Publication Information

{'id': 'https://openalex.org/W2009184278', 'doi': 'https://doi.org/10.1074/jbc.274.29.20185', 'title': 'Osmotic Response Element Enhancer Activity', 'display_name': 'Osmotic Response Element Enhancer Activity', 'publication_year': 1999, 'publication_date': '1999-07-01', 'ids': {'openalex': 'https://openalex.org/W2009184278', 'doi': 'https://doi.org/10.1074/jbc.274.29.20185', 'mag': '2009184278', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/10400634'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.274.29.20185', 'pdf_url': 'http://www.jbc.org/article/S0021925819726350/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S0021925819726350/pdf', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5087074426', 'display_name': 'Varsha Nadkarni', 'orcid': None}, 'institutions': [], 'countries': [], 'is_corresponding': False, 'raw_author_name': 'Varsha Nadkarni', 'raw_affiliation_strings': ['Harry B. and Aileen Gordon Diabetes Research Laboratory, Molecular Diabetes and Metabolism Section, Department of Pediatrics, and the'], 'affiliations': [{'raw_affiliation_string': 'Harry B. and Aileen Gordon Diabetes Research Laboratory, Molecular Diabetes and Metabolism Section, Department of Pediatrics, and the', 'institution_ids': []}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5110928371', 'display_name': 'Kenneth H. Gabbay', 'orcid': None}, 'institutions': [], 'countries': [], 'is_corresponding': False, 'raw_author_name': 'Kenneth H. Gabbay', 'raw_affiliation_strings': ['Harry B. and Aileen Gordon Diabetes Research Laboratory, Molecular Diabetes and Metabolism Section, Department of Pediatrics, and the'], 'affiliations': [{'raw_affiliation_string': 'Harry B. and Aileen Gordon Diabetes Research Laboratory, Molecular Diabetes and Metabolism Section, Department of Pediatrics, and the', 'institution_ids': []}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5089032199', 'display_name': 'Kurt M. Bohren', 'orcid': 'https://orcid.org/0000-0002-3183-4118'}, 'institutions': [], 'countries': [], 'is_corresponding': False, 'raw_author_name': 'Kurt M. Bohren', 'raw_affiliation_strings': ['Harry B. and Aileen Gordon Diabetes Research Laboratory, Molecular Diabetes and Metabolism Section, Department of Pediatrics, and the'], 'affiliations': [{'raw_affiliation_string': 'Harry B. and Aileen Gordon Diabetes Research Laboratory, Molecular Diabetes and Metabolism Section, Department of Pediatrics, and the', 'institution_ids': []}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5016383010', 'display_name': 'David Sheikh‐Hamad', 'orcid': 'https://orcid.org/0000-0003-4436-4191'}, 'institutions': [{'id': 'https://openalex.org/I181547552', 'display_name': 'Baylor College of Medicine', 'ror': 'https://ror.org/02pttbw34', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I181547552', 'https://openalex.org/I2801539370']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'David Sheikh-Hamad', 'raw_affiliation_strings': ['Renal Division, Department of Medicine, Baylor College of Medicine, Houston, Texas 77030'], 'affiliations': [{'raw_affiliation_string': 'Renal Division, Department of Medicine, Baylor College of Medicine, Houston, Texas 77030', 'institution_ids': ['https://openalex.org/I181547552']}]}], 'institution_assertions': [], 'countries_distinct_count': 1, 'institutions_distinct_count': 1, 'corresponding_author_ids': [], 'corresponding_institution_ids': [], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 3.827, 'has_fulltext': True, 'fulltext_origin': 'pdf', 'cited_by_count': 86, 'citation_normalized_percentile': {'value': 0.769264, 'is_in_top_1_percent': False, 'is_in_top_10_percent': False}, 'cited_by_percentile_year': {'min': 95, 'max': 96}, 'biblio': {'volume': '274', 'issue': '29', 'first_page': '20185', 'last_page': '20190'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T12533', 'display_name': 'Aldose Reductase and Taurine', 'score': 1.0, 'subfield': {'id': 'https://openalex.org/subfields/1307', 'display_name': 'Cell Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, 'topics': [{'id': 'https://openalex.org/T12533', 'display_name': 'Aldose Reductase and Taurine', 'score': 1.0, 'subfield': {'id': 'https://openalex.org/subfields/1307', 'display_name': 'Cell Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T10839', 'display_name': 'Pancreatic function and diabetes', 'score': 0.9857, 'subfield': {'id': 'https://openalex.org/subfields/2746', 'display_name': 'Surgery'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, {'id': 'https://openalex.org/T10631', 'display_name': 'Cancer, Hypoxia, and Metabolism', 'score': 0.9852, 'subfield': {'id': 'https://openalex.org/subfields/1306', 'display_name': 'Cancer Research'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/osmolyte', 'display_name': 'Osmolyte', 'score': 0.64148664}, {'id': 'https://openalex.org/keywords/osmotic-shock', 'display_name': 'Osmotic shock', 'score': 0.4682385}], 'concepts': [{'id': 'https://openalex.org/C2776439734', 'wikidata': 'https://www.wikidata.org/wiki/Q414213', 'display_name': 'Aldose reductase', 'level': 3, 'score': 0.69229126}, {'id': 'https://openalex.org/C127160389', 'wikidata': 'https://www.wikidata.org/wiki/Q415608', 'display_name': 'Osmolyte', 'level': 2, 'score': 0.64148664}, {'id': 'https://openalex.org/C161733203', 'wikidata': 'https://www.wikidata.org/wiki/Q911828', 'display_name': 'Reporter gene', 'level': 4, 'score': 0.6268486}, {'id': 'https://openalex.org/C97029542', 'wikidata': 'https://www.wikidata.org/wiki/Q281417', 'display_name': 'Protein kinase A', 'level': 3, 'score': 0.5936332}, {'id': 'https://openalex.org/C184235292', 'wikidata': 'https://www.wikidata.org/wiki/Q421851', 'display_name': 'Kinase', 'level': 2, 'score': 0.58461004}, {'id': 'https://openalex.org/C168529131', 'wikidata': 'https://www.wikidata.org/wiki/Q13656562', 'display_name': 'Osmotic shock', 'level': 3, 'score': 0.4682385}, {'id': 'https://openalex.org/C51551487', 'wikidata': 'https://www.wikidata.org/wiki/Q2043632', 'display_name': 'p38 mitogen-activated protein kinases', 'level': 4, 'score': 0.4589677}, {'id': 'https://openalex.org/C150194340', 'wikidata': 'https://www.wikidata.org/wiki/Q26972', 'display_name': 'Gene expression', 'level': 3, 'score': 0.44895872}, {'id': 'https://openalex.org/C153911025', 'wikidata': 'https://www.wikidata.org/wiki/Q7202', 'display_name': 'Molecular biology', 'level': 1, 'score': 0.44443056}, {'id': 'https://openalex.org/C185592680', 'wikidata': 'https://www.wikidata.org/wiki/Q2329', 'display_name': 'Chemistry', 'level': 0, 'score': 0.41986397}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.4097203}, {'id': 'https://openalex.org/C55493867', 'wikidata': 'https://www.wikidata.org/wiki/Q7094', 'display_name': 'Biochemistry', 'level': 1, 'score': 0.39300162}, {'id': 'https://openalex.org/C95444343', 'wikidata': 'https://www.wikidata.org/wiki/Q7141', 'display_name': 'Cell biology', 'level': 1, 'score': 0.35552007}, {'id': 'https://openalex.org/C104317684', 'wikidata': 'https://www.wikidata.org/wiki/Q7187', 'display_name': 'Gene', 'level': 2, 'score': 0.15327916}, {'id': 'https://openalex.org/C181199279', 'wikidata': 'https://www.wikidata.org/wiki/Q8047', 'display_name': 'Enzyme', 'level': 2, 'score': 0.13326803}], 'mesh': [{'descriptor_ui': 'D017871', 'descriptor_name': 'Calcium-Calmodulin-Dependent Protein Kinases', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D004742', 'descriptor_name': 'Enhancer Elements, Genetic', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': True}, {'descriptor_ui': 'D020929', 'descriptor_name': 'Mitogen-Activated Protein Kinase Kinases', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': True}, {'descriptor_ui': 'D020928', 'descriptor_name': 'Mitogen-Activated Protein Kinases', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': True}, {'descriptor_ui': 'D017346', 'descriptor_name': 'Protein-Serine-Threonine Kinases', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D011505', 'descriptor_name': 'Protein-Tyrosine Kinases', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D000449', 'descriptor_name': 'Aldehyde Reductase', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D000449', 'descriptor_name': 'Aldehyde Reductase', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D000818', 'descriptor_name': 'Animals', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D001483', 'descriptor_name': 'Base Sequence', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D017871', 'descriptor_name': 'Calcium-Calmodulin-Dependent Protein Kinases', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002460', 'descriptor_name': 'Cell Line', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D015500', 'descriptor_name': 'Chloramphenicol O-Acetyltransferase', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D015500', 'descriptor_name': 'Chloramphenicol O-Acetyltransferase', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D017931', 'descriptor_name': 'DNA Primers', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D004285', 'descriptor_name': 'Dogs', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D004791', 'descriptor_name': 'Enzyme Inhibitors', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D004791', 'descriptor_name': 'Enzyme Inhibitors', 'qualifier_ui': 'Q000494', 'qualifier_name': 'pharmacology', 'is_major_topic': False}, {'descriptor_ui': 'D005419', 'descriptor_name': 'Flavonoids', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D005419', 'descriptor_name': 'Flavonoids', 'qualifier_ui': 'Q000494', 'qualifier_name': 'pharmacology', 'is_major_topic': False}, {'descriptor_ui': 'D006801', 'descriptor_name': 'Humans', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D048369', 'descriptor_name': 'MAP Kinase Kinase 1', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D009994', 'descriptor_name': 'Osmolar Concentration', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011485', 'descriptor_name': 'Protein Binding', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D017346', 'descriptor_name': 'Protein-Serine-Threonine Kinases', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D017346', 'descriptor_name': 'Protein-Serine-Threonine Kinases', 'qualifier_ui': 'Q000037', 'qualifier_name': 'antagonists & inhibitors', 'is_major_topic': False}, {'descriptor_ui': 'D011505', 'descriptor_name': 'Protein-Tyrosine Kinases', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011505', 'descriptor_name': 'Protein-Tyrosine Kinases', 'qualifier_ui': 'Q000037', 'qualifier_name': 'antagonists & inhibitors', 'is_major_topic': False}, {'descriptor_ui': 'D012333', 'descriptor_name': 'RNA, Messenger', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D012333', 'descriptor_name': 'RNA, Messenger', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D015398', 'descriptor_name': 'Signal Transduction', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D014157', 'descriptor_name': 'Transcription Factors', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D014157', 'descriptor_name': 'Transcription Factors', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D048051', 'descriptor_name': 'p38 Mitogen-Activated Protein Kinases', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}], 'locations_count': 2, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.274.29.20185', 'pdf_url': 'http://www.jbc.org/article/S0021925819726350/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/10400634', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.274.29.20185', 'pdf_url': 'http://www.jbc.org/article/S0021925819726350/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 32, 'referenced_works': ['https://openalex.org/W1487920066', 'https://openalex.org/W1499693439', 'https://openalex.org/W1515131982', 'https://openalex.org/W1547521803', 'https://openalex.org/W1568192877', 'https://openalex.org/W1604507293', 'https://openalex.org/W1604557194', 'https://openalex.org/W1631361623', 'https://openalex.org/W1806143782', 'https://openalex.org/W1847275787', 'https://openalex.org/W1966547087', 'https://openalex.org/W1969488647', 'https://openalex.org/W1971915141', 'https://openalex.org/W1971946365', 'https://openalex.org/W1986115510', 'https://openalex.org/W1996088807', 'https://openalex.org/W1997634040', 'https://openalex.org/W2001399809', 'https://openalex.org/W2019968039', 'https://openalex.org/W2024284478', 'https://openalex.org/W2030271387', 'https://openalex.org/W2032731042', 'https://openalex.org/W2035936653', 'https://openalex.org/W2059571743', 'https://openalex.org/W2065509427', 'https://openalex.org/W2072410510', 'https://openalex.org/W2078901242', 'https://openalex.org/W2081622770', 'https://openalex.org/W2097794242', 'https://openalex.org/W2112225255', 'https://openalex.org/W2161538812', 'https://openalex.org/W2163562782'], 'related_works': ['https://openalex.org/W4200050017', 'https://openalex.org/W2980412163', 'https://openalex.org/W2174383954', 'https://openalex.org/W2154893635', 'https://openalex.org/W2143735239', 'https://openalex.org/W2042742291', 'https://openalex.org/W2018093451', 'https://openalex.org/W1994573931', 'https://openalex.org/W1974859630', 'https://openalex.org/W1944875260'], 'abstract_inverted_index': {'Hypertonicity': [0, 254, 1142, 3858], 'induces': [1, 255, 3232], 'a': [2, 80, 184, 256, 334, 438, 618, 666, 882, 937, 981, 1019, 1026, 1153, 1188, 1293, 1658, 1931, 1948, 2023, 2160, 2284, 2556, 2693, 2712, 2724, 2942, 3101, 3208, 3233, 3258, 3404, 3408, 3491, 3497, 3552, 3559, 3568, 3599, 3892, 4151, 4171, 4221], 'group': [3, 257], 'of': [4, 13, 39, 64, 94, 130, 157, 173, 178, 195, 199, 210, 249, 258, 267, 293, 318, 348, 384, 411, 427, 432, 449, 453, 464, 503, 525, 550, 559, 563, 592, 600, 621, 648, 669, 696, 813, 913, 968, 1025, 1028, 1035, 1080, 1092, 1096, 1107, 1117, 1145, 1159, 1161, 1206, 1302, 1364, 1366, 1393, 1400, 1414, 1425, 1434, 1455, 1459, 1467, 1477, 1502, 1599, 1617, 1630, 1688, 1707, 1876, 1878, 1907, 1918, 1938, 1953, 2015, 2026, 2054, 2078, 2103, 2129, 2273, 2367, 2392, 2463, 2575, 2577, 2763, 2823, 2899, 2926, 3012, 3187, 3206, 3217, 3228, 3257, 3262, 3310, 3393, 3431, 3454, 3463, 3478, 3546, 3587, 3591, 3602, 3631, 3636, 3657, 3669, 3687, 3727, 3760, 3767, 3884, 3910, 3926, 3929, 3949, 3964, 4106, 4124, 4136, 4153, 4176, 4194, 4206, 4223, 4242], 'genes': [5, 24, 259, 278, 552, 1402, 1440], 'that': [6, 61, 90, 122, 154, 239, 260, 315, 344, 376, 408, 493, 808, 1190, 1292, 1341, 1357, 1496, 1624, 2071, 3225, 3356, 3416, 3448, 3500, 3959], 'are': [7, 25, 116, 244, 261, 279, 370, 498, 1483, 1508, 2608, 3449, 3972, 4150, 4220], 'responsible': [8, 35, 262, 289], 'for': [9, 36, 263, 290, 738, 768, 988, 1348, 1644, 1866, 1927, 1950, 2002, 2134, 2253, 2436, 2531, 2548, 2597, 2610, 2630, 2648, 2833, 2878, 2904, 2973, 2991, 3086, 3160, 3170, 3628], 'the': [10, 26, 37, 44, 62, 68, 91, 104, 126, 131, 135, 155, 161, 171, 196, 208, 214, 247, 250, 264, 280, 291, 298, 316, 322, 345, 358, 380, 385, 389, 409, 415, 425, 450, 462, 468, 501, 504, 522, 560, 564, 598, 769, 803, 810, 1023, 1038, 1044, 1090, 1125, 1157, 1162, 1207, 1285, 1300, 1342, 1349, 1361, 1391, 1397, 1412, 1422, 1430, 1453, 1465, 1475, 1481, 1497, 1506, 1511, 1545, 1557, 1565, 1615, 1621, 1626, 1631, 1639, 1663, 1678, 1689, 1700, 1708, 1793, 1809, 1889, 1942, 1954, 1959, 1971, 1983, 2013, 2059, 2067, 2075, 2089, 2094, 2130, 2215, 2225, 2236, 2245, 2274, 2289, 2363, 2374, 2445, 2469, 2477, 2527, 2560, 2573, 2580, 2591, 2598, 2620, 2631, 2635, 2664, 2672, 2721, 2733, 2760, 2764, 2820, 2844, 2886, 3002, 3044, 3094, 3204, 3214, 3255, 3263, 3294, 3311, 3336, 3343, 3422, 3429, 3440, 3444, 3451, 3461, 3476, 3479, 3502, 3522, 3544, 3547, 3574, 3588, 3609, 3613, 3620, 3623, 3629, 3632, 3664, 3725, 3748, 3758, 3768, 3772, 3781, 3787, 3869, 3882, 3908, 3911, 3924, 3930, 3936, 3947, 3950, 3960, 4122, 4134, 4192, 4204, 4240, 4249, 4252], 'intracellular': [11, 265, 1050, 1081, 1105], 'accumulation': [12, 266, 524, 591, 1056, 1106], 'protective': [14, 268, 561], 'organic': [15, 269, 527], 'osmolytes': [16, 270, 528, 594], 'such': [17, 271, 815], 'as': [18, 101, 103, 272, 355, 357, 603, 800, 802, 816, 1472, 1474, 1574, 1947, 2299, 2369, 2628, 2646, 2976, 3088, 3152, 3284, 3784, 3786, 4112, 4119, 4182, 4189, 4285], 'sorbitol': [19, 273, 819, 1039, 1055, 1082, 1108], 'and': [20, 43, 165, 207, 242, 274, 297, 419, 461, 496, 514, 990, 1013, 1369, 1417, 1486, 1500, 1514, 1550, 1562, 1601, 1611, 1666, 1672, 1675, 1703, 1785, 1799, 1811, 1827, 1843, 1864, 1998, 2111, 2119, 2126, 2184, 2202, 2218, 2244, 2268, 2270, 2279, 2377, 2422, 2450, 2457, 2472, 2529, 2559, 2564, 2567, 2588, 2612, 2661, 2671, 2683, 2718, 2728, 2740, 2745, 2799, 2843, 2848, 2867, 2874, 2885, 2928, 2949, 2966, 2983, 3028, 3040, 3068, 3138, 3163, 3177, 3281, 3419, 3428, 3457, 3484, 3505, 3513, 3517, 3754, 3866, 3872, 3967, 4149, 4219, 4245, 4254, 4264, 4288, 4311], 'betaine.': [21, 275], 'Two': [22, 276, 4278], 'representative': [23, 277], 'aldose': [27, 95, 200, 281, 349, 454, 804, 898, 953], 'reductase': [28, 96, 201, 282, 350, 455, 805, 899, 954], 'enzyme': [29, 283, 806, 987], '(AR,': [30, 284], 'EC': [31, 285], '1.1.1.21),': [32, 286], 'which': [33, 48, 287, 302, 1114, 1211, 1698, 1940, 1957, 2742, 3779], 'is': [34, 76, 163, 166, 288, 330, 417, 420, 595, 617, 665, 980, 1046, 1073, 1102, 1115, 1185, 1346, 2594, 2616, 2626, 2644, 2653, 3252, 3297, 3879, 4130, 4200, 4312], 'conversion': [38, 292], 'glucose': [40, 294, 989, 1036, 1051, 1086, 1112, 1833], 'to': [41, 55, 134, 160, 213, 295, 309, 388, 414, 467, 517, 556, 569, 571, 818, 1017, 1054, 1076, 1098, 1307, 1410, 1429, 1451, 1480, 1505, 1807, 1925, 2000, 2018, 2021, 2036, 2039, 2057, 2066, 2069, 2241, 2359, 2454, 2468, 2526, 2618, 2736, 2758, 2814, 2960, 3030, 3093, 3200, 3230, 3342, 3349, 3661, 3701, 3711, 3720, 4142, 4212], 'sorbitol,': [42, 296], 'betaine': [45, 51, 299, 305, 705], 'transporter': [46, 300, 607, 613, 661, 736, 767, 871, 904, 926, 959], '(BGT1),': [47, 301], 'mediates': [49, 125, 303, 379, 1212], 'Na+-coupled': [50, 304], 'uptake': [52, 306], 'in': [53, 67, 98, 112, 193, 230, 233, 246, 307, 321, 352, 366, 447, 484, 487, 500, 1022, 1122, 1124, 1149, 1156, 1284, 1305, 1354, 1396, 1421, 1462, 1830, 1970, 2005, 2051, 2100, 2189, 2265, 2283, 2362, 2386, 2486, 2493, 2517, 2579, 2711, 2732, 2755, 2801, 2850, 2871, 2890, 2907, 3100, 3155, 3165, 3220, 3236, 3240, 3245, 3250, 3254, 3277, 3289, 3396, 3435, 3443, 3470, 3475, 3519, 3535, 3543, 3551, 3643, 3731, 3881, 3891, 4158, 4170, 4228, 4297, 4308], 'response': [54, 106, 308, 360, 562, 637, 685, 894, 949, 1198, 1306, 1547, 2762, 3540], 'osmotic': [56, 105, 310, 359, 893, 948, 1197, 1546], 'stress.': [57, 311], 'We': [58, 312, 3202, 4238], 'recently': [59, 313], 'reported': [60, 314], 'induction': [63, 93, 198, 317, 347, 452, 549, 599, 1214, 1301, 1363, 1399, 1458, 3216, 3392, 3590, 3666, 3878, 3928], 'BGT1': [65, 319, 1303, 1370], 'mRNA': [66, 97, 320, 351, 1147, 1304, 1365, 1461, 3219, 3238, 3251, 3275, 3296, 3339, 3362, 3395, 3434, 3523], 'renal': [69, 323, 1126, 1287], 'epithelial': [70, 324, 1288], 'Madin-Darby': [71, 325, 890, 945], 'canine': [72, 326, 635, 683, 891, 946], 'kidney': [73, 327, 565, 892, 947], 'cell': [74, 143, 328, 397, 1289, 2261, 2382, 2788, 3003, 4268], 'line': [75, 329, 1290], 'inhibited': [77, 118, 331, 372], 'by': [78, 119, 223, 332, 373, 477, 521, 597, 1048, 1088, 1187, 1432, 1510, 1604, 1656, 1778, 1887, 2012, 2098, 2113, 2198, 2204, 2209, 2220, 2235, 2379, 2430, 2476, 2489, 2542, 2572, 2951, 2985, 3402, 3496, 3573, 3751, 3765, 3917, 4328], 'SB203580,': [79, 120, 333, 374, 1298, 3207], 'specific': [81, 335, 601, 1294, 3209, 3273, 3441], 'p38': [82, 123, 174, 224, 240, 336, 377, 428, 478, 494, 1295, 1343, 1394, 1415, 1484, 1512, 2632, 3210, 3264, 3417, 3455, 3480, 3548, 3603, 3670, 3752, 3888, 3965, 4107, 4177, 4243], 'kinase': [83, 124, 188, 189, 225, 241, 337, 378, 442, 443, 479, 495, 633, 656, 681, 878, 881, 888, 889, 923, 933, 936, 943, 944, 978, 1296, 1344, 1395, 1416, 2043, 2494, 2518, 2538, 2824, 3211, 3265, 3418, 3456, 3481, 3549, 3604, 3671, 3753, 3889, 3966, 4108, 4178, 4244], 'inhibitor.': [84, 338, 3266], 'In': [85, 339, 2088, 2224], 'these': [86, 340, 593, 1401, 3436], 'studies': [87, 341, 1353, 1407, 1447, 2757], 'we': [88, 342, 3459, 3756], 'report': [89, 343], 'hypertonic': [92, 197, 346, 451, 1216, 1362, 1398, 2817, 3215, 3391, 3589, 3665, 3721, 3927, 4166, 4236, 4316], 'HepG2': [99, 114, 150, 353, 368, 404, 1442, 1463, 1820, 2793, 2953, 3221, 3397, 3473, 3690, 4276], 'cells': [100, 115, 151, 181, 231, 354, 369, 405, 435, 485, 568, 1097, 1821, 1870, 1989, 2037, 2081, 2095, 2356, 2794, 2810, 2845, 2954, 2980, 3243, 3270, 3287, 3398, 3474, 3646, 3691, 3709, 3718], 'well': [102, 356, 801, 1473, 1862, 3785], 'element': [107, 361, 895, 950, 1199, 1548, 2735], '(ORE)-driven': [108, 362], 'reporter': [109, 204, 217, 363, 458, 471, 1439, 1469, 2091, 3468, 3493, 3530, 3570, 3592, 3681, 3697, 3762, 3862, 3912, 3931, 4128, 4198], 'gene': [110, 205, 218, 364, 459, 472, 1470, 1633, 1691, 2092, 3047, 3314, 3446, 3531, 3593, 3913, 3932], 'expression': [111, 219, 365, 473, 1466, 3427, 3462, 3532, 3595, 3642, 3759, 3863, 3909, 3971, 4123, 4140, 4193, 4210], 'transfected': [113, 367, 1872, 1903, 3692], 'both': [117, 371, 1367], 'suggesting': [121, 375, 1340, 3355], 'activation': [127, 381, 1424, 1499], 'and/or': [128, 382], 'binding': [129, 156, 209, 383, 410, 463, 1428, 1476, 1501], 'transcription': [132, 386, 1091, 1184, 1208, 1426, 1503, 2623, 4255], 'factor(s)': [133, 387], 'ORE.': [136, 215, 390, 469], 'Electrophoretic': [137, 391], 'gel': [138, 392, 2561, 2908, 2945, 3025], 'mobility': [139, 393, 1445], 'shift': [140, 394, 1446, 2909], 'assays': [141, 395], 'with': [142, 182, 396, 436, 1836, 1873, 1922, 1995, 2179, 2352, 2448, 2840, 3076, 3242, 3286, 3303, 3490, 3527, 3555, 3612, 3619, 3693, 3868, 3895, 4266], 'extracts': [144, 398, 2789, 3688, 3707, 3716, 4269, 4298, 4310], 'prepared': [145, 399, 1655, 2791], 'from': [146, 400, 1556, 1815, 2214, 2639, 2792, 3001, 3043, 3307, 3689, 3708, 3717, 4271, 4299, 4326], 'SB203580-treated,': [147, 401], 'hypertonically': [148, 179, 402, 433, 3423, 3471, 3536, 4274], 'stressed': [149, 180, 403, 434, 3269, 3472, 3537, 3645, 4275, 4301], 'further': [152, 406], 'show': [153, 407], 'trans-acting': [158, 211, 412, 465, 1478], 'factors': [159, 212, 413, 466, 1427, 1479, 1504], 'ORE': [162, 416, 1435, 1482, 1507, 1645, 1701, 1893, 2666, 2734, 2765, 3504, 3782, 3874, 4253, 4260], 'prevented': [164, 418, 4325], 'thus': [167, 421, 1975], 'also': [168, 422, 1074, 1359, 1449, 2064, 3400, 3648], 'dependent': [169, 423], 'on': [170, 424, 2249, 2555, 2655, 2876, 2941, 3213, 3639, 3678, 3969, 4121, 4191, 4248], 'activity': [172, 426, 1647, 2136, 2175, 2296, 2569, 3686], 'kinase.': [175, 429], 'Similarly,': [176, 430, 1682, 1930], 'treatment': [177, 431], 'PD098059,': [183, 437, 3403], 'mitogen-activated': [185, 439, 623, 671, 876, 885, 931, 940], 'extracellular': [186, 440, 631, 679, 879, 886, 934, 941], 'regulated': [187, 441, 632, 680, 887, 942, 1186, 1509, 3750], '(MEK1)': [190, 444], 'inhibitor,': [191, 445, 1297, 2860, 3212, 3406, 3890], 'results': [192, 446, 3581, 3610], 'inhibition': [194, 226, 229, 448, 480, 483, 3557, 3586, 3638, 3897], 'mRNA,': [202, 456], 'ORE-driven': [203, 216, 457, 470, 1468, 3464, 3528, 3640, 3679, 3695, 3860, 4126, 4137, 4196, 4207], 'expression,': [206, 460], 'was': [220, 474, 1015, 1554, 1654, 1776, 1790, 1902, 1920, 1945, 2010, 2034, 2063, 2124, 2132, 2239, 2247, 2263, 2276, 2297, 2384, 2428, 2452, 2465, 2474, 2524, 2540, 2553, 2562, 2570, 2690, 2730, 2752, 2883, 2888, 2999, 3026, 3399, 3541, 3596, 3626, 3659, 3914, 4262, 4293, 4306], 'not': [221, 475, 3348, 3388, 3915], 'affected': [222, 476, 3916], 'or': [227, 481, 1882, 1891, 2046, 2365, 2602, 2816, 2829, 2933, 2962, 2971, 3352, 3466, 3674, 3887, 3902, 4114, 4184, 4273], 'MEK1': [228, 243, 482, 497, 3405, 3420, 3485, 3637, 3675, 3886, 3968, 4115, 4185, 4246], 'incubated': [232, 486, 2178, 2530, 2875, 2903, 3244, 3288, 4265], 'iso-osmotic': [234, 488, 2961], 'media.': [235, 489, 2007, 3247, 3722], 'These': [236, 490, 1493, 3267, 3413, 4320], 'data': [237, 491, 3414, 3957], 'indicate': [238, 492, 1495, 3715, 3737], 'involved': [245, 499, 1121], 'regulation': [248, 502], 'hyperosmotic': [251, 505, 519, 1308, 2360, 2963], 'stress': [252, 506, 520, 1217, 2009], 'response.': [253, 507, 1351], 'Many': [508], 'organisms,': [509], 'including': [510, 1195], 'bacteria,': [511], 'yeast,': [512], 'plants,': [513], 'animals,': [515], 'adapt': [516], 'sustained': [518], 'preferential': [523], 'compatible': [526], '(1Yancey': [529], 'P.H.': [530], 'Clark': [531], 'M.E.': [532], 'Hand': [533], 'S.C.': [534], 'Bowlus': [535], 'R.D.': [536], 'Somero': [537], 'G.N.': [538], 'Science.': [539], '1982;': [540], '217:': [541], '1214-1222Crossref': [542], 'PubMed': [543, 585, 731, 763, 795, 837, 866, 1010, 1066, 1137, 1180, 1233, 1252, 1278, 1335, 1385, 1541, 1593, 1726, 1745, 1771, 2154, 2323, 2347, 2782, 3065, 3332, 3380, 3808, 3827, 3853], 'Scopus': [544, 586, 796, 1067, 1138, 1253, 1279, 1336, 1386, 1594, 1746, 1772, 2155, 2348, 2783, 3828, 3854], '(2953)': [545], 'Google': [546, 588, 732, 764, 798, 838, 867, 1011, 1069, 1140, 1181, 1234, 1255, 1281, 1338, 1388, 1542, 1596, 1727, 1748, 1774, 2157, 2324, 2350, 2785, 3066, 3333, 3381, 3809, 3830, 3856], 'Scholar).': [547, 589, 868, 1070, 1141, 1182, 1282, 1389, 1597, 2786, 3334, 3857], 'The': [548, 590, 1100, 1405, 1787, 1869, 1895, 1962, 1988, 2042, 2080, 2122, 2192, 2206, 2259, 2355, 2381, 2426, 2480, 2537, 2551, 2650, 2658, 2687, 2809, 2836, 2881, 2935, 2979, 3024, 3142, 3173, 3248, 3390, 3634, 3956, 4174, 4257], 'osmoprotective': [551], 'has': [553], 'been': [554], 'shown': [555, 1016, 2754], 'be': [557, 4323], 'part': [558], 'medulla': [566, 1127], 'tubular': [567], 'exposure': [570, 1095, 3229], 'hypertonicity': [572, 1350, 2761, 3231], 'during': [573, 1041, 1215], 'urinary': [574], 'concentration': [575, 2025, 2077, 3261, 3562, 3601, 3656], '(2Garcı́a-Pérez': [576, 1128], 'A.': [577, 707, 717, 743, 747, 749, 778, 791, 841, 1129, 1168, 1248, 1589, 1741, 2778, 3823], 'Burg': [578, 718, 750, 855, 1130, 1169], 'M.B.': [579, 719, 856, 1131, 1170], 'Physiol.': [580, 1132], 'Rev.': [581, 1133], '1991;': [582, 1134], '71:': [583, 1135], '1081-1115Crossref': [584, 1136], '(481)': [587, 1139], 'facilitated': [596], 'proteins': [602], 'follows:': [604, 3153], 'betaine/γ-amino-n-butyric': [605, 869, 924], 'acid': [606, 612, 660, 771, 870, 925], '(BGT1)': [608], '1The': [609, 657], 'abbreviations': [610, 658], 'BGT1betaine/γ-amino-n-butyric': [611, 659], '1SB2035804-(flurophenyl)-2-(4-methylsulfinylphenyl)-5-(4-pyridyl)': [614, 662], 'imidazolePD098059': [615, 663], '[2-(2′-amino-3′-methoxyphenyl)-oxanaphthalen-4-one]': [616, 664], 'selective': [619, 667], 'inhibitor': [620, 668, 3482, 3486, 3550, 3605, 3672, 3676, 3919, 4109, 4116, 4179, 4186], 'MEK1MAPK,': [622, 670], 'protein': [624, 672, 877, 932, 1164, 2455, 2515, 2583, 2901], 'kinaseERKextracellular': [625, 673], 'signal-regulated': [626, 674, 880, 935, 1491], 'kinasep38': [627, 675], 'kinasea': [628, 676], 'HOG1': [629, 677, 883, 938], 'homologueMEK1mitogen-activated': [630, 678], 'kinaseMDCKMadin-Darby': [634, 682], 'kidneyOREosmotic': [636, 684], 'elementTonEtonicity': [638, 686], 'enhancerARaldose': [639, 687], 'reductaseMe2SOdimethyl': [640, 688], 'sulfoxideSMITsodium-dependent': [641, 689], 'myo-inositol': [642, 690, 735, 903, 958], 'transporterbpbase': [643, 691], 'pairCATchloramphenicol': [644, 692], 'acetyltransferasekbkilobase': [645, 693], 'pairNFATnuclear': [646, 694], 'factor': [647, 695, 912, 967, 2624], 'activated': [649, 697, 914, 969, 2622], 'T': [650, 698, 915, 970], "lymphocytesDMEMDulbecco's": [651, 699], 'modified': [652, 700, 918, 973], "Eagle's": [653, 701, 919, 974], 'mediumJNKc-Jun': [654, 702], 'NH2-terminal': [655, 703, 922, 977, 2636], 'kinasefor': [704], '(3Yamauchi': [706], 'Uchida': [708, 744, 846], 'S.': [709, 745, 774, 790, 847, 1247, 1588, 1740, 1817, 2147, 2331, 2777, 3822], 'Kwon': [710, 775], 'H.M.': [711, 741, 776], 'Preston': [712, 746, 779], 'A.S.': [713, 780], 'Robey': [714], 'R.B.': [715], 'Garcı́a-Pérez': [716, 748, 1167], 'Handler': [720, 752, 783, 853], 'J.S.': [721, 753, 784, 854], 'J.': [722, 754, 828, 857, 1001, 1061, 1171, 1224, 1267, 1314, 1324, 1532, 1717, 1760, 2307, 2314, 2336, 3056, 3323, 3371, 3799, 3842], 'Biol.': [723, 755, 829, 858, 1002, 1172, 1225, 1268, 1325, 1533, 1718, 1761, 2150, 2315, 2337, 3057, 3324, 3372, 3800, 3843], 'Chem.': [724, 756, 830, 859, 1003, 1173, 1226, 1269, 1326, 1534, 1719, 1762, 2316, 2338, 3058, 3325, 3373, 3801, 3844], '1992;': [725, 757, 792], '267:': [726, 758], '649-652Abstract': [727], 'Full': [728, 760, 834, 863, 1007, 1177, 1230, 1273, 1275, 1330, 1332, 1538, 1723, 1766, 1768, 2320, 2342, 2344, 3062, 3329, 3377, 3805, 3848, 3850], 'Text': [729, 761, 835, 864, 1008, 1178, 1231, 1274, 1276, 1331, 1333, 1539, 1724, 1767, 1769, 2321, 2343, 2345, 3063, 3330, 3378, 3806, 3849, 3851], 'PDF': [730, 762, 836, 865, 1009, 1179, 1232, 1277, 1334, 1540, 1725, 1770, 2322, 2346, 3064, 3331, 3379, 3807, 3852], 'Scholar);': [733, 765], 'Na+-dependent': [734], '(SMIT)': [737], 'inositol': [739], '(4Kwon': [740], 'Yamauchi': [742, 777], 'M.': [751, 2143, 3515], '6297-6301Abstract': [759], 'taurine': [766, 772], 'amino': [770], '(5Uchida': [773], 'Marumo': [781], 'F.': [782, 1376], 'Proc.': [785, 1242, 1583, 1735, 2772, 3817], 'Natl.': [786, 1243, 1584, 1736, 2773, 3818], 'Acad.': [787, 1244, 1585, 1737, 2774, 3819], 'Sci.': [788, 1245, 1586, 1738, 2775, 3820], 'U.': [789, 1246, 1374, 1587, 1739, 1816, 2776, 3821], '89:': [793], '8230-8234Crossref': [794], '(309)': [797], 'Scholar),': [799, 1012], '(AR)': [807], 'catalyzes': [809], 'NADPH-mediated': [811], 'reduction': [812], 'aldehydes': [814], 'd-glucose': [817], '(6Bohren': [820, 993, 3048, 3315, 3363], 'K.M.': [821, 994, 1221, 1239, 1529, 1580, 1714, 1732, 2769, 3049, 3316, 3364, 3796, 3814], 'Bullock': [822, 995, 3050, 3317, 3365], 'B.': [823, 825, 843, 996, 998, 1237, 1260, 1578, 1730, 1753, 2767, 3051, 3053, 3318, 3320, 3366, 3368, 3812, 3835], 'Wermuth': [824, 997, 3052, 3319, 3367], 'Gabbay': [826, 999, 1222, 1240, 1263, 1530, 1581, 1715, 1733, 1756, 2770, 3054, 3321, 3369, 3797, 3815, 3838], 'K.H.': [827, 1000, 1058, 1223, 1241, 1262, 1264, 1531, 1582, 1716, 1734, 1755, 1757, 2771, 3055, 3322, 3370, 3798, 3816, 3837, 3839], '1989;': [831, 860, 1004, 1174, 3059, 3326, 3374], '264:': [832, 861, 1005, 1175, 3060, 3327, 3375], '9547-9551Abstract': [833, 1006, 3061, 3328, 3376], 'Scholar,': [839, 1235, 1256, 1728, 1749, 2325, 3810, 3831], '7Garcı́a-Pérez': [840], 'Martin': [842], 'Murphy': [844], 'H.R.': [845], 'Murer': [848], 'H.': [849, 2329, 3511], 'Cowley': [850], 'Jr.,': [851], 'B.D.': [852], '16815-16821Abstract': [862], '1': [872, 927, 2185, 2409, 2419, 2423, 2861, 4287, 4305], '4-(flurophenyl)-2-(4-methylsulfinylphenyl)-5-(4-pyridyl)': [873, 928], 'imidazole': [874, 929], 'MAPK,': [875, 930], 'homologue': [884, 939], 'tonicity': [896, 951], 'enhancer': [897, 952, 1646, 1702, 3577], 'dimethyl': [900, 955], 'sulfoxide': [901, 956], 'sodium-dependent': [902, 957], 'base': [905, 960, 2726], 'pair': [906, 910, 961, 965], 'chloramphenicol': [907, 962, 2194], 'acetyltransferase': [908, 963], 'kilobase': [909, 964], 'nuclear': [911, 966], 'lymphocytes': [916, 971], "Dulbecco's": [917, 972], 'medium': [920, 975, 1834, 2964], 'c-Jun': [921, 976, 2640], 'AR': [979, 1093, 1146, 1163, 1183, 1460, 1558, 1690, 1709, 3038, 3046, 3218, 3237, 3274, 3313, 3394, 3433, 3445, 3791, 3970], 'high': [982, 3147], 'K': [983], 'm': [984, 3109], '(30–80': [985], 'mm)': [986], 'other': [991, 1418, 1704], 'sugars': [992], 'it': [1014, 1072], 'play': [1018], 'major': [1020], 'role': [1021, 1392, 1413], 'pathogenesis': [1024], 'variety': [1027], 'diabetic': [1029], 'complications': [1030], 'via': [1031], 'an': [1032, 1103, 1196, 1683, 2250], 'increased': [1033, 1049], 'flux': [1034], 'through': [1037], 'pathway': [1040, 1045, 1345], 'hyperglycemia,': [1042], 'i.e.': [1043], 'driven': [1047, 1886, 3495, 3572, 3764], 'availability': [1052], 'leading': [1053], '(8Gabbay': [1057], 'N.': [1059], 'Engl.': [1060], 'Med.': [1062], '1973;': [1063], '288:': [1064], '831-836Crossref': [1065], '(604)': [1068], 'However,': [1071, 1390, 3907], 'possible': [1075, 1423], 'accumulate': [1077], 'large': [1078], 'amounts': [1079, 3011], 'at': [1083, 1109, 1202, 1824, 1904, 2117, 2256, 2432, 2534, 2544, 2892, 2946, 2955, 2987, 2994, 3097, 3149, 3407, 3558, 3598, 3898], 'normal': [1084, 1110], 'blood': [1085, 1111], 'levels': [1087, 3239], 'increasing': [1089], 'upon': [1094], 'hypertonicity.': [1099], 'result': [1101], 'enzyme-driven': [1104], 'levels,': [1113], 'one': [1116, 3766], 'several': [1118], 'redundant': [1119], 'mechanisms': [1120], 'osmoregulation': [1123], 'increases': [1143, 3859], 'synthesis': [1144], '15-fold': [1148, 3234, 4314], '24': [1150, 1867, 2003], 'h': [1151, 1994, 2004, 2086, 2975, 3227], 'without': [1152, 2967], 'detectable': [1154], 'change': [1155], 'rate': [1158], 'degradation': [1160], '(9Moriyama': [1165], 'T.': [1166, 2313, 2327], '16810-16814Abstract': [1176], 'promoter': [1189, 1559, 1568, 1628, 1680, 1710, 3426, 3447, 3792], 'contains': [1191, 3501, 3780], 'diverse': [1192], 'regulatory': [1193, 3452, 3962], 'elements': [1194, 1706], '(ORE)': [1200, 1549], 'present': [1201], '1235': [1203], 'bp': [1204, 3943], 'upstream': [1205, 1629], 'start': [1209], 'site,': [1210], 'its': [1213, 1551, 1667], '(10Wang': [1218, 1526, 1711, 3793], 'K.': [1219, 1527, 1712, 3510, 3514, 3794], 'Bohren': [1220, 1238, 1261, 1528, 1579, 1713, 1731, 1754, 2768, 3795, 3813, 3836], '1993;': [1227, 1535, 1720, 3802], '268:': [1228, 1536, 1721, 3803], '16052-16058Abstract': [1229, 1537, 1722, 3804], '11Ruepp': [1236, 1729, 3811], '1996;': [1249, 1590, 1742, 2779, 3824], '93:': [1250, 1591, 1743, 2780, 3825], '8624-8629Crossref': [1251, 1592, 1744, 2781, 3826], '(73)': [1254, 1595, 1747, 2784, 3829], '12Ko': [1257, 1750, 3832], 'B.C.B.': [1258, 1751, 3833], 'Ruepp': [1259, 1752, 3834], 'Chung': [1265, 1758, 3840], 'S.S.M.': [1266, 1759, 3841], '1997;': [1270, 1763, 3845], '272:': [1271, 1764, 3846], '16431-16437Abstract': [1272, 1765, 3847], '(188)': [1280, 1773, 3855], 'Studies': [1283], 'MDCK': [1286], 'showed': [1291, 1356, 3579], 'blocked': [1299, 1360], 'media': [1309, 2818], '(13Sheikh-Hamad': [1310], 'D.': [1311, 1323, 1378], 'Di': [1312], 'Mari': [1313], 'Suki': [1315], 'W.N.': [1316], 'Safirstein': [1317], 'R.': [1318], 'Watts': [1319], 'III,': [1320], 'B.A.': [1321], 'Rouse': [1322], '1998;': [1327, 1382], '273:': [1328], '1832-1837Abstract': [1329], '(163)': [1337], 'Scholar)': [1339, 1543, 1775, 2158, 2351, 3067, 3382], 'essential': [1347], 'Additional': [1352], 'monocytes': [1355], 'SB203580': [1358, 2045, 2828, 2970, 3901], 'SMIT': [1368], '(14Denkert': [1371], 'C.': [1372], 'Warskulat': [1373], 'Hensel': [1375], 'Haussinger': [1377], 'Arch.': [1379], 'Biochem.': [1380], 'Biophys.': [1381], '354:': [1383], '172-180Crossref': [1384], '(78)': [1387], 'remains': [1403], 'unknown.': [1404], 'current': [1406], 'were': [1408, 1448, 1805, 1822, 1856, 1871, 1980, 1990, 2049, 2082, 2096, 2176, 2196, 2211, 2357, 2482, 2669, 2674, 2709, 2743, 2790, 2811, 2838, 2846, 2902, 2938, 2958, 2981, 3016, 3074, 3091, 3144, 3175, 3181, 3198, 3301, 3647, 3699, 3952, 4282], 'undertaken': [1409], 'define': [1411, 3746], 'signal': [1419], 'cascades': [1420], 'ORE,': [1431, 1664, 3775], 'transfection': [1433, 1928, 1951, 2756], 'plasmid': [1436], 'constructs': [1437, 1804, 3469, 3938, 4129, 4199], 'containing': [1438, 1544, 1638, 1662, 2172, 2520, 2663, 2819, 2896, 2919, 3103, 3383], 'into': [1441, 1564, 1620, 1677, 1792, 1858, 2373, 2796], 'cells.': [1443, 3222, 3437, 3538, 4277], 'Gel': [1444], 'performed': [1450], 'determine': [1452, 3439], 'specificity': [1454], 'responses.': [1456], 'Hypertonic': [1457, 2008], 'cells,': [1464, 4302], 'products,': [1471], 'kinase-': [1485, 1513], 'MEK1-dependent,': [1487], 'yet': [1488], 'ERK': [1489, 2473], '(extracellular': [1490], 'kinase)-independent.': [1492], 'findings': [1494, 3524], 'hypertonicity-induced': [1498, 3961], 'MEK1-signaling': [1515], 'pathways.': [1516], 'A': [1517, 1635, 1909, 3653], '132-bp': [1518, 1892, 3498, 3576, 3694, 3777], 'fragment': [1519, 1619, 1661, 1789, 4261], '(GenBankTM': [1520, 1648, 1692], 'accession': [1521, 1649, 1693], 'number': [1522, 1650, 1694], 'L14440,': [1523, 1651, 1695], 'nucleotides': [1524, 1652, 1696], '2032–2163)': [1525], 'surrounding': [1552, 3506], 'sequence': [1553, 1642, 1810, 3499, 3507, 3578], 'excised': [1555, 2213], 'construct': [1560, 1637, 1901, 3494, 3571, 3682, 3698], 'pARP4.2': [1561], 'inserted': [1563, 1676, 1791], 'pCAT': [1566, 1879], 'SV40': [1567, 1627], 'vector': [1569, 1623, 1636, 1796, 1900, 1913], '(Promega)': [1570, 2238], 'usingBamHI/PstI': [1571], 'cloning': [1572], 'sites': [1573, 1603, 3442], 'described': [1575, 2300, 2370, 2977], 'previously': [1576, 2301, 2753], '(11Ruepp': [1577, 2766], 'Introduction': [1598], 'SacI': [1600, 1673], 'NheI': [1602], 'polymerase': [1605, 1779, 2678], 'chain': [1606, 1780], 'reaction': [1607, 1781, 2539, 2651, 2936], 'using': [1608, 1782, 1797, 1982, 2159, 2288, 2676, 2692, 2715, 3005, 3183, 3567], 'primers': [1609, 1783], '5′-TGGTTTGTCCGAGCTCATCAATGTATCTTATC': [1610], '5′-CAGGAAACAGCTAGCACCATGATTACGCCA,': [1612], 'respectively,': [1613], 'allowed': [1614, 1999], 'ligation': [1616], 'this': [1618, 3357], 'pGL3-promoter': [1622], 'carries': [1625], 'luciferase': [1632, 1912, 1973, 2135, 2174, 2227, 2281, 3467, 3569, 3614, 3624, 3641, 3680, 3685, 3696, 3704, 3761, 3861, 4127, 4139, 4145, 4197, 4209, 4215], '(Promega).': [1634, 2294], 'minimal': [1640, 2665], '12-bp': [1641, 3773, 3873, 4259], 'necessary': [1643], '2110–2121)': [1653], 'annealing': [1657], 'synthetic': [1659], 'oligonucleotide': [1660], '5′-gagctcTGGAAAATCACCgctagc': [1665], 'reverse': [1668], 'complement,': [1669], 'flanked': [1670], 'byNheI': [1671], 'sites,': [1674], 'pGL3': [1679, 1794, 1883, 1898], 'vector.': [1681], 'insert': [1684], 'spanning': [1685], '1.5': [1686], 'kb': [1687, 3940], '1801–3300)': [1697], 'includes': [1699], 'identified': [1705], 'amplified': [1777], '5′-TTTAGGCTCGAGTTCAAATTCTATTACTTGG': [1784], '5′-CCATGGAAGCTTCGCTCCCCAGACCCC.': [1786], 'resulting': [1788, 2260], 'basic': [1795, 1899, 2514, 2582, 3503, 3774, 4258], 'XhoI': [1798], 'HindIII': [1800], 'restriction': [1801], 'sites.': [1802], 'All': [1803], 'sequenced': [1806], 'verify': [1808], 'orientation': [1812], '(sequencing': [1813], 'kit': [1814, 2293], 'Biochemical': [1818], 'Corp.).': [1819], 'grown': [1823, 1865, 2800], '37': [1825, 2120], '°C': [1826, 2948, 3099, 3151], '5%': [1828], 'CO2': [1829], 'DMEM': [1831, 2020, 2033, 2803], 'low': [1832], 'supplemented': [1835], '10%': [1837, 2417, 2656, 2917, 3139], 'fetal': [1838], 'calf': [1839], 'serum,': [1840], '1%': [1841, 2404, 3019], 'penicillin/streptomycin,': [1842], '2': [1844, 1874, 2401, 2413, 2506, 2549, 2625, 4289, 4292], 'mm': [1845, 2028, 2186, 2394, 2399, 2402, 2410, 2414, 2497, 2504, 2507, 2510, 2912, 2915, 3134], 'glutamine': [1846], '(Life': [1847], 'Technologies,': [1848], 'Inc.).': [1849], 'Cells': [1850], '(0.25': [1851], '×': [1852, 2434, 2546, 2989], '106,': [1853], 'passages': [1854], '30–40)': [1855], 'seeded': [1857, 2795], '24-well': [1859], 'plates': [1860, 2837], '(16-mm': [1861], 'diameter)': [1863], 'h.': [1868, 2835], 'μg': [1875, 1906, 1917, 1937, 2462, 2898], 'DNA/well': [1877], '(chloramphenicol': [1880], 'acetyltransferase)': [1881], '(luciferase)': [1884], 'vectors,': [1885], 'either': [1888, 3885, 3918], '12-': [1890], 'constructs.': [1894], '1.5-kb': [1896, 3789], 'promoter-driven': [1897], '4': [1905, 2947, 2995], 'DNA/well.': [1908], 'control': [1910, 1932, 1949, 3453, 3702, 4143, 4213], 'firefly': [1911, 1960, 2280, 4138, 4208], 'pRSVL': [1914], '(Promega,': [1915, 1935], '0.2': [1916, 1936], 'DNA/well)': [1919, 1939], 'cotransfected': [1921], 'ORE-pCAT': [1923], 'plasmids': [1924], 'correct': [1926], 'efficiency.': [1929], 'plasmid,': [1933], 'pRLTK': [1934], 'expresses': [1941], 'Renilla': [1943, 3703, 4144, 4214], 'luciferase,': [1944], 'used': [1946, 2595, 2609, 2617, 2627, 2645, 2746, 3627], 'efficiency': [1952], 'ORE-pGL3': [1955], 'plasmids,': [1956], 'express': [1958, 3271], 'luciferase.': [1961], 'two': [1963, 3272], 'luciferases': [1964], 'exhibit': [1965], 'luminescence': [1966], 'under': [1967, 3146, 3450, 3920, 4315], 'different': [1968], 'conditions': [1969, 2361, 4317], 'dual': [1972, 2226], 'assay,': [1974, 3622], 'allowing': [1976], 'independent': [1977, 3729, 4155, 4225], 'quantitation.': [1978], 'Transfections': [1979], 'done': [1981], 'calcium': [1984], 'phosphate': [1985, 2104, 2190], 'precipitation': [1986], 'method.': [1987], 'shocked': [1991], 'after': [1992, 2084], '6': [1993, 3351], '15%': [1996, 2557], 'glycerol': [1997], 'recover': [2001], 'regular': [2006, 2019, 2802], 'induced': [2011, 3424], 'addition': [2014], '5m': [2016], 'NaCl': [2017, 2029], 'make': [2022], 'final': [2024], '220': [2027], '(515': [2030], 'mosmol/kg).': [2031], 'Regular': [2032], 'added': [2035, 2050, 2065, 2240, 2467, 2525], 'exposed': [2038, 2358, 2813, 2959, 3710, 3719], 'iso-smotic': [2040], 'conditions.': [2041, 3922], 'inhibitors': [2044, 2368, 2825, 3951, 4247], 'PD098059': [2047, 3658, 3905], '(Calbiochem)': [2048], '10': [2052, 2127, 2437, 2830, 2968, 3133, 3409, 3899], 'μl': [2053, 2102, 2128, 2272], 'Me2SO': [2055, 2062], '(Sigma)': [2056, 2188, 2516], 'achieve': [2058], 'desired': [2060], 'concentrations.': [2061], 'controls': [2068], 'ensure': [2070], 'all': [2072, 4309], 'wells': [2073], 'had': [2074], 'same': [2076, 3575], 'Me2SO.': [2079], 'harvested': [2083, 2097, 2378], '16': [2085, 2834, 2974, 3226], 'incubation.': [2087], 'CAT': [2090, 3465, 3492, 3529, 3621, 3987], 'assays,': [2093, 2590], 'scraping': [2099], '200': [2101], 'buffer': [2105, 2231, 2495, 2519, 2852, 2910], '(0.1m': [2106], 'potassium': [2107], 'phosphate,': [2108], 'pH': [2109, 2396, 2499, 3114, 3136], '7.9)': [2110], 'lysed': [2112, 2385], '3': [2114, 2484, 2490, 2701, 3651], 'freeze-thaw': [2115], 'cycles': [2116], '−80': [2118], '°C.': [2121, 2536, 2894, 2996], 'lysate': [2123, 2262, 2460, 2882], 'centrifuged,': [2125, 2269, 2884], 'supernatant': [2131, 2275, 2427, 2552, 2652, 2887], 'analyzed': [2133, 2277], '(15de': [2137], 'Wet': [2138], 'J.R.': [2139, 2309], 'Wood': [2140], 'K.V.': [2141], 'DeLuca': [2142], 'Helinski': [2144], 'D.R.': [2145], 'Subramani': [2146], 'Mol.': [2148], 'Cell.': [2149], '1987;': [2151], '7:': [2152], '725-737Crossref': [2153], '(2466)': [2156], 'Monolight': [2161, 2285], '2010': [2162, 2286], 'luminometer': [2163, 2287], '(Analytical': [2164], 'Luminescence': [2165], 'Laboratory,': [2166], 'Sparks,': [2167], 'MD).': [2168], 'Extracts': [2169], '(2–50': [2170], 'μl)': [2171, 2233], 'equal': [2173, 3278], 'then': [2177, 2212, 2466, 2812, 2939], '[14C]chloramphenicol': [2180], '(Amersham': [2181], 'Pharmacia': [2182], 'Biotech)': [2183], 'acetyl-CoA': [2187], 'buffer.': [2191], 'acetylated': [2193], 'products': [2195, 2937], 'separated': [2197, 2940], 'thin': [2199], 'layer': [2200], 'chromatography': [2201, 2216], 'visualized': [2203, 2208, 2950], 'autoradiography.': [2205, 2952], 'bands': [2207], 'autoradiography': [2210], 'plate': [2217, 2246], 'quantitated': [2219, 3182], 'liquid': [2221], 'scintillation': [2222], 'counting.': [2223], 'transfections,': [2228], 'passive': [2229], 'lysis': [2230], '(200': [2232], 'supplied': [2234], 'manufacturer': [2237], 'each': [2242], 'well,': [2243], 'shaken': [2248], 'orbital': [2251], 'shaker': [2252], '30': [2254, 2535, 2879, 2905, 3161, 3171], 'min': [2255, 2533, 2906, 2993], 'room': [2257], 'temperature.': [2258], 'collected': [2264, 2429, 2849], 'amber': [2266], 'tubes': [2267], '2–5': [2271], 'forRenilla': [2278], 'activities': [2282], 'Dual': [2290], 'Luciferase': [2291], 'Assay': [2292], 'MAPK': [2295], 'determined': [2298, 2571], '(16Pombo': [2302], 'C.M.': [2303], 'Bonventre': [2304], 'J.V.': [2305], 'Avruch': [2306], 'Woodgett': [2308], 'Kyriakis': [2310], 'J.M.': [2311], 'Force': [2312], '1994;': [2317], '269:': [2318], '26546-26551Abstract': [2319], '17Moriguchi': [2326], 'Kawasaki': [2328], 'Matsuda': [2330], 'Gotoh': [2332], 'Y.': [2333], 'Nishida': [2334], 'E.': [2335], '1995;': [2339], '270:': [2340], '12969-12972Abstract': [2341], '(122)': [2349], 'slight': [2353], 'modifications.': [2354], 'presence': [2364, 3256, 3477, 3545, 3883], 'absence': [2366], 'above,': [2371], 'scraped': [2372, 2847, 2982], 'experimental': [2375], 'medium,': [2376], 'centrifugation.': [2380], 'pellet': [2383, 3004], 'Triton': [2387, 2405], 'Lysis': [2388], 'Buffer': [2389], '(TLB)': [2390], 'consisting': [2391], '20': [2393, 2532], 'Tris,': [2395, 2913, 3135], '7.4,': [2397, 2500], '137': [2398], 'NaCl,': [2400, 2916, 3110], 'EDTA,': [2403], 'X-100,': [2406], '25': [2407, 2501, 2503, 2521, 3560], 'mmβ-glycerophosphate,': [2408, 2502], 'sodium': [2411, 2415, 2511], 'orthovanadate,': [2412], 'pyrophosphate,': [2416], 'glycerol,': [2418], 'mmphenylmethylsulfonyl': [2420, 2862], 'fluoride,': [2421, 2863], 'μg/ml': [2424, 2857, 3129], 'leupeptin.': [2425], 'centrifugation': [2431, 2543, 2986], '15,000': [2433], 'g': [2435, 2547, 2990], 'min.': [2438, 2550, 2880, 3172], 'Anti-ERK': [2439], 'antibody': [2440, 2446], '(Upstate': [2441], 'Biotechnology': [2442], 'Inc.': [2443], 'NY;': [2444], 'cross-reacts': [2447], 'ERK1': [2449, 2566], 'ERK2)': [2451], 'bound': [2453], 'A-': [2456], 'G-agarose.': [2458], 'Cell': [2459], '(100': [2461], 'protein)': [2464], 'agarose': [2470], 'beads,': [2471], 'precipitated': [2475], 'antibody-agarose': [2478], 'complex.': [2479], 'beads': [2481, 2528], 'washed': [2483, 2839, 3145], 'times': [2485], 'TLB,': [2487], 'followed': [2488], 'additional': [2491], 'washes': [2492], '(25': [2496], 'Hepes,': [2498], 'MgCl2,': [2505], 'dithiothreitol,': [2508], '0.1': [2509], 'vanadate).': [2512], 'Myelin': [2513], 'μm': [2522, 2827, 2831, 2865, 2869, 2969, 3260, 3561, 3655, 3900, 3904], '[α-32P]dATP': [2523, 2684], 'stopped': [2541], '12,000': [2545], 'resolved': [2554, 2654], 'SDS-PAGE,': [2558], 'dried': [2563], 'autoradiographed.': [2565], '-2': [2568], 'extent': [2574], 'incorporation': [2576], '32P': [2578], 'myelin': [2581], 'substrate.': [2584], 'For': [2585, 2720], 'JNK1,': [2586], 'p38,': [2587], 'p38β': [2589], 'above': [2592], 'procedure': [2593], 'except': [2596], 'following:': [2599], 'anti-p38,': [2600], 'anti-p38β,': [2601], 'anti-JNK1': [2603], 'antibodies': [2604], '(Santa': [2605, 2641], 'Cruz,': [2606], 'CA)': [2607, 2615], 'immunoprecipitation,': [2611], 'Pansorbin': [2613], '(Calbiochem,': [2614], 'immobilize': [2619], 'antibodies;': [2621], 'substrate': [2629, 2647], 'kinases,': [2633], 'whereas': [2634, 4303], 'peptide-(1–79)': [2637], 'derived': [2638, 3306, 4270], 'Cruz': [2642], 'Biotechnology)': [2643], 'JNK1.': [2649], 'SDS-PAGE.': [2657], 'oligonucleotides': [2659, 2738], '5′-GTGAAGCACCAAATGGAAAATCACCGGCATGGAGT': [2660], '5′-GTGACTCCATGCCGGTGATTTTCCATTTGGTGCTT': [2662], '(in': [2667], 'bold)': [2668, 2729], 'annealed,': [2670], '5′-overhangs': [2673], 'labeled': [2675, 2688, 3075], 'Klenow': [2677], '(Roche': [2679], 'Molecular': [2680, 3084], 'Biochemicals),': [2681], '[α-32P]dCTP,': [2682], '(ICN': [2685], 'Radiochemicals).': [2686], 'probe': [2689, 2921, 3346], 'purified': [2691], 'Select': [2694], 'G-25': [2695], 'spin': [2696], 'column': [2697], '(5': [2698, 4001, 4013, 4043, 4097], 'Prime': [2699], '→': [2700], 'Prime,': [2702], 'Inc.,': [2703], 'Boulder,': [2704], 'CO).': [2705], 'Specific': [2706], 'competitor': [2707, 2930], 'fragments': [2708], 'generated': [2710], 'similar': [2713, 3580, 3649, 3953], 'fashion': [2714], 'non-radioactive': [2716], 'α-dCTP': [2717], 'α-dATP.': [2719], 'nonspecific': [2722], 'competitor,': [2723], 'single': [2725, 2749], '(underlined': [2727], 'changed': [2731], 'yield': [2737], '5′-AAGCACCAAATAGAAAATCACCGGCATGGAGT': [2739], '5′ACTCCATGCCGGTGATTTTCTATTTGGTGCTT': [2741], 'annealed': [2744], 'directly.': [2747], 'This': [2748, 3539, 3877], 'nucleotide': [2750], 'mutation': [2751], 'abolish': [2759], 'Whole': [2787], '10-cm': [2797], 'dishes': [2798], 'until': [2804], 'they': [2805], 'reached': [2806], '90%': [2807, 2956], 'confluency.': [2808], 'isotonic': [2815, 3246, 3290, 3712, 3921, 4163, 4233, 4272], 'appropriate': [2821], 'concentrations': [2822], '(10': [2826, 2911, 3606, 4055], 'PD098059)': [2832, 2972], 'phosphate-buffered': [2841, 2872], 'saline,': [2842], 'extraction': [2851], '(1%': [2853], 'Nonidet': [2854], 'P-40,': [2855], '5': [2856, 2897, 2992, 3259, 3654, 3903], 'soybean': [2858], 'trypsin': [2859], '100': [2864, 2868, 2924], 'leupeptin,': [2866], 'benzamidine': [2870], 'saline)': [2873], 'ice': [2877], 'stored': [2889], 'aliquots': [2891], '−70': [2893], 'Aliquots': [2895], 'total': [2900], '50': [2914], 'glycerol)': [2918], 'radiolabeled': [2920, 4263], '(50,000': [2922], 'cpm),': [2923], 'ng': [2925], 'poly(dI/dC)': [2927], 'cold': [2929], '(0,': [2931], '10,': [2932], '50×).': [2934], '4%': [2943], 'acrylamide': [2944], 'confluency': [2957], '(with': [2965], 'above.': [2978], 'pelleted': [2984], '5000': [2988], 'Total': [2997], 'RNA': [2998, 3013], 'isolated': [3000], 'RNAzol': [3006], '(Tel-Test,': [3007], 'Friendswood,': [3008], 'TX).': [3009], 'Equal': [3010], 'per': [3014], 'lane': [3015], 'loaded': [3017], 'onto': [3018], 'agarose,': [3020], '2.2': [3021], 'mformaldehyde': [3022], 'gel.': [3023], 'electrophoresed': [3027], 'transferred': [3029], 'GeneScreen': [3031], 'membrane': [3032], '(NEN': [3033], 'Life': [3034], 'Science': [3035, 3190], 'Products).': [3036], 'Human': [3037], 'cDNA': [3039, 3072], 'introns': [3041, 3308, 3350], '6–8': [3042, 3309], 'human': [3045, 3069, 3312, 3790], 'full-length': [3070], 'β-actin': [3071], '(CLONTECH)': [3073], '[α-32P]dCTP': [3077], '(Random': [3078], 'Primed': [3079], 'DNA': [3080], 'Labeling': [3081], 'Kit,': [3082], 'Roche': [3083], 'Biochemicals)': [3085], 'use': [3087], 'probes.': [3089], 'Probes': [3090], 'hybridized': [3092, 3302, 3341], 'blots': [3095, 3143, 3174, 3300], 'overnight': [3096], '42': [3098], 'solution': [3102, 3118], '40%': [3104], 'formamide,': [3105], '5×': [3106, 3116], 'SSC': [3107], '(0.75': [3108], '75': [3111], 'mmtrisodium': [3112], 'citrate,': [3113], '7),': [3115], "Denhardt's": [3117], '(0.5%': [3119], '(w/v)': [3120, 3123], 'polyvinylpyrrolidone,': [3121], '0.5%': [3122, 3126, 3158, 3168], 'Ficoll': [3124], '400),': [3125], 'SDS,': [3127], '250': [3128], 'salmon': [3130], 'sperm': [3131], 'DNA,': [3132], '7.5,': [3137], 'dextran': [3140], 'sulfate.': [3141], 'stringency': [3148], '65': [3150], 'twice': [3154, 3164], '3×': [3156], 'SSC,': [3157, 3167], 'SDS': [3159, 3169], 'min,': [3162], '0.3×': [3166], 'autoradiographed,': [3176], 'relative': [3178, 4141, 4211], 'band': [3179, 3196, 3358], 'intensities': [3180, 3197], 'Image': [3184, 3741], 'Tool': [3185], '(University': [3186], 'Texas': [3188], 'Health': [3189], 'Center,': [3191], 'San': [3192], 'Antonio)': [3193], 'software.': [3194], 'Relative': [3195], 'normalized': [3199, 3700], 'β-actin.': [3201], 'examined': [3203, 3460, 3757, 4239], 'effects': [3205, 3635, 3948, 3963, 4241], 'Fig.': [3223], '1shows': [3224], 'increase': [3235, 3249], 'comparison': [3241], 'attenuated': [3253, 3401, 3542, 3880], 'osmotically': [3268, 3644, 4300], 'species': [3276, 3340], 'abundance': [3279], '(1.5': [3280, 3939], '2.5': [3282], 'kb)': [3283], 'compared': [3285], 'media,': [3291, 3713], 'where': [3292], 'only': [3293], 'smaller': [3295], 'detected.': [3298], 'Northern': [3299], 'genomic': [3304], 'probes': [3305], 'Only': [3335], 'larger': [3337], '2.5-kb': [3338], 'intron': [3344, 3384], '7': [3345, 3385], 'but': [3347], '8': [3353], 'probes,': [3354], 'represents': [3359], 'incompletely': [3360], 'processed': [3361], 'sequences': [3386], '(data': [3387], 'shown).': [3389], 'μmconcentration': [3410], '(Fig.': [3411, 3525, 3563, 3650, 4318], '1).': [3412], 'suggest': [3415, 3958], 'regulate': [3421], 'native': [3425, 3432], 'level': [3430], 'To': [3438, 3745], 'MEK1,': [3458, 3755], '(SB203580)': [3483], '(PD098059).': [3487], 'Transfection': [3488, 3565], 'experiments': [3489, 3566], '2V.': [3508], 'Nadkarni,': [3509], 'Gabbay,': [3512], 'Bohren,': [3516], 'manuscript': [3518], 'preparation.': [3520], 'paralleled': [3521], '2),': [3526], 'rising': [3533], '5-fold': [3534], 'dose-dependent': [3553, 3893], 'manner': [3554], 'complete': [3556, 3585, 3896], '2).': [3564], '(Fig.3': [3582], 'A),': [3583], 'albeit': [3584], 'product': [3594, 3933], 'achieved': [3597], 'lower': [3600], 'μm).': [3607], 'Since': [3608], 'obtained': [3611, 3618], 'assay': [3615, 3625], 'confirmed': [3616], 'those': [3617], 'remainder': [3630], 'studies.': [3633], 'B).': [3652], 'sufficient': [3660], 'inhibit': [3662], 'completely': [3663], 'response.Figure': [3667], '3Effect': [3668], '(A)': [3673], '(B)': [3677], 'expression.': [3683], 'Firefly': [3684], 'activity.': [3705], 'Boxesindicate': [3706], 'andtriangles': [3714], 'Values': [3723, 4132, 4202], 'represent': [3724, 4133, 4203], 'mean': [3726, 4152, 4222], 'six': [3728, 4154, 4224], 'transfections': [3730, 4156, 4226], 'three': [3732, 4159, 4229], 'separate': [3733, 4160, 4230], 'experiments.': [3734, 4161, 4231], 'Error': [3735], 'bars': [3736], '±': [3738, 3991, 3993, 3995, 3997, 4003, 4005, 4007, 4009, 4015, 4017, 4019, 4021, 4023, 4025, 4027, 4033, 4035, 4037, 4039, 4045, 4047, 4049, 4051, 4057, 4059, 4061, 4063, 4069, 4071, 4073, 4079, 4081, 4083, 4089, 4091, 4093, 4099, 4101, 4103], 'S.D.View': [3739], 'Large': [3740], 'Figure': [3742], 'ViewerDownload': [3743], '(PPT)': [3744], 'better': [3747], 'cis-elements': [3749], 'constructs,': [3763], 'following': [3769], 'enhancer/promoter': [3770], 'constructs:': [3771], 'TGGAAAATCACC;': [3776], 'sequence,': [3778], 'complex': [3783, 4286, 4304], 'full': [3788], '5.9-,': [3864], '4.7-,': [3865], '1.6-fold': [3867], '1.5-kb,': [3870], '132-,': [3871], 'sequences,': [3875], 'respectively.': [3876], 'manner,': [3894], '(TableI).': [3906], 'Although': [3923], 'magnitude': [3925], 'differed': [3934], 'among': [3935], 'various': [3937, 4125, 4195], '>': [3941, 3944], '132': [3942], '12': [3945], 'bp),': [3946], '(Table': [3954], 'I).': [3955], 'ORE-specific.Table': [3973], 'I1.5-kb': [3974], 'PGL3': [3975, 3979, 3983], '(n': [3976, 3980, 3984, 3988], '=': [3977, 3981, 3985, 3989], '6)H/I132-bp': [3978, 3986], '6)H/I12-bp': [3982], '3)H/II116': [3990], '1048': [3992], '653': [3994, 4018], '51293': [3996], '158I': [3998], '+': [3999, 4011, 4029, 4041, 4053, 4065, 4075, 4085, 4095], 'SB': [4000, 4030, 4042, 4054], 'μm)91': [4002], '558': [4004], '762': [4006], '5808': [4008], '94I': [4010], 'PD': [4012, 4066, 4076, 4086, 4096], 'μm)93': [4014], '563': [4016], '6H684': [4020], '385.9226': [4022], '74.783': [4024], '51.67517': [4026], '1545.8H': [4028], '(1': [4031, 4077], 'μm)552': [4032], '274.7145': [4034], '92.578': [4036], '31.38550': [4038], '736.6H': [4040], 'μm)260': [4044], '292.191': [4046], '81.662': [4048], '51.04600': [4050], '5275.7H': [4052], 'μm)55': [4056, 4098], '60.652': [4058], '110.952': [4060], '30.81551': [4062], '351.9H': [4064], '(0.5': [4067], 'μm)579': [4068], '265.0149': [4070], '113.181': [4072], '31.5H': [4074], 'μm)392': [4078], '134.2129': [4080], '52.074': [4082], '41.4H': [4084], '(3': [4087], 'μm)267': [4088], '242.986': [4090], '41.459': [4092], '31.1H': [4094], '50.560': [4100], '31.046': [4102], '0.20.9The': [4104], 'effect': [4105, 4175], '(SB203580,': [4110, 4180], 'abbreviated': [4111, 4118, 4181, 4188], 'SB)': [4113, 4183], '(PD098059,': [4117, 4187], 'PD)': [4120, 4190], 'shown.': [4131, 4201], 'ratio': [4135, 4205], '(see': [4146, 4216], '"Experimental': [4147, 4217], 'Procedures")': [4148, 4218], '(±S.E.)': [4157, 4227], 'I,': [4162, 4232], 'medium;': [4164, 4234], 'H,': [4165, 4235], 'medium.': [4167, 4237], 'Open': [4168], 'table': [4169], 'new': [4172], 'tab': [4173], 'interaction': [4250], 'between': [4251], 'factors.': [4256], 'whole': [4267], 'prominent': [4279], 'DNA-protein': [4280], 'complexes': [4281, 4321], 'observed,': [4283], 'designated': [4284], '(Fig.4).': [4290], 'Complex': [4291], 'seen': [4294], 'most': [4295], 'prominently': [4296], 'observed': [4307], 'intensified': [4313], '4).': [4319], 'can': [4322], 'competitively': [4324], 'forming': [4327]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W2009184278', 'counts_by_year': [{'year': 2020, 'cited_by_count': 1}, {'year': 2017, 'cited_by_count': 1}, {'year': 2016, 'cited_by_count': 3}, {'year': 2015, 'cited_by_count': 3}, {'year': 2014, 'cited_by_count': 1}, {'year': 2013, 'cited_by_count': 1}, {'year': 2012, 'cited_by_count': 2}], 'updated_date': '2025-01-07T03:29:01.077046', 'created_date': '2016-06-24'}