984, 3014, 3495, 3567, 3975], 'IIB.': [421], 'Participation': [422], 'regarded': [427], 'function': [431], '(reviewed': [434, 629], 'Ref.1de': [436], 'Murcia': [437, 440, 592, 599, 2893, 2896], 'G.': [438, 600, 744, 789, 878, 969, 1158, 1300, 2503, 2559, 2897, 3806, 4044], 'Ménissier-de': [439, 591, 2892], 'J.': [441, 481, 593, 602, 635, 686, 691, 711, 810, 864, 876, 917, 939, 990, 1150, 1298, 1301, 1328, 1454, 1770, 1979, 2203, 2501, 2540, 2557, 2638, 2919, 2928, 3471, 3556, 3599, 3672, 3804, 3878], 'Trends': [442, 464], 'Biochem.': [443, 465, 486, 640, 863, 881, 926, 1337, 1463, 1988, 2202, 2506, 2562, 3555, 3598], 'Sci.': [444, 466, 750, 795, 975, 1504, 1808], '1994;': [445], '19:': [446], '172-176Abstract': [447], 'Full': [448, 470, 697, 717, 1286, 2644, 2646, 2934, 2936], 'Text': [449, 471, 698, 718, 1287, 2645, 2647, 2935, 2937], 'PDF': [450, 472, 699, 719, 1288, 2648, 2938], 'PubMed': [451, 473, 545, 580, 606, 700, 720, 757, 802, 819, 868, 888, 933, 955, 982, 999, 1165, 1199, 1230, 1267, 1289, 1307, 1344, 1470, 1511, 1779, 1815, 1995, 2027, 2157, 2207, 2513, 2544, 2569, 2904, 2939, 3247, 3480, 3560, 3603, 3681, 3820, 3887], 'Scopus': [452, 474, 546, 581, 607, 758, 803, 820, 869, 889, 934, 956, 983, 1000, 1166, 1200, 1231, 1268, 1290, 1308, 1345, 1471, 1512, 1780, 1816, 1996, 2028, 2158, 2208, 2514, 2545, 2570, 2649, 2905, 2940, 3248, 3481, 3561, 3604, 3682, 3821, 3888], '(763)': [453], 'Google': [454, 476, 491, 548, 583, 609, 645, 701, 721, 760, 805, 822, 871, 891, 936, 958, 985, 1002, 1168, 1202, 1233, 1270, 1292, 1310, 1347, 1473, 1514, 1782, 1818, 1998, 2030, 2160, 2210, 2516, 2547, 2572, 2651, 2907, 2942, 3250, 3483, 3563, 3606, 3684, 3823, 3890], 'Scholar,': [455, 477, 584, 702, 806, 937, 986], '2Lindahl': [456], 'T.': [457, 575, 684, 949, 1194, 2914, 3812, 4019, 4021], 'Satoh': [458], 'M.S.': [459, 573], 'Poirier': [460, 2535], 'G.G.': [461, 2536], 'Klungland': [462], 'A.': [463, 590, 753, 798, 923, 978, 1334, 1460, 1507, 1811, 1985], '1995;': [467, 1264, 2024, 3244], '20:': [468], '405-411Abstract': [469], '(576)': [475], '3Oei': [478, 632], 'S.L.': [479, 633, 808, 915, 988, 1152, 1326, 1452, 1768, 1977, 3469, 3670, 3802, 3876], 'Griesenbeck': [480, 634, 809, 916, 989, 1327, 1453, 1769, 1978, 3470, 3671, 3803, 3877], 'Schweiger': [482, 636, 813, 918, 993, 1159, 1329, 1455, 1773, 1980, 3474, 3675, 3881], 'M.': [483, 586, 637, 708, 742, 787, 812, 814, 919, 967, 992, 994, 1156, 1160, 1258, 1330, 1456, 1498, 1772, 1774, 1802, 1981, 2018, 2631, 2885, 3473, 3475, 3674, 3676, 3814, 3880, 3882, 4025], 'Rev.': [484, 638], 'Physiol.': [485, 639], 'Pharmacol.': [487, 641], '1997;': [488, 642, 754, 799, 865, 930, 979, 1162, 1341, 1467, 1992, 2541, 3557, 3600], '131:': [489, 643], '127-174PubMed': [490, 644], 'Scholar).1': [492], 'Occurrence': [493], 'induces': [498], 'enzymatic': [500, 2277], 'ADPRT,': [503, 2744, 2879, 3021, 3108], 'transfer': [504], 'ADP-ribose': [506, 1694, 1759, 2097, 2105, 2218, 2223, 2387, 2607, 3096, 3183], 'moieties': [507], 'from': [508, 1061, 1209, 1241, 2108, 3446, 3585, 3994], 'NAD+': [509, 531, 1649, 1714, 2061, 2172, 2446, 2822, 3874], 'proteins.': [511, 2035], 'Therefore,': [512, 2265], 'after': [513, 565, 3745], 'genotoxic': [514, 3977], 'treatment': [515], 'mammalian': [517], 'cells,': [518], 'greatly': [520, 3379], 'enhanced': [521, 3004], 'depletion': [527], 'intracellular': [530], 'pool': [532], '(4Durkacz': [533], 'B.W.': [534], 'Omidiji': [535], 'O.': [536, 1219], 'Gray': [537], 'D.A.': [538], 'Shall': [539], 'S.': [540, 752, 797, 941, 977, 1506, 1810, 2538, 2891, 3240, 3242], 'Nature.': [541, 576, 1195, 3243], '1980;': [542, 694, 2204], '283:': [543], '593-596Crossref': [544], '(922)': [547], 'Scholar).': [549, 610, 646, 722, 761, 823, 959, 1169, 1203, 1234, 1348, 1474, 1515, 1819, 1999, 2161, 2211, 2573, 2652, 3685, 3824, 3891], 'was': [551, 677, 767, 775, 1004, 1048, 1051, 1086, 1098, 1110, 1144, 1181, 1207, 1533, 1598, 1621, 1696, 1704, 1760, 1851, 1890, 1915, 1928, 2066, 2082, 2090, 2166, 2183, 2232, 2273, 2290, 2323, 2354, 2379, 2416, 2434, 2596, 2708, 2782, 2808, 2956, 2989, 2999, 3002, 3078, 3165, 3294, 3408, 3569, 3579, 3652, 3742, 3785], 'concluded': [552, 2656], 'this': [554, 840, 2812, 3493, 3845, 3893, 3981], 'effect': [555, 1909, 2351, 2738, 2968, 2979], 'part': [557], 'defense': [560], 'mechanism,': [561], 'because': [562, 2873, 3227, 3608], 'γ-irradiation': [566], 'stimulated': [568, 2787], '(5Satoh': [572], 'Lindahl': [574], '1992;': [577], '356:': [578], '356-358Crossref': [579], '(975)': [582], '6Molinete': [585], 'Vermeulen': [587], 'W.': [588, 1252, 1277, 2012, 4024], 'Bürkle': [589], 'Küpper': [594], 'H.': [595, 2524], 'Hoeijmakers': [596], 'J.H.': [597], 'de': [598, 2895], 'EMBO': [601, 2539], '1993;': [603, 1227], '12:': [604], '2109-2117Crossref': [605], '(226)': [608], 'The': [611, 1074, 1112, 1917, 1950, 2036, 2074, 2212, 2480, 2697, 2776, 2948, 2977, 3260, 3750], 'target': [612, 2550, 3364], 'include': [616], 'enzyme': [618, 681, 841, 2791, 3982], 'itself': [619, 3660], 'well': [621, 2336], 'limited': [624, 3664], 'number': [625, 1032, 3665], 'Ref.': [631], 'also': [649, 2459, 2493, 2597, 2840, 2852, 3914], 'been': [650, 732, 894, 2402, 2494, 3940], 'shown': [651, 3281, 3570, 3858], 'participate': [653], 'appears': [660, 843], 'exert': [662, 2252, 2736], 'dual': [664], 'function.': [665], 'On': [666, 762], 'one': [668], 'hand,': [669, 765], 'component': [672], 'IIC': [676], 'identified': [678], '(7Matsui': [683], 'Segall': [685], 'Weil': [687], 'P.A.': [688], 'Roeder': [689, 709, 745, 790, 970, 1499, 1803, 2149], 'R.G.': [690, 710, 746, 791, 971, 1500, 1804, 2150], 'Biol.': [692, 712, 1226, 2639, 2900, 2929], 'Chem.': [693, 713, 2640, 2930], '255:': [695], '11992-11996Abstract': [696], '8Slattery': [703], 'E.': [704, 1178, 1190, 1210, 2917], 'Dignam': [705], 'J.D.': [706, 2146], 'Matsui': [707], '1983;': [714, 2154], '258:': [715], '5955-5959Abstract': [716], 'In': [723, 1035, 1349, 2361, 3547, 3686, 3844, 3949, 3997], 'absence': [725, 1939, 3088, 3175], 'substrate,': [728], 'NAD+,': [729, 2303, 3026, 3113, 3406], 'be': [735, 845, 897, 1023, 1962, 1970, 2871, 3444, 3523, 3572, 3717, 3776, 3989], 'enhancer': [737], 'activator-dependent': [739], '(9Meisterernst': [741, 786, 966], 'Stelzer': [743, 788, 968], 'Proc.': [747, 792, 972, 1501, 1805], 'Natl.': [748, 793, 973, 1502, 1806], 'Acad.': [749, 794, 974, 1503, 1807], 'U.': [751, 796, 976, 1505, 1809], '94:': [755, 800, 980], '2261-2265Crossref': [756, 801, 981], '(145)': [759, 804, 984], 'reported': [768, 895], 'recently': [769], 'with': [773, 850, 912, 1091, 1214, 1315, 1367, 1422, 1480, 1530, 1552, 1685, 1690, 1706, 1934, 1956, 2004, 2136, 2325, 2338, 2404, 2456, 2470, 2485, 2496, 2554, 2579, 2622, 2715, 2751, 2799, 3035, 3122, 3193, 3290, 3315, 3352, 3454], 'efficient': [777], 'means': [778, 4007], 'reversibly': [780], 'general': [782, 1025, 1122], '10Oei': [807, 987], 'Ziegler': [811, 991, 1155, 1771, 3472, 3673, 3813, 3879], 'Biochemistry.': [815, 995, 1161, 1775, 3476, 3677, 3883], '1998;': [816, 952, 996, 1776, 2641, 2901, 2931, 3477, 3678, 3884], '37:': [817, 997, 1777, 3478, 3679, 3885], '1465-1469Crossref': [818, 998, 1778, 3479, 3680, 3886], '(57)': [821, 1001, 1781, 3482, 3683, 3889], 'Consequently,': [824], 'activating': [826], 'repressing': [828], 'on': [832, 835, 1019, 1607, 1912, 2255, 2720, 2739, 2969, 2986], 'depends': [834], 'mediated': [846, 2083, 2274], 'direct': [848], 'interactions': [849], 'basal': [851, 1012, 2982, 3257, 3341], 'gene-specific': [853], 'Transcription': [856, 902], 'TFIIF': [858, 3568], '(11Rawling': [859, 3551, 3594], 'J.M.': [860, 2633, 3552, 3595], 'Alvarez-Gonzalez': [861, 3553, 3596], 'R.': [862, 1281, 3554, 3597], '324:': [866, 3558, 3601], '249-253Crossref': [867, 3559, 3602], '(58)': [870, 3562, 3605], 'Scholar)': [872, 892, 1003, 1783, 2031, 2548, 2908, 3484, 3564], 'p53': [874, 1206, 2499, 2593, 2615, 2851, 4042], '(12Wesierska-Gadek': [875, 2500, 2556], 'Schmid': [877, 2502, 2558], 'Cerni': [879, 2504, 2560], 'C.': [880, 2505, 2561, 2887, 4022], 'Biophys.': [882, 927, 1338, 1464, 1989, 2507, 2563], 'Res.': [883, 928, 1263, 1339, 1465, 1990, 2023, 2153, 2508, 2564], 'Commun.': [884, 929, 1340, 1466, 1991, 2509, 2565], '1996;': [885, 2510, 2566, 3817], '224:': [886, 2511, 2567], '96-102Crossref': [887, 2512, 2568], '(81)': [890, 2515, 2571], 'have': [893, 3344, 3939], 'acceptors': [898], 'YY1': [904, 1173, 2006, 2048, 2065, 2121, 2137, 2163, 2259, 2272, 2289, 2405, 2580, 2763, 2798, 2807, 3201, 3710, 3723, 4040], 'Oct-1': [906], 'were': [907, 1239, 1320, 1365, 1419, 1477, 1522, 1550, 1602, 1616, 1642, 1663, 1681, 1735, 1745, 1752, 1952, 2001, 2129, 3033, 3064, 3120, 3151, 3270, 3714, 3724], 'found': [908, 1052, 3521], 'tightly': [910, 3233], 'associate': [911, 3234], '(13Oei': [914, 1325, 1451, 1976], 'Babich': [920, 1331, 1457, 1982], 'V.': [921, 1223, 1332, 1458, 1983, 2889, 4030], 'Kropotov': [922, 1333, 1459, 1984], 'Tomilin': [924, 1335, 1461, 1986], 'N.': [925, 1221, 1336, 1462, 1987], '240:': [931, 1342, 1468, 1993], '108-111Crossref': [932, 1343, 1469, 1994], '(92)': [935, 1346, 1472, 1997], '14Nie': [938], 'Sakamoto': [940], 'Song': [942], 'D.': [943, 1254, 2014, 3808], 'Qu': [944], 'Z.': [945], 'Ota': [946], 'K.': [947], 'Taniguchi': [948], 'FEBS': [950, 3815], 'Lett.': [951, 3816], '424:': [953], '27-32Crossref': [954], '(84)': [957], 'Because': [960, 1888], 'observed': [1005, 2324, 2403, 2495, 2777], 'system': [1008], 'requiring': [1009], 'transcriptional': [1013, 3258, 3647], 'complex,': [1014], 'gene': [1020, 4010], 'more': [1024], 'rather': [1026, 2990, 3663], 'than': [1027, 3867], 'restricted': [1028], 'small': [1031, 2603], 'present': [1037, 1447, 1895, 2281], 'study': [1038, 1896, 3894], 'mechanism': [1041, 3462], 'investigated.': [1049], 'reaction': [1056, 1109, 1354, 1427, 1485, 1519, 1593, 1850, 1872, 2683, 2772, 2860, 3307, 3336, 3800], 'prevented': [1057, 1087, 2184, 2417, 3332, 3445], 'specific': [1058, 1075, 2044, 2118, 2296, 2486, 2592, 2664, 2953, 3213, 3363, 3381, 3707], 'thus': [1065], 'excluding': [1066], 'complex.': [1073], 'some': [1079, 2668, 2705, 3638], '(YY1,': [1082], 'TBP,': [1083, 2997, 3049, 3052, 3136, 3139, 3712], 'p53)': [1085], 'covalent': [1089, 4013], 'poly(ADP-ribose).': [1092, 3455], 'No': [1093], 'detected': [1099, 1761, 3715], 'they': [1101], 'had': [1102, 2438, 2966, 3397, 3610], 'initiated.': [1111], 'results': [1113, 2128, 3261], 'suggest': [1114], 'when': [1116, 3393, 3920], 'activated,': [1117], 'modify': [1120], 'certain': [1121], 'prevent': [1129], 'DNA.': [1133, 3347], 'overexpression': [1135, 4037], 'Escherichia': [1137], 'coli': [1138, 1179, 1211], 'cells': [1139, 1180, 1212], 'human': [1141, 1171, 1205], 'His-tagged': [1142, 1172], 'purified': [1145, 1182, 1619, 2033, 2497, 2761], 'described': [1147, 1184, 1323, 2490], 'previously': [1148, 1324], '(15Griesenbeck': [1149], 'Oei': [1151], 'Mayer-Kuckuk': [1153, 3809], 'P.': [1154, 1279, 3810], 'Buchlow': [1157, 3805, 4045], '36:': [1163], '7297-7394Crossref': [1164], '(42)': [1167], 'Recombinant': [1170, 1204, 1235, 1618], '(plasmid': [1174], 'pHisYY1)': [1175], 'produced': [1176, 2087, 2233], 'Seto': [1186], 'et': [1187, 2628], 'al.': [1188, 2629], '(16Seto': [1189], 'Shi': [1191], 'Y.': [1192], 'Shenk': [1193], '1991;': [1196], '354:': [1197], '241-245Crossref': [1198], '(342)': [1201], 'obtained': [1208, 2130, 3083, 3170], 'transformed': [1213], 'plasmid': [1216, 1495, 1799], 'pET-8c-p53H-47': [1217], '(17Foord': [1218], 'Navot': [1220], 'Rotter': [1222], 'Mol.': [1224, 2898], 'Cell.': [1225, 1282, 2899], '13:': [1228], '1378-1384Crossref': [1229], '(34)': [1232], 'TBP': [1236, 1544, 2453, 2849, 3190, 3228, 3277, 3357, 3373, 3413, 3442, 3488, 3528, 3578, 3591, 3721, 3903], 'TFIIB': [1238, 1549, 2985, 2998, 3360, 3696], 'purchased': [1240], 'Promega.': [1242, 1540], '32P': [1243], 'labeling': [1244], 'oligonucleotides': [1247, 2375, 3274, 3833], '(YY1': [1248], '(18Yant': [1249, 2009], 'S.R.': [1250, 2010, 2927], 'Zhu': [1251, 2011], 'Millinoff': [1253, 2013], 'Slightom': [1255, 2015], 'J.L.': [1256, 2016], 'Goodman': [1257, 2017], 'Gumucio': [1259, 2019], 'D.L.': [1260, 2020], 'Nucleic': [1261, 2021], 'Acids': [1262, 2022], '23:': [1265, 2025], '4353-4362Crossref': [1266, 2026], '(132)': [1269, 2029], 'Scholar),': [1271, 1293, 1311, 2517, 2943, 3251, 3607], 'GGCTCCGCGGCCATCTTGGCGGCT;': [1272], 'Sp1(19),': [1273], 'ATTCGATCGGGGCGGGGCGAGC;': [1274], 'AP-1': [1275, 2365, 2397, 3740, 3757], '(20Lee': [1276], 'Mitchell': [1278], 'Tjian': [1280], '1987;': [1283], '49:': [1284], '741-752Abstract': [1285], '(1365)': [1291], 'CGCTTGATGAGTCAGCCGGAA;': [1294], 'TATA': [1296, 1531, 1556, 3273, 3292, 3500], '(21Locker': [1297], 'Buzard': [1299], 'Seq.': [1303], '1990;': [1304], '1:': [1305], '3-11Crossref': [1306], '(111)': [1309], 'GCAGAGCATATAAGGTGAGGTAGGA)': [1312], 'EMSAs': [1314, 1418, 1476, 1931, 1975, 2000, 3269], 'HeLa': [1316, 1356, 1785, 2142, 2236, 2284, 3644], 'extracts': [1318, 1357, 1450, 1787, 2144, 2237, 3646], '(Promega)': [1319], 'performed': [1321, 1534, 3271], 'brief,': [1350], '(4': [1358, 2220], 'μg': [1359, 1789], 'protein)': [1361], 'recombinant': [1363, 1481, 1702, 2034, 2498, 2762, 3276, 4039], 'incubated': [1366, 1551, 1622, 1705, 3034, 3121], '5': [1368, 1388, 1553, 3047, 3050, 3067, 3134, 3137, 3154, 3868], 'ng': [1369, 1406, 1432, 1491, 1542, 1547, 1554, 1595, 1795], 'of32P-labeled': [1370, 1555, 1693], 'duplex': [1371, 1557], 'oligonucleotide': [1372, 1436, 1444, 1532, 1558, 2008, 2119, 2139, 2297, 2329, 2342, 2349, 3293], 'for': [1373, 1559, 1822, 2831, 2842, 3066, 3084, 3153, 3171, 3235, 3365, 3438, 3525, 3637, 3778, 3897, 3947, 4032, 4036, 4046], '20': [1374, 1380, 1541, 1566, 1823], 'min': [1375, 1561, 1824, 3068, 3155, 3869], 'at': [1376, 1562, 1659, 1715, 1825, 1883, 3040, 3127], 'room': [1377, 1563], 'temperature': [1378, 1564, 1827], 'mm': [1381, 1386, 1389, 1392, 1567, 1572, 1575, 1578, 1627, 1632, 1836, 1839, 1842, 1857, 1860], 'Tris-HCl,': [1382, 1568, 1628], 'pH': [1383, 1569, 1629, 1833], '8,': [1384, 1570], '60': [1385], 'KCl,': [1387, 1573, 1837], 'MgCl2,': [1390, 1576, 1633], 'dithiothreitol,': [1393, 1579, 1843], '0.05%': [1394], 'Nonidet': [1395], 'P-40,': [1396], '10%': [1397, 1581, 1844], 'glycerol,': [1398, 1845], '50': [1399, 1546, 1634, 1835], 'μg/ml': [1400, 1652, 3020, 3029, 3045, 3048, 3051, 3054, 3057, 3061, 3107, 3116, 3132, 3135, 3138, 3141, 3144, 3148], 'bovine': [1401, 1638], 'serum': [1402, 1639], 'albumin,': [1403], '500': [1405], 'poly': [1408], '(dI-dC)': [1409], 'final': [1412, 1585, 1672, 1720, 1871], 'volume': [1413, 1586, 1721, 1873], '10': [1415, 1574, 1588, 1594, 1651, 1723, 3028, 3044, 3053, 3056, 3060, 3115, 3131, 3140, 3143, 3147], 'μl.': [1416, 1589, 1876], 'If': [1417, 1475], 'carried': [1420, 1478, 1954, 2002], 'out': [1421, 1479, 1955, 2003, 2092, 2677], 'extracts,': [1424], 'contained': [1428, 1486, 1784], 'addition': [1430, 1646, 1739, 2037, 2301, 2420, 2444, 2755, 2820, 2847, 2995, 3404, 3872], '400': [1431], 'unrelated': [1435], 'unspecific': [1438, 1443, 1488], 'competitor': [1439], 'inhibit': [1442], 'activities': [1446], 'proteins,': [1482, 3693, 3709], 'inhibitor': [1489, 2194], '200': [1490, 1794], 'promoter-less': [1494], 'p(C2AT)n': [1496], '(22Sawadogo': [1497, 1801], '1985;': [1508, 1812], '82:': [1509, 1813], '4394-4398Crossref': [1510, 1814], '(367)': [1513, 1817], 'Following': [1516, 1590, 1820], 'protein-DNA': [1520], 'separated': [1523, 1746], '4%': [1526], 'gel.': [1528, 1611], 'EMSA': [1529, 2135, 2378, 3425, 3761, 3788], 'according': [1535], 'protocol': [1538], '15': [1560, 1875], '80': [1571], '2': [1577, 2774, 2802, 2824, 3106, 3533, 3698, 3728], 'glycerol': [1582], 'poly(dI-dC)': [1597], 'added,': [1599], 'samples': [1601], 'subjected': [1603], 'electrophoretic': [1605], 'separation': [1606], '6%': [1609], 'gels': [1615, 1751], 'autoradiographed.': [1617], 'buffer': [1625, 1830], '(10': [1626, 1831], '8.0,': [1630], '7': [1631, 1847], 'μmZnCl2,': [1635], '1%': [1637], 'albumin).': [1640], 'Reactions': [1641], 'started': [1643, 1852], '32P-labeled': [1648, 1713, 3025, 3112], 'sonicated': [1653, 3031, 3118], 'salmon': [1654], 'sperm': [1655], '(Boehringer,': [1657], 'Mannheim)': [1658], '25': [1660, 1716, 1862], '°C.': [1661], 'Incubations': [1662, 1734, 3063, 3150], 'stopped': [1664, 1736, 3071, 3158], 'adding': [1666, 1854, 2191], 'trichloroacetic': [1667, 1678, 1687, 3073, 3160], 'acid': [1668, 1679, 1688, 3074, 3161], 'give': [1670], 'concentration': [1673], '20%.': [1675], 'centrifugation': [1677], 'precipitates': [1680], 'washed': [1682], 'two': [1683], 'times': [1684], '5%': [1686], 'ethanol.': [1691], 'Incorporation': [1692], 'units': [1695], 'determined': [1697], 'Cerenkov': [1699], 'counting.': [1700], 'Purified': [1701], 'presence': [1711, 1946, 2057, 2170, 2213, 2244, 2601, 3690], '°C': [1717], 'μl': [1724], 'under': [1725, 2699, 3376], 'conditions': [1726, 2698, 3377, 3504], 'indicated': [1727, 3039, 3126], 'legends': [1730], 'figures.': [1733], 'SDS-containing': [1741], 'sample': [1742], 'buffer.': [1743], 'Proteins': [1744], 'SDS-PAGE.': [1748], 'dried,': [1753], 'with32P-labeled': [1758], 'autoradiography.': [1763], 'Standard': [1764], 'reactions': [1766], '(10Oei': [1767, 3468, 3669, 3875], '(18': [1788], 'protein/reaction': [1791], 'mixture)': [1792], 'supercoiled': [1798], 'pML(C2AT)n': [1800], 'preincubation': [1821], 'ambient': [1826], 'mmHEPES,': [1832], '7.9,': [1834], '0.1': [1838, 1867], 'EDTA,': [1840], '0.25': [1841], 'mmMgCl2)': [1848], 'NTPs': [1855], '(0.6': [1856], 'ATP,': [1858], '0.6': [1859], 'UTP,': [1861], 'μm[α-32P]CTP,': [1863], '10,000': [1864], 'cpm/pmol,': [1865], 'mm3′-O-methyl-GTP)': [1868], 'All': [1877], 'data': [1878, 3587], 'presented': [1879, 3205, 3263, 3588, 3839], 'representative': [1881], 'least': [1884], 'three': [1885], 'independent': [1886], 'experiments.': [1887], 'goal': [1892], 'understand': [1898], 'how': [1899], 'activation': [1900], 'analyzed.': [1916], 'bind': [1923, 2293, 3497], 'cognate': [1926, 3450], 'sequences': [1927, 2433], 'tested': [1929], 'following': [1932, 3042, 3129, 3870, 3976], 'incubation': [1933, 3747], 'catalytically': [1935], 'inactive': [1936], '(in': [1937, 1944, 2454, 3191], 'NAD+)': [1941, 1948], 'ADPRT.': [1949, 3221], 'experiments': [1951, 2094, 3835], 'first': [1953], 'YY1,': [1957, 2846, 3046, 3133], 'which': [1958, 2225, 2466, 2700, 3736], 'known': [1960, 2519, 2875, 3231], 'partner': [1964, 2520, 2876], 'sensitive': [1971, 3295], 'consensus': [2007, 2138, 2328, 2341, 2348, 2432], 'unmodified': [2039], 'did': [2041, 2111, 2250, 2389, 3308, 3754], 'affect': [2043, 3756], '(Fig.': [2049, 2069, 2122, 2131, 2173, 2185, 2260, 2308, 2330, 2366, 2406, 2447, 2581, 2773, 2801, 2823, 3299, 3317, 3367, 3386, 3414, 3428, 3514, 3529, 3542, 3762], 'A,': [2051, 2071, 2124, 2310, 2583, 3285, 3301, 3319, 3388, 3430, 3544], 'lane': [2052, 2072, 2125, 2176, 2188, 2263, 2311, 2315, 2333, 2369, 2409, 2450, 2584, 2588, 2964, 3302, 3320, 3389, 3417, 3431, 3517, 3545, 3625, 3765], '2),': [2053, 3210], 'strongly': [2067], 'suppressed': [2068], '3).': [2073, 2451, 3321, 3432, 3626], 'possibility': [2075], 'solely': [2084], 'polymers': [2089, 2098, 2106, 2219, 2388, 2608, 2618], 'ruled': [2091], 'using': [2095, 2140, 3272, 3789], 'isolated': [2096, 2617], 'instead': [2099], 'NAD+.': [2101], 'Addition': [2102, 2384, 2759], 'deproteinized': [2104, 2386, 2606], '(detached': [2107], 'automodified': [2109], 'ADPRT)': [2110], 'retention': [2115, 2363, 3831], '4).': [2126, 2264], 'Similar': [2127], 'B)': [2133], 'cell-free': [2141], '(23Dignam': [2145], 'Lebowitz': [2147], 'R.M.': [2148], 'Nucl.': [2151], 'Ac.': [2152], '11:': [2155], '1475-1489Crossref': [2156], '(9164)': [2159], 'abolished': [2167], 'B,': [2175, 2187, 2262, 2314, 2408, 2587, 3416, 3531, 3624], '2).': [2177, 3303, 3390, 3546], '3)': [2189], 'potent': [2193], 'poly(ADP-ribosyl)ation,': [2196], '3-aminobenzamide': [2197, 2422], '(24Purnell': [2198], 'M.R.': [2199], 'Whish': [2200], 'W.J.D.': [2201], '185:': [2205], '775-777Crossref': [2206], '(419)': [2209], 'amount': [2216], 'nmol': [2221], 'units),': [2224], 'far': [2227], 'exceeded': [2228], 'maximum': [2230], 'endogenous': [2240], 'mmNAD+': [2247], '(not': [2248, 2343, 2359, 2373, 2398, 2423, 2609, 3748], 'shown),': [2249], 'any': [2253], 'NAD+-dependent': [2266], 'prevention': [2267, 3537, 3779], 'extract.': [2286], 'However,': [2287, 2671, 3304], 'allowed': [2291], 'prior': [2298, 2441, 3401, 3615], 'remained': [2306, 3426], 'unaffected': [2307, 2435, 3427], '5,': [2312], '5).': [2316], 'A': [2317, 3699, 3729], 'similar': [2318, 2461, 3836], 'sensitivity': [2319], 'Sp1': [2327, 2395, 2413], 'C,': [2332, 2368, 2449, 2963, 3516, 3764], '2)': [2334, 3518], 'NFκB': [2340], 'shown).': [2344, 2360, 2399, 2424, 2610, 3749, 3843], 'Using': [2345], 'detectable': [2355, 2810, 3410, 3743], 'less': [2357, 2864, 3866], 'pronounced': [2358], 'contrast,': [2362], '5)': [2370, 2965, 3766], 'shown)': [2374], 'insensitive': [2380, 2957], 'activity.': [2383], 'As': [2400, 2574, 3187, 3280], '3),': [2410, 3418], 'Again,': [2425], 'taken': [2439], 'place': [2440], 'Importantly,': [2452, 3370], 'complex': [2455, 3192, 3286, 3420], 'TFIIB)': [2457, 3194], 'exhibited': [2458, 3195], 'response': [2462], 'activity,': [2465], 'significance': [2469], 'regard': [2471], '(see': [2478, 2839], 'below).': [2479], 'interference': [2481], 'above': [2491, 3206], '(25Vaziri': [2523], 'West': [2525], 'M.D.': [2526], 'Allsopp': [2527], 'R.C.': [2528], 'Davison': [2529], 'T.S.': [2530], 'Wu': [2531], 'Y.S.': [2532], 'Arrowsmith': [2533], 'C.H.': [2534], 'Benchimol': [2537], '16:': [2542], '6018-6033Crossref': [2543], '(334)': [2546], 'opposed': [2575], 'observations': [2578], '4': [2585], '4)': [2589, 3535], 'repressed': [2598], 'amounts': [2604], 'high': [2612], 'affinity': [2613], 'accordance': [2621], 'recent': [2624, 3549], 'report': [2625, 3550], 'Malanga': [2627], '(26Malanga': [2630], 'Pleschke': [2632], 'Kleczkowska': [2634], 'H.E.': [2635], 'Althaus': [2636], 'F.R.': [2637], '273:': [2642, 2932], '111843-118434Abstract': [2643], '(196)': [2650], 'important': [2674, 2829, 3849, 3917], 'point': [2676], 'dissociation': [2688], 'preformed': [2690, 3311], 'influenced': [2709, 3829], 'implicated': [2710], 'interaction': [2712, 3215], 'these': [2716, 2867, 3217, 3827], 'depended': [2719], 'functional': [2722], 'state': [2723], 'enzyme.': [2726], 'To': [2727], 'gain': [2728], 'insight': [2729], 'into': [2730], 'whether': [2731], 'turn': [2735], 'we': [2745], 'compared': [2746], 'rate': [2748, 2971, 3770], 'without': [2753, 3929], 'resulted': [2764, 2853], 'substantial': [2767], 'acceleration': [2768], 'A).': [2775, 2803], 'enhancement': [2778], '[32P]poly(ADP-ribose)': [2780], 'synthesis': [2781, 2974], 'attributable': [2783], 'both': [2785], 'auto(ADP-ribosyl)ation': [2788, 2859], 'occurrence': [2794], 'heteromodification': [2796], 'Remarkably,': [2804], 'B).': [2825, 3268, 3369], 'finding': [2827], 'holds': [2828], 'implications': [2830], 'repress': [2837], 'below': [2841], 'TBP).': [2843], 'Similarly': [2844], 'stimulation': [2856], '(Table': [2861, 2975, 3005], 'I),': [2862], 'although': [2863, 3720], 'efficiently.': [2865], 'Nevertheless,': [2866], 'effects': [2868], 'appear': [2869, 3584], 'specific,': [2872], 'XRCC1': [2880], '(x-ray': [2881], 'repaircross-complementing': [2882], '1)': [2883], '(27Masson': [2884], 'Niedergang': [2886], 'Schreiber': [2888], 'Müller': [2890], 'J': [2894], '18:': [2902], '3563-3571Crossref': [2903], '(833)': [2906], 'DNA-dependent': [2910], 'kinase': [2912], '(28Ruscetti': [2913], 'Lehnert': [2915], 'B.,': [2916], 'Halbrook': [2918], 'Trong': [2920], 'H.L.': [2921], 'Hoekstra': [2922], 'M.F.': [2923], 'Chen': [2924], 'D.J.': [2925], 'Peterson': [2926], '14461-14467Abstract': [2933], '(213)': [2941], 'inhibited': [2944], 'reaction.': [2947], 'AP-1-binding': [2949], 'whose': [2952], '(cf.': [2960, 3621], 'Fig.': [2961, 3265, 3283, 3622, 3841, 3860], 'no': [2967, 3409], 'I).': [2976], 'stimulating': [2978], 'weak.': [2991], 'Still,': [2992], 'if,': [2993], 'present,': [3000], 'further': [3003], 'I).Table': [3006], 'IStimulation': [3007], 'factorsTranscription': [3013], 'addedRelative': [3015], 'ADPRTNone': [3018], '1YY18.3TBP2.3TFIIB1.6TBP+TFIIB4.5p532.5c-Jun1.12': [3019], 'μm': [3023, 3110], 'concentrations:': [3043, 3130], 'TFIIB,': [3055, 3142, 3230], 'c-Jun.': [3062, 3149], 'continued': [3065, 3152], 'then': [3070, 3157], 'precipitation.': [3075, 3162], 'Incorporated': [3076, 3163], 'radioactivity': [3077, 3164], 'related': [3079, 3166], 'value': [3082, 3169], '(40': [3093, 3180], 'pmol': [3094, 3181], 'units/μg': [3097, 3184], 'ADPRT).': [3099, 3186], 'Open': [3100], 'table': [3101], 'new': [3104, 3926], 'tab': [3105], 'mentioned': [3188], 'before,': [3189], 'behavior': [3197], 'resembling': [3198], 'assays': [3204], '(Figs.': [3207, 3697, 3727], 'indicating': [3211], 'physical': [3214], 'considerable': [3225], 'interest,': [3226], '(29Lee': [3239], 'Hahn': [3241], '376:': [3245], '609-612Crossref': [3246], '(79)': [3249], 'essential': [3253, 3494], 'components': [3254], 'machinery.': [3259], '3(A': [3266], 'TFIIB.': [3279], '3': [3284, 3300, 3318, 3368, 3387, 3415, 3429, 3515, 3530, 3543, 3623, 3701, 3731, 3861], 'TBP/TFIIB': [3289, 3314, 3385], 'accomplished': [3338], 'Analysis': [3348], 'revealed': [3354], 'occurred': [3374], 'diminished': [3380], 'That': [3391, 3933], 'is,': [3392, 3934], 'there': [3407], 'visualized': [3423], 'These': [3433], 'findings': [3434], 'provide': [3435], 'strong': [3436], 'support': [3437], 'conclusion': [3440, 3918], 'sequence': [3451], 'proposed,': [3458], 'therefore,': [3459], 'underlying': [3463], 'includes': [3485], 'causing': [3489], 'inability': [3491], 'box.': [3501], 'Indeed,': [3502], 'required': [3505], 'observe': [3507], 'Pol': [3511], 'parallel': [3519], 'those': [3520, 3838], 'crucial': [3524, 3777, 3906], 'lanes': [3532], 'acceptor': [3574, 3708], 'poly(ADP-ribose),': [3576], 'modified.': [3581, 3718], 'would': [3583], 'escaped': [3592], 'already': [3611], 'Several': [3627], 'lines': [3628], 'evidence': [3630, 3896], 'demonstrate': [3631], 'specificity': [3633], 'For': [3641], 'example,': [3642], 'caused': [3649], 'accompanied': [3653], 'selective': [3655, 3999], 'primarily': [3658], 'addition,': [3687, 3998], 'e.g.albumin': [3694], 'B),': [3702, 3732], 'respectively,': [3713], 'Furthermore,': [3719], 'readily': [3725], 'ADP-ribosylated': [3726], 'c-Jun,': [3735], 'binds': [3737], 'specifically': [3738], 'sites,': [3741], 'prolonged': [3746], 'observation': [3751], 'suggests': [3767], 'might': [3775], 'binding.': [3782], 'supposition': [3784], 'corroborated': [3786], 'NAD+analogs': [3790], 'permit': [3792], 'very': [3794], 'slow': [3795], 'rates': [3796], '(30Oei': [3801], 'Jorcke': [3807], 'Wons': [3811], '397:': [3818], '17-21Crossref': [3819], '(23)': [3822], 'None': [3825], 'analogs': [3828], '1(not': [3842], 'respect': [3846], 'note': [3851], 'C': [3862], 'achieved': [3864], 'within': [3865], 'Finally,': [3892], 'provides': [3895], 'suggestion': [3899], 'step': [3907], 'underlines': [3915], 'initiated,': [3921], 'interrupting': [3930], 'ongoing': [3931], 'once': [3935], 'preinitiation': [3937], 'formed,': [3941], 'ADP-ribosylation.': [3948], 'essence,': [3950], 'According': [3966], 'role': [3969], 'survival': [3974], 'stress,': [3978], 'participation': [3979], 'during': [3992], 'recovery': [3993], 'damage.': [3996], 'novel': [4006], 'controlling': [4009], 'We': [4016], 'thank': [4017], 'Drs.': [4018], 'Shenk,': [4020], 'Lee,': [4023], 'Yang,': [4026], 'B.': [4027], 'Lüscher,': [4028], 'Rotta': [4031], 'kindly': [4033], 'providing': [4034], 'plasmids': [4035], 'expert': [4047], 'technical': [4048], 'assistance.': [4049]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W2013289541', 'counts_by_year': [{'year': 2024, 'cited_by_count': 1}, {'year': 2023, 'cited_by_count': 2}, {'year': 2022, 'cited_by_count': 1}, {'year': 2021, 'cited_by_count': 1}, {'year': 2020, 'cited_by_count': 1}, {'year': 2019, 'cited_by_count': 1}, {'year': 2018, 'cited_by_count': 2}, {'year': 2017, 'cited_by_count': 2}, {'year': 2016, 'cited_by_count': 4}, {'year': 2015, 'cited_by_count': 1}, {'year': 2014, 'cited_by_count': 1}, {'year': 2013, 'cited_by_count': 4}, {'year': 2012, 'cited_by_count': 5}], 'updated_date': '2025-01-11T04:14:43.166722', 'created_date': '2016-06-24'}