The Copper-transporting ATPases, Menkes and Wilson Disease Proteins, Have Distinct Roles in Adult and Developing Cerebellum

Name: Work Video:
Duration: 3 min 30 s
Natalie Barnes; Ruslan Tsivkovskii; Natalia O. Tsivkovskaia; Svetlana Lutsenko
{'id': 'https://openalex.org/W2007131731', 'doi': 'https://doi.org/10.1074/jbc.m413840200', 'title': 'The Copper-transporting ATPases, Menkes and Wilson Disease Proteins, Have Distinct Roles in Adult and Developing Cerebellum', 'display_name': 'The Copper-transporting ATPases, Menkes and Wilson Disease Proteins, Have Distinct Roles in Adult and Developing Cerebellum', 'publication_year': 2005, 'publication_date': '2005-01-06', 'ids': {'openalex': 'https://openalex.org/W2007131731', 'doi': 'https://doi.org/10.1074/jbc.m413840200', 'mag': '2007131731', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/15634671'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m413840200', 'pdf_url': 'http://www.jbc.org/article/S0021925819629856/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S0021925819629856/pdf', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5036328192', 'display_name': 'Natalie Barnes', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I165690674', 'display_name': 'Oregon Health & Science University', 'ror': 'https://ror.org/009avj582', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I165690674']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Natalie Barnes', 'raw_affiliation_strings': ['Department of Biochemistry and Molecular Biology, Oregon Health and Science University Portland, Oregon 97239-3098, USA.'], 'affiliations': [{'raw_affiliation_string': 'Department of Biochemistry and Molecular Biology, Oregon Health and Science University Portland, Oregon 97239-3098, USA.', 'institution_ids': ['https://openalex.org/I165690674']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5074602236', 'display_name': 'Ruslan Tsivkovskii', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I165690674', 'display_name': 'Oregon Health & Science University', 'ror': 'https://ror.org/009avj582', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I165690674']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Ruslan Tsivkovskii', 'raw_affiliation_strings': ['Department of Biochemistry and Molecular Biology, Oregon Health and Science University, Portland, Oregon, 97239-3098'], 'affiliations': [{'raw_affiliation_string': 'Department of Biochemistry and Molecular Biology, Oregon Health and Science University, Portland, Oregon, 97239-3098', 'institution_ids': ['https://openalex.org/I165690674']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5043865691', 'display_name': 'Natalia O. Tsivkovskaia', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I165690674', 'display_name': 'Oregon Health & Science University', 'ror': 'https://ror.org/009avj582', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I165690674']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Natalia Tsivkovskaia', 'raw_affiliation_strings': ['Department of Behavioral Neuroscience, Oregon Health and Science University, Portland, Oregon 97239-3098.'], 'affiliations': [{'raw_affiliation_string': 'Department of Behavioral Neuroscience, Oregon Health and Science University, Portland, Oregon 97239-3098.', 'institution_ids': ['https://openalex.org/I165690674']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5079179187', 'display_name': 'Svetlana Lutsenko', 'orcid': 'https://orcid.org/0000-0001-5275-2587'}, 'institutions': [{'id': 'https://openalex.org/I165690674', 'display_name': 'Oregon Health & Science University', 'ror': 'https://ror.org/009avj582', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I165690674']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Svetlana Lutsenko', 'raw_affiliation_strings': ['Department of Biochemistry and Molecular Biology, Oregon Health and Science University, Portland, Oregon, 97239-3098'], 'affiliations': [{'raw_affiliation_string': 'Department of Biochemistry and Molecular Biology, Oregon Health and Science University, Portland, Oregon, 97239-3098', 'institution_ids': ['https://openalex.org/I165690674']}]}], 'institution_assertions': [], 'countries_distinct_count': 1, 'institutions_distinct_count': 1, 'corresponding_author_ids': [], 'corresponding_institution_ids': [], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 7.609, 'has_fulltext': True, 'fulltext_origin': 'pdf', 'cited_by_count': 173, 'citation_normalized_percentile': {'value': 0.999828, 'is_in_top_1_percent': True, 'is_in_top_10_percent': True}, 'cited_by_percentile_year': {'min': 98, 'max': 99}, 'biblio': {'volume': '280', 'issue': '10', 'first_page': '9640', 'last_page': '9645'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T10915', 'display_name': 'Trace Elements in Health', 'score': 1.0, 'subfield': {'id': 'https://openalex.org/subfields/2916', 'display_name': 'Nutrition and Dietetics'}, 'field': {'id': 'https://openalex.org/fields/29', 'display_name': 'Nursing'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, 'topics': [{'id': 'https://openalex.org/T10915', 'display_name': 'Trace Elements in Health', 'score': 1.0, 'subfield': {'id': 'https://openalex.org/subfields/2916', 'display_name': 'Nutrition and Dietetics'}, 'field': {'id': 'https://openalex.org/fields/29', 'display_name': 'Nursing'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, {'id': 'https://openalex.org/T10790', 'display_name': 'Heavy Metal Exposure and Toxicity', 'score': 0.9857, 'subfield': {'id': 'https://openalex.org/subfields/2307', 'display_name': 'Health, Toxicology and Mutagenesis'}, 'field': {'id': 'https://openalex.org/fields/23', 'display_name': 'Environmental Science'}, 'domain': {'id': 'https://openalex.org/domains/3', 'display_name': 'Physical Sciences'}}, {'id': 'https://openalex.org/T12610', 'display_name': 'RNA regulation and disease', 'score': 0.9775, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/menkes-disease', 'display_name': 'Menkes disease', 'score': 0.9823524}, {'id': 'https://openalex.org/keywords/atp7a', 'display_name': 'ATP7A', 'score': 0.7107438}, {'id': 'https://openalex.org/keywords/p-type-atpase', 'display_name': 'P-type ATPase', 'score': 0.4639608}, {'id': 'https://openalex.org/keywords/wilsons-disease', 'display_name': "Wilson's disease", 'score': 0.44623077}], 'concepts': [{'id': 'https://openalex.org/C2777581567', 'wikidata': 'https://www.wikidata.org/wiki/Q639203', 'display_name': 'Menkes disease', 'level': 4, 'score': 0.9823524}, {'id': 'https://openalex.org/C2779652256', 'wikidata': 'https://www.wikidata.org/wiki/Q130983', 'display_name': 'Cerebellum', 'level': 2, 'score': 0.82113487}, {'id': 'https://openalex.org/C2779736553', 'wikidata': 'https://www.wikidata.org/wiki/Q14884608', 'display_name': 'ATP7A', 'level': 4, 'score': 0.7107438}, {'id': 'https://openalex.org/C23265538', 'wikidata': 'https://www.wikidata.org/wiki/Q300033', 'display_name': 'ATPase', 'level': 3, 'score': 0.6446036}, {'id': 'https://openalex.org/C2991729501', 'wikidata': 'https://www.wikidata.org/wiki/Q753', 'display_name': 'Copper metabolism', 'level': 3, 'score': 0.54226017}, {'id': 'https://openalex.org/C169760540', 'wikidata': 'https://www.wikidata.org/wiki/Q207011', 'display_name': 'Neuroscience', 'level': 1, 'score': 0.4906603}, {'id': 'https://openalex.org/C87746105', 'wikidata': 'https://www.wikidata.org/wiki/Q11903647', 'display_name': 'P-type ATPase', 'level': 4, 'score': 0.4639608}, {'id': 'https://openalex.org/C2776231509', 'wikidata': 'https://www.wikidata.org/wiki/Q117121', 'display_name': "Wilson's disease", 'level': 3, 'score': 0.44623077}, {'id': 'https://openalex.org/C544778455', 'wikidata': 'https://www.wikidata.org/wiki/Q753', 'display_name': 'Copper', 'level': 2, 'score': 0.41809562}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.39247805}, {'id': 'https://openalex.org/C2779134260', 'wikidata': 'https://www.wikidata.org/wiki/Q12136', 'display_name': 'Disease', 'level': 2, 'score': 0.28177932}, {'id': 'https://openalex.org/C142724271', 'wikidata': 'https://www.wikidata.org/wiki/Q7208', 'display_name': 'Pathology', 'level': 1, 'score': 0.28162956}, {'id': 'https://openalex.org/C71924100', 'wikidata': 'https://www.wikidata.org/wiki/Q11190', 'display_name': 'Medicine', 'level': 0, 'score': 0.25716746}, {'id': 'https://openalex.org/C185592680', 'wikidata': 'https://www.wikidata.org/wiki/Q2329', 'display_name': 'Chemistry', 'level': 0, 'score': 0.24967748}, {'id': 'https://openalex.org/C55493867', 'wikidata': 'https://www.wikidata.org/wiki/Q7094', 'display_name': 'Biochemistry', 'level': 1, 'score': 0.17748386}, {'id': 'https://openalex.org/C181199279', 'wikidata': 'https://www.wikidata.org/wiki/Q8047', 'display_name': 'Enzyme', 'level': 2, 'score': 0.09063184}, {'id': 'https://openalex.org/C178790620', 'wikidata': 'https://www.wikidata.org/wiki/Q11351', 'display_name': 'Organic chemistry', 'level': 1, 'score': 0.0}], 'mesh': [{'descriptor_ui': 'D000251', 'descriptor_name': 'Adenosine Triphosphatases', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D027682', 'descriptor_name': 'Cation Transport Proteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D002531', 'descriptor_name': 'Cerebellum', 'qualifier_ui': 'Q000254', 'qualifier_name': 'growth & development', 'is_major_topic': True}, {'descriptor_ui': 'D000251', 'descriptor_name': 'Adenosine Triphosphatases', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D000251', 'descriptor_name': 'Adenosine Triphosphatases', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D000818', 'descriptor_name': 'Animals', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D001483', 'descriptor_name': 'Base Sequence', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D027682', 'descriptor_name': 'Cation Transport Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D027682', 'descriptor_name': 'Cation Transport Proteins', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D002460', 'descriptor_name': 'Cell Line', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002531', 'descriptor_name': 'Cerebellum', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D003300', 'descriptor_name': 'Copper', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D003300', 'descriptor_name': 'Copper', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D000073840', 'descriptor_name': 'Copper-Transporting ATPases', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D017931', 'descriptor_name': 'DNA Primers', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D018507', 'descriptor_name': 'Gene Expression Regulation, Developmental', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D007700', 'descriptor_name': 'Kinetics', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D051379', 'descriptor_name': 'Mice', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D018345', 'descriptor_name': 'Mice, Knockout', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008969', 'descriptor_name': 'Molecular Sequence Data', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D009457', 'descriptor_name': 'Neuroglia', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D009457', 'descriptor_name': 'Neuroglia', 'qualifier_ui': 'Q000502', 'qualifier_name': 'physiology', 'is_major_topic': False}, {'descriptor_ui': 'D009474', 'descriptor_name': 'Neurons', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D009474', 'descriptor_name': 'Neurons', 'qualifier_ui': 'Q000502', 'qualifier_name': 'physiology', 'is_major_topic': False}, {'descriptor_ui': 'D010766', 'descriptor_name': 'Phosphorylation', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011689', 'descriptor_name': 'Purkinje Cells', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011689', 'descriptor_name': 'Purkinje Cells', 'qualifier_ui': 'Q000502', 'qualifier_name': 'physiology', 'is_major_topic': False}, {'descriptor_ui': 'D018411', 'descriptor_name': 'Spodoptera', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D014162', 'descriptor_name': 'Transfection', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}], 'locations_count': 2, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m413840200', 'pdf_url': 'http://www.jbc.org/article/S0021925819629856/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/15634671', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m413840200', 'pdf_url': 'http://www.jbc.org/article/S0021925819629856/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 29, 'referenced_works': ['https://openalex.org/W1504736651', 'https://openalex.org/W1572795685', 'https://openalex.org/W1595395957', 'https://openalex.org/W192250034', 'https://openalex.org/W1972624845', 'https://openalex.org/W1977360731', 'https://openalex.org/W1981033824', 'https://openalex.org/W1986642316', 'https://openalex.org/W1987939098', 'https://openalex.org/W1991112352', 'https://openalex.org/W2021994925', 'https://openalex.org/W2026126173', 'https://openalex.org/W2033017137', 'https://openalex.org/W2037414045', 'https://openalex.org/W2042059312', 'https://openalex.org/W2067826437', 'https://openalex.org/W2078458638', 'https://openalex.org/W2112544498', 'https://openalex.org/W2125812338', 'https://openalex.org/W2126898944', 'https://openalex.org/W2132544275', 'https://openalex.org/W2147286697', 'https://openalex.org/W2164670320', 'https://openalex.org/W2164960448', 'https://openalex.org/W2166118277', 'https://openalex.org/W2169514498', 'https://openalex.org/W2170057620', 'https://openalex.org/W2433714683', 'https://openalex.org/W268446214'], 'related_works': ['https://openalex.org/W44241854', 'https://openalex.org/W4214596293', 'https://openalex.org/W3201916834', 'https://openalex.org/W2513411289', 'https://openalex.org/W2155767496', 'https://openalex.org/W2031129868', 'https://openalex.org/W2026994978', 'https://openalex.org/W1973470249', 'https://openalex.org/W1530371307', 'https://openalex.org/W1519459752'], 'abstract_inverted_index': {'Copper': [0, 237, 474], 'is': [1, 109, 125, 194, 238, 346, 362, 431, 475, 593, 689, 961, 1070, 2505, 2599, 2606, 2631, 2645, 2650, 2708, 2739, 2768, 2823, 2980, 2987, 3018, 3058, 3071, 3090, 3503, 3526, 3615, 3662, 3764, 3888, 3901, 4013, 4112, 4119, 4123, 4139, 4158, 4233, 4284, 4298, 4325, 4418, 4434, 4518, 4615, 4619, 4624, 4660, 4678, 4694, 4718, 4762, 4774, 4789, 4853, 4874, 4963, 4981, 5026, 5035], 'essential': [2, 239, 683, 2651, 5037], 'for': [3, 22, 214, 240, 259, 451, 479, 754, 1210, 1306, 1317, 1335, 1359, 1443, 1511, 1660, 1674, 1683, 1691, 1952, 2074, 2082, 2121, 2137, 2197, 2215, 2233, 2242, 2303, 2309, 2337, 2416, 2442, 2452, 2487, 2639, 2652, 2744, 3156, 3530, 3544, 3560, 3602, 3613, 3618, 3653, 3658, 3664, 3667, 3839, 4173, 4313, 4635, 4664, 4765, 4772, 4779, 4816, 4847, 5144, 5197, 5209, 5218, 5227, 5237, 5248, 5273], 'brain': [4, 24, 76, 241, 261, 313, 481, 976, 1064, 1080, 1155, 4174, 4186, 4228], 'metabolism,': [5, 242], 'serving': [6, 243, 483], 'as': [7, 134, 244, 371, 484, 739, 1788, 1852, 1916, 1966, 2013, 2110, 2129, 2328, 2485, 3758, 4407, 4932], 'a': [8, 33, 126, 172, 226, 245, 270, 363, 409, 463, 485, 703, 831, 1012, 1169, 1454, 1531, 1591, 1709, 2329, 2402, 2435, 2463, 2556, 2616, 2646, 2775, 3035, 3168, 3554, 3920, 3994, 4069, 4195, 4326, 4350, 4699, 4719, 4741, 4933, 4936], 'cofactor': [9, 246, 486], 'to': [10, 52, 120, 151, 186, 205, 247, 289, 357, 388, 423, 442, 735, 778, 802, 805, 830, 885, 891, 974, 1023, 1277, 1976, 1984, 2252, 2318, 2401, 2496, 2508, 2537, 2550, 2615, 2632, 2635, 2842, 2876, 2882, 3044, 3061, 3127, 3166, 3199, 3206, 3481, 3582, 3713, 3759, 3832, 3841, 3846, 3850, 3877, 3933, 4004, 4028, 4037, 4052, 4058, 4160, 4285, 4288, 4300, 4310, 4315, 4357, 4386, 4438, 4475, 4500, 4556, 4617, 4626, 4661, 4827, 4855, 4887, 4923, 4945, 4975, 4983, 5141, 5185], 'superoxide': [11, 248], 'dismutase,': [12, 249], 'dopamine-β-hydroxylase,': [13, 250], 'amyloid': [14, 251, 551], 'precursor': [15, 252, 552], 'protein,': [16, 182, 253, 419, 742, 747, 4483], 'ceruloplasmin,': [17, 183, 254, 420, 4161, 5142], 'and': [18, 30, 49, 58, 65, 72, 83, 90, 102, 219, 224, 234, 255, 267, 286, 295, 302, 309, 320, 327, 339, 456, 461, 471, 500, 516, 542, 550, 628, 711, 718, 729, 737, 744, 750, 763, 876, 894, 1009, 1066, 1073, 1084, 1123, 1131, 1159, 1161, 1173, 1183, 1190, 1199, 1216, 1263, 1289, 1293, 1321, 1324, 1342, 1370, 1391, 1421, 1432, 1475, 1504, 1524, 1551, 1561, 1588, 1706, 1717, 1842, 1846, 1908, 1959, 1979, 2001, 2011, 2070, 2089, 2108, 2124, 2145, 2156, 2182, 2208, 2232, 2259, 2269, 2281, 2306, 2377, 2395, 2408, 2549, 2626, 2707, 2754, 2783, 2799, 2815, 2923, 2958, 2961, 2972, 2997, 3013, 3027, 3057, 3080, 3110, 3119, 3150, 3180, 3213, 3286, 3340, 3360, 3368, 3390, 3397, 3407, 3472, 3489, 3514, 3592, 3620, 3625, 3638, 3716, 3749, 3946, 3950, 3961, 3963, 3966, 4062, 4092, 4096, 4121, 4184, 4203, 4212, 4220, 4241, 4246, 4263, 4268, 4307, 4328, 4342, 4516, 4552, 4707, 4729, 4760, 4810, 4868, 4870, 4889, 4894, 4971, 5023, 5113, 5130, 5149, 5174, 5224, 5231, 5241, 5245, 5250, 5262, 5269, 5277], 'other': [19, 256, 1063, 4009, 4639, 4668], 'proteins': [20, 257, 553, 771, 1948, 1997, 3739], 'required': [21, 258, 3657], 'normal': [23, 260, 480, 697, 4183], 'function.': [25, 262, 4823, 5155], 'The': [26, 142, 196, 263, 379, 433, 1261, 1396, 1778, 1996, 2115, 2204, 2265, 2389, 2474, 2518, 2529, 2829, 3009, 3114, 3384, 3523, 3698, 3926, 4318, 4373, 4425, 4492, 4712, 4767, 4807, 4824, 4918, 5126, 5156], 'copper-transporting': [27, 264, 725, 959, 1059, 1091, 1180, 2737, 3007, 3132, 3989], 'ATPases': [28, 265, 727, 960, 1060, 1092, 2738, 3133, 3376, 4688], 'ATP7A': [29, 48, 64, 89, 124, 145, 190, 218, 266, 285, 301, 326, 361, 382, 427, 455, 728, 736], 'ATP7B': [31, 50, 66, 91, 108, 164, 180, 220, 268, 287, 303, 328, 345, 401, 417, 457, 738], 'play': [32, 269], 'central': [34, 42, 271, 279, 753, 951, 2657, 5050], 'role': [35, 272, 684, 1014, 2820, 4648, 4657, 4744, 5044], 'in': [36, 40, 47, 74, 95, 112, 159, 175, 200, 221, 232, 273, 277, 284, 311, 332, 349, 396, 412, 437, 458, 469, 492, 520, 543, 695, 724, 760, 790, 807, 834, 980, 1015, 1062, 1075, 1087, 1096, 1129, 1188, 1196, 1308, 1362, 1373, 1405, 1460, 1469, 1530, 1541, 1544, 1607, 1611, 1626, 1642, 1652, 1663, 1719, 1724, 1818, 1887, 2057, 2094, 2112, 2167, 2271, 2283, 2293, 2367, 2410, 2418, 2427, 2429, 2434, 2444, 2455, 2457, 2462, 2510, 2523, 2594, 2601, 2608, 2628, 2655, 2710, 2741, 2764, 2771, 2779, 2791, 2806, 2845, 2874, 2885, 2901, 2914, 2956, 2965, 2982, 3015, 3039, 3051, 3064, 3074, 3085, 3094, 3121, 3134, 3146, 3183, 3342, 3362, 3377, 3387, 3470, 3585, 3704, 3728, 3744, 3772, 3834, 3853, 3858, 3868, 3894, 3904, 3907, 3923, 3928, 3970, 3996, 4021, 4106, 4126, 4131, 4142, 4167, 4181, 4205, 4217, 4223, 4282, 4304, 4322, 4355, 4359, 4368, 4384, 4420, 4430, 4451, 4478, 4488, 4494, 4630, 4651, 4681, 4691, 4755, 4785, 4896, 4906, 4925, 4939, 4956, 4968, 4977, 4987, 5013, 5045, 5048, 5102, 5105, 5110, 5132, 5135, 5163, 5178], 'distribution': [37, 94, 274, 331, 759, 1194, 2288, 2405, 2751, 2937, 3885, 4179], 'of': [38, 139, 144, 163, 178, 217, 275, 376, 381, 400, 415, 454, 487, 547, 597, 685, 757, 775, 793, 1090, 1098, 1121, 1149, 1153, 1212, 1223, 1273, 1281, 1287, 1330, 1348, 1386, 1616, 1715, 1722, 1816, 1836, 1840, 1844, 1881, 1911, 1962, 2004, 2044, 2049, 2060, 2097, 2143, 2170, 2185, 2227, 2237, 2267, 2279, 2289, 2322, 2347, 2406, 2423, 2449, 2499, 2520, 2540, 2555, 2619, 2621, 2624, 2735, 2752, 2758, 2797, 2813, 2821, 2827, 2831, 2879, 2888, 2897, 2912, 2927, 2936, 2941, 2953, 2968, 2970, 2999, 3005, 3011, 3097, 3103, 3108, 3116, 3130, 3173, 3177, 3191, 3211, 3347, 3373, 3409, 3475, 3487, 3499, 3576, 3589, 3599, 3660, 3700, 3707, 3768, 3824, 3830, 3856, 3886, 3897, 3919, 3931, 3958, 3964, 3973, 3988, 3999, 4050, 4134, 4145, 4155, 4226, 4239, 4252, 4271, 4280, 4296, 4320, 4371, 4381, 4414, 4427, 4449, 4481, 4496, 4506, 4511, 4550, 4649, 4658, 4701, 4705, 4748, 4758, 4770, 4814, 4845, 4866, 4892, 4914, 4920, 4928, 4935, 4953, 4960, 4989, 5002, 5005, 5020, 5030, 5108, 5128, 5147, 5159, 5166, 5189, 5200, 5213, 5259], 'copper': [39, 119, 128, 203, 230, 276, 356, 365, 440, 467, 591, 693, 758, 780, 804, 829, 881, 897, 972, 1021, 1193, 2042, 2634, 2742, 3375, 3410, 3565, 3688, 3770, 3831, 3844, 4010, 4035, 4115, 4157, 4168, 4178, 4200, 4287, 4302, 4312, 4614, 4634, 4663, 4721, 4773, 4793, 4817, 4848, 4921, 4954, 4966, 4973, 5139], 'the': [41, 75, 121, 154, 176, 179, 210, 222, 278, 312, 358, 391, 413, 416, 447, 459, 548, 594, 682, 705, 709, 755, 773, 782, 785, 791, 835, 879, 899, 950, 954, 970, 975, 1058, 1068, 1088, 1118, 1134, 1150, 1154, 1192, 1213, 1270, 1278, 1285, 1307, 1322, 1336, 1757, 1762, 1770, 1784, 1882, 1888, 1906, 1944, 1947, 1960, 1967, 1980, 1989, 2090, 2160, 2171, 2209, 2277, 2287, 2319, 2323, 2351, 2362, 2384, 2393, 2417, 2443, 2471, 2482, 2497, 2500, 2538, 2551, 2559, 2595, 2622, 2636, 2656, 2711, 2736, 2749, 2765, 2780, 2784, 2819, 2886, 2910, 2915, 2918, 2933, 2939, 2944, 2966, 2994, 3003, 3047, 3065, 3081, 3095, 3131, 3157, 3178, 3208, 3388, 3405, 3412, 3473, 3483, 3572, 3586, 3610, 3641, 3651, 3705, 3731, 3756, 3773, 3822, 3828, 3843, 3864, 3872, 3884, 3908, 3917, 3924, 3929, 3951, 3971, 3974, 3986, 3997, 4008, 4019, 4025, 4029, 4047, 4059, 4089, 4094, 4107, 4127, 4132, 4135, 4143, 4149, 4153, 4177, 4182, 4206, 4227, 4253, 4272, 4277, 4289, 4294, 4415, 4421, 4445, 4479, 4489, 4509, 4541, 4548, 4647, 4655, 4671, 4702, 4828, 4841, 4859, 4897, 4907, 4926, 4969, 4978, 4993, 5014, 5018, 5049, 5145, 5153, 5164, 5167, 5179, 5186, 5198, 5201, 5210, 5214, 5228, 5238, 5253, 5275], 'nervous': [43, 280, 952, 2658, 5051], 'system;': [44, 281], 'genetic': [45, 282], 'mutations': [46, 283, 723], 'lead': [51, 288], 'severe': [53, 290, 632], 'neurodegenerative': [54, 291], 'disorders,': [55, 292], 'Menkes': [56, 293, 598, 606, 740, 1217], 'disease': [57, 132, 166, 192, 294, 369, 403, 429, 599, 630, 741, 746, 1215, 1218, 5181], 'Wilson': [59, 131, 296, 368, 609, 629, 745, 1214], 'disease,': [60, 297], 'respectively.': [61, 298], 'Although': [62, 299], 'both': [63, 300, 1157, 3006, 3117, 3358, 3636, 3959, 4099, 4215, 4687, 4726], 'are': [67, 103, 304, 340, 720, 752, 767, 1202, 3197, 3394, 3401, 3579, 3718, 4098, 4214, 4229, 4689, 4818], 'required,': [68, 305], 'their': [69, 306, 764, 2002, 2290, 3142, 3378, 3745, 4221, 4763, 4871], 'specific': [70, 307, 2404, 4888], 'roles': [71, 308, 519, 1187, 4891], 'regulation': [73, 310, 544, 756, 1120, 2967, 3172, 4270], 'remain': [77, 314, 714, 1081, 4187], 'poorly': [78, 315, 517, 962], 'understood.': [79, 316, 963], 'Using': [80, 317, 1165, 2147], 'high-resolution': [81, 318], 'imaging': [82, 319, 1167, 5254], 'functional': [84, 321, 955, 1174, 3209, 3752, 3766, 3786, 3921, 4196, 4266, 4703, 4756, 4912, 4951, 5191], 'assays,': [85, 322], 'we': [86, 323, 1141, 1176, 2285, 2747, 2908, 3204, 3356, 3594, 3779, 4045, 4363, 4485, 4736, 4910], 'demonstrate': [87, 324, 1177, 3736], 'that': [88, 325, 967, 1178, 1191, 1829, 2757, 2763, 2803, 2818, 2826, 2993, 3219, 3494, 3571, 3609, 3635, 3684, 3737, 3784, 3821, 3867, 3912, 3985, 4018, 4210, 4276, 4628, 4716, 4738, 4778, 4905, 4948], 'show': [92, 329], 'cell-specific': [93, 198, 330, 435, 3741, 4237], 'adult': [96, 160, 333, 397, 1077, 1340, 2411, 2596, 2889, 2959, 3066, 3869, 4218, 4542], 'cerebellum,': [97, 334, 1147, 2234, 2284, 2597, 4093, 4219, 4543], 'have': [98, 335, 1061, 1093, 1142, 1185, 1207, 3153, 3217, 3222, 3740, 3750, 4170], 'distinct': [99, 215, 336, 452, 1186, 2824, 3154, 3573, 3751, 4265], 'enzymatic': [100, 337, 3371, 3392], 'characteristics,': [101, 338], 'regulated': [104, 341], 'differently': [105, 342], 'during': [106, 147, 343, 384, 2974, 3088, 3123], 'development.': [107, 344, 2929, 2975], 'continuously': [110, 347], 'expressed': [111, 348, 2600, 2769, 2989, 3357, 3852, 4125], 'Purkinje': [113, 350, 620, 1197, 2368, 2524, 2609, 2772, 2846, 2983, 3016, 3045, 3711, 3835, 3895, 4002, 4247, 4316, 4943, 4998, 5111], 'neurons': [114, 351, 1198, 2369, 2525, 2773, 2847, 3017, 3836, 3896, 4003, 4027, 4693, 4944, 4999, 5112], '(PN)': [115, 352], 'where': [116, 189, 353, 426, 1018, 2985, 4007, 4654, 4787], 'it': [117, 354, 1019, 3848, 4623, 4724, 4901], 'delivers': [118, 355, 828], 'ferroxidase': [122, 359, 832, 4291], 'ceruloplasmin.': [123, 360], 'faster': [127, 137, 364, 374, 3505, 3529, 4720, 4732], 'transporter': [129, 366, 2561], 'than': [130, 367, 3226, 3506, 3666, 3694, 4733, 4777], 'protein': [133, 370, 2522, 3587, 4055, 4382, 4417], 'evidenced': [135, 372], 'by': [136, 168, 373, 405, 883, 1314, 1453, 1538, 1823, 2470, 3501, 3567, 3938, 3991, 4117, 4335, 4441, 4638, 4642, 4667, 4916], 'rates': [138, 375, 3486], 'catalytic': [140, 377, 2045, 3557, 3600, 3642, 4727], 'reactions.': [141, 378], 'expression': [143, 177, 201, 380, 414, 438, 1089, 2553, 2844, 2940, 2969, 3341, 3747, 3893, 3914, 3930, 3998, 4023, 4480, 4495, 4941, 5007], 'switches': [146, 383], 'development': [148, 385, 2998, 3077, 3089, 3125], 'from': [149, 184, 386, 421, 781, 898, 2159, 2373, 2825, 3411, 3710, 4001, 4024, 4498, 4942, 4997], 'PN': [150, 157, 185, 233, 387, 394, 422, 470, 2379, 2534, 2557, 3075, 3122, 3184, 3854, 3980, 4452, 4499, 4517, 4546, 4551, 4618, 4682], 'Bergmann': [152, 187, 235, 389, 424, 472, 623, 1200, 2348, 2374, 2602, 2792, 2883, 3052, 3062, 3714, 3861, 3878, 3905, 3934, 3952, 4005, 4031, 4244, 4305, 4323, 4631, 4946, 4984, 5133], 'glia,': [153, 188, 390, 425, 2349, 2603, 4006, 4947], 'cells': [155, 392, 900, 1726, 1820, 2782, 3001, 3364, 4558], 'supporting': [156, 393], 'function': [158, 395, 546, 4279, 4295], 'brain.': [161, 398, 701], 'Inactivation': [162, 399, 4959], '(Wilson': [165, 402], 'protein)': [167, 193, 404, 430], 'gene': [169, 406], 'knock-out': [170, 407, 3782], 'induces': [171, 408, 3993], 'striking': [173, 410, 4937], 'shift': [174, 411, 4938], 'target': [181, 418], '(Menkes': [191, 428], 'present.': [195, 432], 'induced': [197, 434], 'change': [199, 436, 3037, 3083, 4020, 4141], 'restores': [202, 439, 5138], 'delivery': [204, 441, 1022, 2743, 3829, 3845, 4036, 4314, 4826, 4922, 4974, 5140], 'ceruloplasmin': [206, 443, 833], 'via': [207, 444, 4039, 4164], 'ATP7A.': [208, 445], 'Overall,': [209, 446], 'results': [211, 448, 1206, 3552, 4191, 4885], 'provide': [212, 449], 'evidence': [213, 450], 'functions': [216, 453, 766, 1057, 2623, 3129, 4222, 4873], 'cerebellum': [223, 460, 1189, 1325, 2158, 2511, 2712, 2766, 2887, 2916, 2960, 3972, 4133, 4283, 4927, 5165], 'illustrate': [225, 462], 'tight': [227, 464], 'link': [228, 465], 'between': [229, 466, 957, 1071, 2392, 4198, 4514, 4862], 'homeostasis': [231, 468, 482, 592, 2654, 4169], 'glia.': [236, 473, 3862], 'an': [476, 1410, 3091, 3100, 3596, 4876, 5027, 5036, 5042], 'important': [477, 1139, 1208, 4329, 4753, 4854, 5028, 5043], 'nutrient': [478], 'key': [488, 3385], 'metabolic': [489, 633, 5038], 'enzymes': [490], 'involved': [491, 2740], 'mitochondrial': [493], 'function,': [494], 'neurotransmitter': [495], 'biosynthesis,': [496, 2746], 'oxidative': [497], 'stress': [498], 'defense,': [499], 'iron': [501, 2653, 5046, 5109], 'transport': [502, 694, 779, 803, 3161, 4116, 5047], '(1Frieden': [503], 'E.': [504], 'Clin.': [505, 2722], 'Physiol.': [506], 'Biochem.': [507], '1986;': [508], '4:': [509], '11-19PubMed': [510], 'Google': [511, 540, 575, 588, 650, 663, 679, 824, 871, 921, 947, 1007, 1053, 1115, 1259, 1753, 1813, 1877, 1941, 2038, 2575, 2589, 2685, 2705, 2730, 2872, 3250, 3274, 3311, 3338, 3439, 3463, 3817, 4086, 4404, 4473, 4538, 4576, 4611, 4805, 5078, 5098, 5124], 'Scholar).': [512, 589, 680, 872, 948, 1054, 1260, 1754, 1814, 1942, 2039, 2731, 3275, 3464, 3818, 4087, 4539, 4612, 4806, 5099, 5125], 'It': [513, 4015, 4331, 4852], 'plays': [514, 4740, 5041], 'additional': [515], 'understood': [518], 'neuronal': [521], 'myelination': [522], '(2Prodan': [523], 'C.I.': [524], 'Holland': [525], 'N.R.': [526], 'Wisdom': [527], 'P.J.': [528], 'Burstein': [529], 'S.A.': [530], 'Bottomley': [531], 'S.S.': [532], 'Neurology.': [533], '2002;': [534, 1742, 1802, 1866, 1930, 2027, 2569, 2701, 3239, 3327, 3428, 5094], '59:': [535], '1453-1456Crossref': [536], 'PubMed': [537, 572, 585, 647, 660, 821, 868, 918, 944, 1004, 1050, 1256, 1750, 1810, 1874, 1938, 2035, 2572, 2588, 2682, 2704, 2727, 2869, 3247, 3271, 3308, 3335, 3436, 3460, 3814, 4085, 4401, 4470, 4608, 5075, 5097, 5121], 'Scopus': [538, 573, 586, 648, 661, 822, 869, 919, 945, 1005, 1051, 1113, 1257, 1751, 1811, 1875, 1939, 2036, 2573, 2683, 2728, 2870, 3248, 3272, 3309, 3336, 3437, 3461, 3815, 4402, 4471, 4609, 4803, 5076, 5122], '(113)': [539], 'Scholar)': [541, 1008, 1878, 2590, 2706, 2873, 3312, 4474], 'or': [545, 698, 890, 1078, 1312, 1676, 1685, 1885, 2051, 2162, 2342, 3761, 3948, 5008], 'prion': [549], '(3Multhaup': [554], 'G.': [555], 'Schlicksupp': [556], 'A.': [557, 2678, 4522, 4524, 4560, 4562, 4579, 4589, 4604, 5071], 'Hesse': [558], 'L.': [559], 'Beher': [560], 'D.': [561, 812, 3257, 3294, 3446, 4530, 4568], 'Ruppert': [562], 'T.': [563, 840, 852, 856, 984, 2853, 4462, 4581, 4591], 'Masters': [564], 'C.L.': [565], 'Beyreuther': [566], 'K.': [567, 838, 992, 1239, 3797, 4585], 'Science.': [568, 643], '1996;': [569, 915, 1001, 2585, 2724], '271:': [570], '1406-1409Crossref': [571], '(591)': [574], 'Scholar,': [576, 651, 664, 922, 2576, 2686, 3251, 3440, 4577, 5079], '4Millhauser': [577], 'G.L.': [578], 'Acc.': [579], 'Chem.': [580, 859, 1041, 1741, 1801, 1865, 1929, 2026, 3238, 3262, 3299, 3326, 3427, 3451, 4078], 'Res.': [581, 2865, 4394, 4397], '2004;': [582, 4800], '37:': [583], '79-85Crossref': [584], '(359)': [587], 'Abnormal': [590], 'primary': [595, 1638, 4742], 'cause': [596], '(MNK)': [600], '1The': [601], 'abbreviations': [602], 'used': [603, 1334, 1571, 2327, 2340, 2415, 2426, 2441, 2451, 3480, 5217], 'are:': [604], 'MNK,': [605], 'disease;': [607, 610], 'WND,': [608], 'MNKP,': [611, 743, 1761, 3593, 3947, 4012, 4262, 4780], 'MNK': [612, 717], 'protein;': [613, 616], 'WNDP,': [614, 1184, 3545, 4156, 4204, 4258, 4961], 'WND': [615, 719], 'CP,': [617, 2816, 3962, 4292], 'ceruloplasmin;': [618], 'PN,': [619], 'neuron;': [621], 'BG,': [622], 'glia;': [624], 'P,': [625], 'postnatal': [626, 2928], 'day.': [627], '(WND),': [631], 'disorders': [634], 'with': [635, 722, 1168, 1303, 1400, 1409, 1424, 1438, 1449, 1457, 1553, 1582, 1637, 1704, 1955, 2133, 2296, 2547, 2612, 2756, 2774, 2938, 3141, 3404, 3539, 3644, 3674, 4148, 4257, 4261, 4349, 4684, 4820, 4965, 5252], 'marked': [636, 2390, 3036, 4171, 5106, 5160], 'neurological': [637, 5161], 'manifestations': [638, 5177], '(5Scheinberg': [639], 'H.': [640, 924, 926, 2665, 2851, 4456, 5058, 5116], 'Gitlin': [641, 2670, 2719, 4074, 5063], 'J.': [642, 857, 912, 914, 1039, 1104, 1233, 1736, 1739, 1796, 1799, 1860, 1863, 1924, 1927, 2021, 2024, 2583, 2696, 2699, 2721, 2861, 3233, 3236, 3255, 3259, 3260, 3292, 3296, 3297, 3321, 3324, 3422, 3425, 3444, 3448, 3449, 3791, 4076, 4463, 4533, 4571, 4583, 4795, 4798, 5089, 5092], '1952;': [644], '116:': [645], '484-485Crossref': [646], '(208)': [649], '6Bearne': [652], 'A.G.': [653], 'Ann.': [654], 'Hum.': [655, 815, 1107, 1250, 3808], 'Genet.': [656, 817, 1109, 1252, 3810], '1960;': [657], '24:': [658], '33-43Crossref': [659], '(85)': [662], '7Menkes': [665], 'J.H.': [666, 674], 'Alter': [667], 'M.': [668, 844, 850, 986, 994, 996, 2667, 2857, 4073, 4460, 4526, 4564, 4587, 4593, 4595, 5060], 'Stegleder': [669], 'G.K.': [670], 'Weakley': [671], 'D.R.': [672], 'Sung': [673], 'Pediatrics.': [675], '1962;': [676], '29:': [677], '764-779PubMed': [678], 'Despite': [681], 'copper,': [686, 3654], 'very': [687, 768, 3720], 'little': [688, 4140], 'currently': [690, 4620], 'known': [691, 4048], 'about': [692], 'either': [696, 886, 1076, 1301, 1331, 5000], 'diseased': [699, 4185], 'human': [700, 761], 'As': [702, 4104], 'result,': [704], 'molecular': [706, 2483], 'mechanisms': [707], 'underlying': [708], 'MNK-': [710], 'WND-related': [712], 'neurodegeneration': [713, 5114], 'essentially': [715, 3616, 4188, 4790], 'uncharacterized.': [716, 4189], 'associated': [721, 3140, 4964], 'P-type': [726], 'ATP7B,': [730], 'respectively': [731], '(We': [732], 'will': [733], 'refer': [734], 'WNDP).': [748], 'MNKP': [749, 799, 875, 968, 1072, 1124, 1158, 1182, 1718, 1765, 1817, 1841, 1847, 1884, 2268, 2280, 2304, 2338, 2394, 2407, 2598, 2625, 2753, 2814, 2822, 2832, 2843, 2880, 2902, 2913, 2934, 2954, 2971, 2978, 3012, 3040, 3048, 3111, 3118, 3149, 3179, 3212, 3220, 3288, 3359, 3389, 3488, 3500, 3531, 3621, 3637, 3668, 3695, 3840, 3873, 3960, 4122, 4202, 4211, 4240, 4297, 4321, 4366, 4416, 4428, 4450, 4497, 4629, 4650, 4659, 4677, 4706, 4717, 4739, 4759, 4867, 4893, 5131, 5239], 'WNDP': [751, 827, 877, 1074, 1122, 1160, 1716, 1723, 1845, 1886, 2270, 2282, 2310, 2396, 2409, 2521, 2541, 2605, 2627, 2755, 2798, 2804, 2942, 2973, 2986, 3014, 3070, 3086, 3104, 3109, 3120, 3151, 3181, 3227, 3315, 3361, 3391, 3507, 3591, 3619, 3639, 3665, 3685, 3702, 3717, 3787, 3825, 3992, 4118, 4213, 4242, 4281, 4708, 4761, 4771, 4815, 4846, 4869, 4895, 4915, 5148], 'cells,': [762, 4640], 'general': [765], 'similar.': [769], 'Both': [770, 3465], 'utilize': [772], 'energy': [774], 'ATP': [776, 1909, 1972, 3502, 3561, 3597, 3614], 'hydrolysis': [777, 3562], 'cytosol': [783, 4970], 'into': [784, 1769, 2641], 'secretory': [786, 2637, 4829], 'pathway': [787, 2638, 4830], 'thus': [788], 'participating': [789], 'biosynthesis': [792], 'copper-dependent': [794, 2647, 4290], 'enzymes.': [795, 2643], 'In': [796, 873, 949, 1350, 2360, 3042, 3068, 3882, 4088, 4129, 4540], 'peripheral': [797, 2629, 4369, 4374], 'tissues,': [798], 'was': [800, 1767, 1781, 1821, 1850, 1964, 1973, 1982, 2006, 2079, 2092, 2117, 2127, 2206, 2212, 2230, 2240, 2381, 2468, 2493, 2526, 3936, 3968, 3982], 'shown': [801], 'tyrosinase': [806], 'melanocytes': [808], '(8Petris': [809], 'M.J.': [810, 902, 928], 'Strausak': [811, 3256, 3293, 3445], 'Mercer': [813, 903], 'J.F.B.': [814, 904], 'Mol.': [816, 1108, 1251, 3809, 4395], '2000;': [818, 936, 4398, 4605], '9:': [819], '2845-2851Crossref': [820], '(188)': [823], 'Scholar),': [825, 4405], 'whereas': [826, 2350, 2604, 4293], 'liver': [836, 2223, 4091, 4109], '(9Terada': [837], 'Nakako': [839], 'Yang': [841], 'X.L.': [842], 'Iida': [843], 'Aiba': [845], 'N.': [846, 854, 930, 2855], 'Minamiya': [847], 'Y.': [848, 2663, 2849, 4454, 4458, 4597, 5056], 'Nakai': [849], 'Sakaki': [851], 'Miura': [853, 929], 'Sugiyama': [855], 'Biol.': [858, 1040, 1740, 1800, 1864, 1928, 2025, 3237, 3261, 3298, 3325, 3426, 3450, 4077], '1998;': [860, 4467], '273:': [861], '1815-1820Abstract': [862], 'Full': [863, 865, 939, 941, 1045, 1047, 1745, 1747, 1805, 1807, 1869, 1871, 1933, 1935, 2030, 2032, 3242, 3244, 3266, 3268, 3303, 3305, 3330, 3332, 3431, 3433, 3455, 3457, 4082], 'Text': [864, 866, 940, 942, 1046, 1048, 1746, 1748, 1806, 1808, 1870, 1872, 1934, 1936, 2031, 2033, 3243, 3245, 3267, 3269, 3304, 3306, 3331, 3333, 3432, 3434, 3456, 3458, 4083], 'PDF': [867, 943, 1049, 1749, 1809, 1873, 1937, 2034, 3246, 3270, 3307, 3334, 3435, 3459, 4084], '(154)': [870], 'addition,': [874], 'regulate': [878, 4301], 'intracellular': [880, 3174, 4872], 'concentration': [882, 4303], 'trafficking': [884], 'plasma': [887], 'membrane': [888, 2053, 2238], '(MNKP)': [889], 'vesicles': [892], '(WNDP)': [893], 'exporting': [895], 'excess': [896, 4749], '(10Petris': [901], 'Culvenor': [905], 'J.G.': [906], 'Lockhart': [907], 'P.': [908], 'Gleeson': [909], 'P.A.': [910], 'Camakaris': [911, 3258, 3295, 3447], 'EMBO': [913], '15:': [916], '6084-6095Crossref': [917], '(541)': [920], '11Roelofsen': [923], 'Wolters': [925], 'Van-Luyn': [927], 'Kuipers': [931], 'F.': [932, 990], 'Vonk': [933], 'R.J.': [934, 2690, 5083], 'Gastroenterology.': [935], '119:': [937], '782-793Abstract': [938], '(226)': [946], 'system,': [953], 'relationship': [956, 1069, 4197, 4861], 'two': [958, 1179, 2307, 3374, 3604, 4054, 4199, 4336], 'Current': [964], 'data': [965, 3735], 'suggest': [966, 3553], 'controls': [969], 'overall': [971], 'supply': [973], 'through': [977], 'its': [978, 3892, 4821], 'localization': [979, 2278, 2911, 3010, 3190, 4238, 4319, 4358, 4376, 4448], 'choroid': [981], 'plexus': [982], '(12Iwase': [983], 'Nishimura': [985, 2856], 'Sugimura': [987], 'H.H.I.': [988], 'Ozsawa': [989], 'Shinmura': [991], 'Suzuki': [993], 'Tanaka': [995], 'Kino': [997], 'I.': [998, 3253, 3290, 3442], 'Acta': [999], 'Neuropathol.': [1000], '91:': [1002], '482-488Crossref': [1003], '(40)': [1006], 'also': [1010, 2494, 2931, 2962, 2988, 3019, 3527, 4309, 4364], 'has': [1011, 1125, 1226, 1727, 3849, 4332], 'biosynthetic': [1013, 4822], 'pituitary': [1016], 'gland': [1017], 'mediates': [1020], 'peptidyl-glycine': [1024], 'α-amidating': [1025], 'monooxygenase': [1026], '(13Stevenson': [1027], 'T.C.': [1028, 1249, 3807], 'Ciccotosto': [1029], 'G.D.': [1030], 'Ma': [1031], 'X.M.': [1032], 'Mueller': [1033], 'G.P.': [1034], 'Mains': [1035], 'R.E.': [1036], 'Eipper': [1037, 5208], 'B.A.': [1038], '2003;': [1042, 5118], '278:': [1043], '12278-12284Abstract': [1044], '(72)': [1052], 'What': [1055], 'physiological': [1056], 'regions': [1065, 1152], 'what': [1067], 'developing': [1079, 2957, 3135, 4692], 'unknown.': [1082], 'Spatial': [1083], 'temporal': [1085], 'differences': [1086, 2964, 3584], 'been': [1094, 1127, 1227, 1728, 4333], 'observed': [1095, 2810, 3969, 4911], 'tissues': [1097, 2630], 'mouse': [1099], 'embryo': [1100], '(14Kuo': [1101], 'Y.M.': [1102], 'Gitschier': [1103, 2860], 'Packman': [1105, 2862], 'S.': [1106, 1235, 1237, 1241, 1738, 1798, 1862, 1926, 2023, 2677, 2698, 2863, 3235, 3323, 3424, 3793, 3795, 3799, 4603, 5070, 5091], '1997;': [1110, 2866], '7:': [1111], '1043-1049Crossref': [1112], '(80)': [1114], 'Scholar);': [1116], 'however': [1117], 'developmental': [1119, 2898, 3746, 4269, 4476], 'never': [1126, 1132], 'examined': [1128, 2909], 'detail': [1130], 'within': [1133], 'CNS.': [1135], 'To': [1136, 1755, 2040, 2732, 2904, 3352, 3569, 3775, 4041], 'address': [1137, 3776], 'these': [1138, 3000, 3192, 3277, 3354, 3476, 3603, 3738, 3769, 4557, 4929, 4957], 'issues,': [1140], 'focused': [1143], 'our': [1144, 2877, 3734, 4884, 5031], 'attention': [1145], 'on': [1146, 1284, 1904, 1986, 1993, 2072, 2119, 2140, 2244, 3916, 4068, 4194, 4235, 4840], 'one': [1148], 'critical': [1151], 'expressing': [1156, 1760], 'several': [1162], 'copper-requiring': [1163, 2642, 4254], 'proteins.': [1164, 3605], 'fluorescent': [1166, 2428, 2456], 'single': [1170, 4351], 'cell': [1171, 2479, 3344, 4352, 4361, 4423], 'resolution': [1172], 'analysis,': [1175], 'ATPases,': [1181], 'pathways': [1195, 4180], 'glia': [1201, 2375, 2793, 2884, 3053, 3063, 3879, 3906, 3935, 3953, 4032, 4245, 4306, 4324, 4632, 4985, 5134], 'tightly': [1203], 'linked.': [1204], 'These': [1205, 2947, 3551, 3606], 'implication': [1209], 'understanding': [1211], 'pathologies.': [1219], 'Mouse': [1220], 'Strains—The': [1221], 'generation': [1222, 5199], 'Atp7b-/-': [1224, 1262, 1343, 2163, 3781, 3870, 3909, 3975, 4108, 4136, 4908, 5136, 5168], 'mice': [1225, 1266, 1344, 2164, 2840, 3783, 3976, 4930, 5137, 5169], 'described': [1228, 1729, 1789, 1853, 2014, 2130], 'previously': [1229, 1730, 1790, 1854, 2015, 4446], '(15Buiakova': [1230, 3788], 'O.I.': [1231, 3789], 'Xu': [1232, 3790], 'Lutsenko': [1234, 1737, 1797, 1861, 1925, 2022, 3234, 3322, 3423, 3792, 5260], 'Zeitlin': [1236, 3794], 'Das': [1238, 1240, 3796, 3798], 'Ross': [1242, 3800], 'B.M.': [1243, 3801], 'Mekios': [1244, 3802], 'C.': [1245, 3803], 'Scheinberg': [1246, 3804], 'I.H.': [1247, 3805], 'Gilliam': [1248, 3806], '1999;': [1253, 3811], '8:': [1254, 3812], '1665-1671Crossref': [1255, 3813], '(168)': [1258, 3816], 'wild-type': [1264, 1341, 2161, 3898, 4090, 4898], 'C57BLx129SV/SvEv': [1265], 'were': [1267, 1295, 1300, 1326, 1333, 1345, 1354, 1389, 1398, 1447, 1467, 1522, 1536, 1570, 1577, 1605, 1630, 1658, 1699, 1830, 1914, 1949, 1998, 2055, 2165, 2195, 2250, 2312, 2326, 2365, 3279], 'housed': [1268], 'at': [1269, 1381, 1508, 1519, 1527, 1634, 1988, 2085, 2200, 2218, 2917, 2943, 3021, 3033], 'OHSU': [1271], 'Department': [1272], 'Comparative': [1274], 'Medicine': [1275], 'according': [1276], 'National': [1279], 'Institutes': [1280], 'Health': [1282], 'guidelines': [1283], 'use': [1286], 'laboratory': [1288], 'experimental': [1290], 'animals.': [1291], 'Food': [1292], 'water': [1294], 'provided': [1296], 'ad': [1297], 'libitum.': [1298], 'Animals': [1299], 'perfused': [1302], '4%': [1304, 1363, 1450], 'paraformaldehyde': [1305, 1451], 'situ': [1309, 2294, 2419, 2430, 2445, 2458, 4340], 'hybridization': [1310, 1470, 2295, 2420, 2446, 4341], 'studies': [1311, 2837, 3216], 'euthanized': [1313], 'CO2': [1315], 'inhalation': [1316], 'Western': [1318, 2148], 'blotting': [1319], 'experiments,': [1320, 1946, 5220], 'livers': [1323], 'quickly': [1327], 'removed.': [1328], 'Mice': [1329], 'sex': [1332], 'experiments.': [1337, 2473], 'Unless': [1338], 'specified,': [1339], '10': [1346, 2083, 2198], 'weeks': [1347, 4674], 'age.': [1349], 'Situ': [1351], 'Hybridization—The': [1352], 'brains': [1353], 'removed': [1355, 1537], 'following': [1356, 1414, 2008], 'perfusion,': [1357], 'soaked': [1358], '24': [1360], 'h': [1361, 1662], 'paraformaldehyde,': [1364], '20%': [1365], 'sucrose,': [1366, 2181], 'then': [1367, 1371, 1422, 1578, 1631, 1974, 1999, 2125, 3369, 3398], '30%': [1368], 'sucrose': [1369], 'embedded': [1372], 'Optimal': [1374], 'Cutting': [1375], 'Temperature': [1376], 'compound': [1377], '(Tissue-Tek,': [1378], 'Torrance,': [1379], 'CA)': [1380, 1587], '-20': [1382], '°C.': [1383], 'Sagittal': [1384], 'sections': [1385, 1604], '20': [1387, 1889], 'μm': [1388, 1506, 1957, 2065, 2102, 2105, 2135, 3672], 'sliced': [1390], 'placed': [1392], 'onto': [1393], 'gelatin/poly-l-lysine-coated': [1394], 'slides.': [1395], 'slides': [1397, 1446, 1466, 1657], 'treated': [1399], '1%': [1401, 1483, 1622], 'hydrogen': [1402], 'peroxide': [1403], '(H2O2)': [1404], 'phosphate-buffered': [1406, 1425, 1608, 1627, 1653], 'saline,': [1407, 1609], 'blocked': [1408, 1543, 1610], 'avidin/biotin': [1411], 'blocking': [1412, 1545, 1612], 'kit': [1413, 1786], "manufacturer's": [1415], 'instructions': [1416], '(Biomeda,': [1417], 'Foster': [1418], 'City,': [1419], 'CA),': [1420], 'washed': [1423], 'saline/diethyl': [1426], 'pyrocarbonate,': [1427], '100': [1428, 2101, 2104], 'mm': [1429, 1492, 1890, 1895, 1898, 2152, 2175], 'glycine/diethyl': [1430], 'pyrocarbonate': [1431], '0.3%': [1433], 'Triton': [1434, 1620, 1650], 'X-100.': [1435], 'Following': [1436, 1655], 'treatment': [1437], '1': [1439, 1661, 2183], 'μg/ml': [1440, 1496, 1500], 'proteinase': [1441], 'K': [1442], '15': [1444, 2075, 2122], 'min,': [1445, 3518], 'incubated': [1448, 1468, 1525, 1552, 1632, 1659, 2071, 2118], 'followed': [1452], '10-min': [1455], 'incubation': [1456], '0.25%': [1458], 'anhydride': [1459], '0.1': [1461], 'm': [1462, 2180], 'triethanolamine.': [1463], 'For': [1464, 1556, 1943, 2222], 'prehybridization,': [1465, 1515], 'solution': [1471, 1478], '(2×': [1472], 'sodium': [1473, 1476], 'chloride': [1474], 'citrate': [1477], '(SSC),': [1479], '50%': [1480, 3724], 'deionized': [1481], 'formamide,': [1482], 'Sarkosyl,': [1484], '10%': [1485], 'dextran': [1486], 'sulfate,': [1487], '1×': [1488], "Denhardt's": [1489], 'solution,': [1490], '50': [1491, 1505, 2047, 2225], 'phosphate': [1493], 'buffer,': [1494, 2173], '250': [1495, 2064], 'yeast': [1497], 'tRNA,': [1498], '500': [1499, 2168, 2201], 'salmon': [1501], 'sperm': [1502], 'DNA,': [1503], 'dithiothreitol': [1507], '37': [1509, 1528], '°C': [1510, 1529, 1636], '2': [1512, 1953, 1956, 2134, 4673], 'h.': [1513], 'After': [1514], 'biotin-labeled': [1516], 'oligonucleotide': [1517, 2301], 'probes': [1518, 1535, 2302, 2308, 2336, 2353, 2425, 2450], '200': [1520, 1894, 2058, 2095], 'ng/ml': [1521], 'added': [1523, 1975], 'overnight': [1526, 1633], 'humidity': [1532], 'chamber.': [1533], 'Excess': [1534], 'stringent': [1539], 'washes': [1540], 'SSC,': [1542], 'buffer': [1546, 1613, 1644, 1900, 2062, 2099], '(TBT,': [1547], 'PerkinElmer': [1548], 'Life': [1549], 'Sciences),': [1550], 'streptavidin-horseradish': [1554], 'peroxidase.': [1555], 'signal': [1557, 2357], 'detection,': [1558], 'fluorescein': [1559], 'isothiocyanate': [1560], 'cynanine': [1562], '3': [1563], '(Cy3)': [1564], 'Tyramide': [1565], 'Signal': [1566], 'Amplification': [1567], 'system': [1568, 2659, 5052], 'kits': [1569], '(Life': [1572], 'Sciences,': [1573], 'Rockville,': [1574], 'MA).': [1575], 'Samples': [1576, 2194], 'mounted': [1579, 1701], 'using': [1580, 1590, 1702, 1708, 1774, 1783, 1825, 1848, 1879, 2132, 2261, 2292, 2383, 2838, 3281, 3365, 3942], 'Vectashield': [1581, 1703], '4′,6-diamidino-2-phenylindole': [1583], '(Vector': [1584], 'Laboratories,': [1585], 'Burlingame,': [1586], 'analyzed': [1589, 1707, 2007, 2286, 4067], 'Zeiss': [1592, 1710], 'LSM510': [1593], 'confocal': [1594, 1711], 'microscope': [1595], '(Carl': [1596], 'Zeiss,': [1597], 'Gottingen,': [1598], 'Germany).': [1599], 'Immunohistochemistry—The': [1600], '20-μm': [1601], 'sagittal': [1602], 'tissue': [1603], 'rehydrated': [1606], '(5%': [1614], 'serum': [1615, 1624, 1647], 'secondary': [1617, 1666], 'antibody,': [1618, 5205], '0.2%': [1619, 1649], 'X-100,': [1621], 'bovine': [1623, 1646], 'albumin': [1625], 'saline).': [1628, 1654], 'Slides': [1629], '4': [1635, 2138], 'antibody': [1639, 1667, 2263, 2476, 2531, 5216, 5230], 'diluted': [1640], '1:5000': [1641], 'dilution': [1643], '(0.25%': [1645], 'albumin,': [1648], 'X-100': [1651], 'washes,': [1656], 'fluorescently': [1664], 'labeled': [1665], '(Alexa': [1668], 'Fluor': [1669, 1678, 1687], '488': [1670], 'donkey': [1671, 1689], 'antirat': [1672], 'IgG': [1673, 1682], 'anti-WNDP': [1675, 2530, 5202], 'Alexa': [1677, 1686], '555': [1679, 1688], 'goat': [1680], 'anti-rabbit': [1681], 'anti-MNKP': [1684, 1827, 2475, 5215], 'anti-goat': [1690], 'anti-ceruloplasmin': [1692], '(CP),': [1693], 'Molecular': [1694], 'Probes,': [1695], 'Eugene,': [1696], 'OR).': [1697], 'Sections': [1698], 'washed,': [1700], '4′,6-diamidino-2-phenylindole,': [1705], 'scanning': [1712], 'microscope.': [1713], 'Expression': [1714, 1815, 2266, 2830, 3709], 'Sf9': [1720, 1725, 1819, 3363], 'Cells—Expression': [1721], '(16Tsivkovskii': [1731, 1791, 1855, 1919, 2016, 3228, 3316, 3417], 'R.': [1732, 1792, 1856, 1920, 2017, 3229, 3317, 3418], 'Eisses': [1733, 1793, 1857, 1921, 2018, 3230, 3318, 3419], 'J.F.': [1734, 1794, 1858, 1922, 2019, 3231, 3319, 3420], 'Kaplan': [1735, 1795, 1859, 1923, 2020, 3232, 3320, 3421], '277:': [1743, 1803, 1867, 1931, 2028, 3240, 3328, 3429], '976-983Abstract': [1744, 1804, 1868, 1932, 2029, 3241, 3329, 3430], '(93)': [1752, 1812, 1876, 1940, 2037, 3249, 3337, 3438], 'generate': [1756], 'recombinant': [1758, 1779, 3590], 'baculovirus': [1759, 1780], '4.6-kb': [1763], 'full-length': [1764], 'fragment': [1766], 'cloned': [1768], 'pFastBactDual': [1771], 'vector': [1772], '(Invitrogen)': [1773, 1787], 'BamHI': [1775], 'cloning': [1776], 'sites.': [1777], 'generated': [1782], 'Bac-to-Bac': [1785], 'verified': [1822, 3937], 'Western-blotting': [1824], 'rabbit': [1826], 'antibodies': [1828, 3943], 'raised': [1831], 'against': [1832, 3944], 'purified': [1833], 'nucleotide-binding': [1834], 'domain': [1835, 5204], 'MNKP.': [1837, 3568, 4040, 4165, 4917], 'Functional': [1838, 3106, 3701], 'Comparison': [1839], 'WNDP—Phosphorylation': [1843], '[γ-32P]ATP': [1849, 2136], 'performed': [1851, 2128, 3280], 'preparations': [1880, 2054], 'membrane-bound': [1883, 3314, 3379], 'Bis-Tris-propane,': [1891], 'pH': [1892, 2177], '6.0,': [1893], 'KCl,': [1896], '5': [1897, 2154], 'MgCl2': [1899], '(reaction': [1901], 'buffer).': [1902], 'Experiments': [1903], 'measuring': [1905], 'kinetic': [1907, 4713, 4864], 'dependence': [1910, 3598], 'enzyme': [1912, 4255], 'phosphorylation': [1913, 2005, 2126, 3396, 3498, 3508, 3601, 4728], 'conducted': [1915], 'published': [1917], 'before': [1918], 'dephosphorylation': [1945, 3524, 4730], 'first': [1950, 4672], 'phosphorylated': [1951], 'min': [1954, 2084, 2123, 2139, 2199, 2217, 3537, 3543], '[γ-32P]ATP,': [1958], 'aliquot': [1961], 'reaction': [1963, 1981, 2061, 2098], 'taken': [1965], 'zero': [1968], 'time': [1969, 1990, 3574], 'point.': [1970], 'Cold': [1971], '25': [1977, 2174], 'μm,': [1978, 3629, 3678], 'allowed': [1983], 'proceeded': [1985], 'ice': [1987, 2073, 2120], 'intervals': [1991], 'indicated': [1992, 2111], 'Fig.': [1994, 2113, 3491], '3C.': [1995], 'acid-precipitated,': [2000], 'level': [2003], 'gel': [2009, 4071], 'electrophoresis': [2010], 'autoradiography': [2012], 'compare': [2041, 2545, 3207], 'dependences': [2043, 3575], 'phosphorylation,': [2046, 3661], 'μg': [2048, 2226, 2236], 'WNDP-': [2050], 'MNKP-containing': [2052, 4030], 'resuspended': [2056, 2093], 'μl': [2059, 2096, 2169], 'plus': [2063], 'bathocuproinedisulfonic': [2066], 'acid': [2067], 'disodium': [2068], 'salt': [2069], 'min.': [2076], 'Then': [2077], 'mixture': [2078, 2116, 2190], 'spun': [2080], 'down': [2081], '20,000': [2086, 2219], '×': [2087, 2153, 2202, 2220], 'g,': [2088], 'pellet': [2091, 2205], 'containing': [2100], 'ascorbate,': [2103], 'Tris(2-chloroethyl)': [2106], 'phosphate,': [2107], 'CuCl2': [2109], '4.': [2114], 'above': [2131], 'ice.': [2141], 'Detection': [2142], 'ApoCP': [2144], 'Holo-CP': [2146], 'Blotting—Liver': [2149], 'pieces': [2150], '(5': [2151], 'mm)': [2155], 'whole': [2157], 'homogenized': [2166], 'homogenization': [2172], 'imidazole,': [2176], '7.4,': [2178], '0.25': [2179, 3517], 'tablet': [2184], 'Roche': [2186], 'complete': [2187], 'protease': [2188], 'inhibitor': [2189], '(Roche': [2191], 'Applied': [2192], 'Science).': [2193], 'centrifuged': [2196, 2214], 'g.': [2203, 2221], 'discarded,': [2207], 'soluble': [2210, 2228], 'portion': [2211, 2229], 'further': [2213, 3195, 4636, 4665, 4881], '30': [2216], 'samples,': [2224], 'used,': [2231], '60': [2235], 'fraction': [2239], 'utilized': [2241, 2313, 3780, 4046], 'separation': [2243], '4–20%': [2245], 'Trisglycine': [2246], 'gels': [2247], '(Invitrogen).': [2248], 'Proteins': [2249], 'transferred': [2251], 'polyvinylidene': [2253], 'difluoride': [2254], 'membranes': [2255], '(Millipore,': [2256], 'Bedford,': [2257], 'MA)': [2258], 'immunostained': [2260], 'anti-CP': [2262], '(Sigma).': [2264], 'Adult': [2272], 'Cerebellum': [2273], 'Is': [2274, 2833], 'Cell-specific—To': [2275], 'determine': [2276, 2733], 'mRNAs': [2291], 'tyramide': [2297], 'amplification.': [2298], 'Three': [2299], 'non-overlapping': [2300, 4890], 'mRNA': [2305, 2311, 2397, 2542, 2552, 2955, 2979, 3874, 4367, 4375], '(Table': [2314, 2332], 'I).': [2315], 'Probes': [2316], 'corresponding': [2317, 4057], 'reverse': [2320], 'sequence': [2321, 3725], 'sense': [2324], 'strain': [2325], 'negative': [2330, 2453], 'control': [2331, 2352, 2385, 2454, 4380], 'II).': [2333], 'All': [2334], 'antisense': [2335], 'mRNA,': [2339], 'together': [2341], 'individually,': [2343], 'produced': [2344, 2532, 4429], 'staining': [2345, 2380, 2535, 2777, 2790, 3049, 3098, 3182, 3981, 4995], 'characteristic': [2346, 2533], 'yielded': [2354, 4345], 'no': [2355, 2378, 2788, 2811, 4791], 'detectable': [2356, 2789], '(Fig.': [2358, 2387, 2489, 2512, 2543, 2591, 2794, 2990, 3029, 3054, 3078, 3415, 3549, 3648, 3696, 3880, 3977, 4102], '1A).': [2359], 'contrast,': [2361, 3069, 3883, 4130], 'WNDP-related': [2363], 'signals': [2364], 'evident': [2366], '(PN),': [2370], 'quite': [2371], 'distinctive': [2372], '(BG),': [2376], 'detected': [2382, 3020, 4419, 4440], 'probe': [2386], '1B).': [2388], 'difference': [2391, 4754], 'patterns': [2398, 2935, 3087, 4348], 'strongly': [2399, 2801, 5183], 'pointed': [2400, 2841], 'cell-type': [2403], 'cerebellum.Table': [2412], 'IOligonucleotide': [2413], 'primers': [2414, 2440], 'experiments': [2421, 2447, 2761, 2948, 3196, 3278, 3607, 3865, 3941], 'Sequence': [2422, 2448], 'anti-sense': [2424], 'hybridization.ProbeSequenceMnkP1GATCATTTCTTCATTACTCATGTTCTGATTATGGTGAAGAGTTGCAAGGTGMnkP2GCATCAATTTGAACCAGGGATGCATTTTTAATGTTATTTTCTTCTATCTTCAMnkP3ACTCCTCTGTCCTGTGTGGCTCCGGGGATGCAACTCATAATTGTCATACGTWndP1CCCCAGGGTCTCAAAATGATTGGAAATCTGGACAGGAGAGACCGTCTCTTWndP2ACTCAGGGGCTTCATGCGGCCGTGGGCCTGGGCCTCATATCTCTCTAGGTC': [2431], 'Open': [2432, 2460], 'table': [2433, 2461], 'new': [2436, 2464, 4327], 'tab': [2437, 2465], 'Table': [2438], 'IIOligonucleotide': [2439], 'hybridization.ProbeSequenceMnkP1CTAGTAAAGAAGTAATGAGTACAAGACTAATACCACTTCTCAACGTTCCACMnkP2CGTAGTTAAACTTGGTCCCTACGTAAAAATTACAATAAAAGAAGATAGAATMnkP3ACTCCTCTGTCCTGTGTGGCTCCGGGGATGCAACTCATAATTGTCATACGTWndP1GGGGTCCCAGAGTTTTACTAACCTTTAGACCTGTCCTGTCTGGCAGAGAAAWndP2TGAGTCCCCGAAGTACGCCGGCACCCGGACCCGGAGTATAGAGAGATCCG': [2459], 'This': [2466, 2491, 2891, 3754, 4231, 4644], 'result': [2467, 4934, 5104], 'confirmed': [2469, 4334], 'immunohistochemistry': [2472, 5219], 'stained': [2477], 'small': [2478], 'bodies': [2480], 'along': [2481, 4683], 'layer,': [2484], 'expected': [2486], 'BG': [2488, 2509, 4347, 4360, 4422, 4501, 4515, 4544], '1C).': [2490, 2513], 'pattern': [2492, 2539, 2554], 'identical': [2495, 2536, 3382, 3496, 3617], 'immunostaining': [2498], 'SK3': [2501], 'potassium': [2502], 'channel,': [2503], 'which': [2504, 2649, 2734, 3137, 3163, 3348, 3400, 4344, 4484, 4781, 4879, 4962, 5040], 'largely': [2506], 'restricted': [2507, 2881, 3876], '2J.': [2514], 'Adelman,': [2515], 'personal': [2516], 'communication.': [2517], 'presence': [2519, 3115, 3918], 'similarly': [2527], 'verified.': [2528], '1,': [2544], 'C': [2546], 'D)': [2548], 'marker,': [2558], 'glutamate': [2560], 'mEAAT1': [2562], '(17Amara': [2563], 'S.G.': [2564], 'Fontana': [2565], 'A.C.': [2566], 'Neurochem.': [2567], 'Int.': [2568], '41:': [2570], '313-318Crossref': [2571], '(204)': [2574], '18Sutherland': [2577], 'M.L.': [2578], 'Delaney': [2579], 'T.A.': [2580], 'Noebels': [2581], 'J.L.': [2582], 'Neurosci.': [2584, 2700, 5093], '16:': [2586], '2191-2207Crossref': [2587], '1D).': [2592, 2795], 'Thus,': [2593, 4151], 'present': [2607, 2778, 2981, 3073, 3902, 4216, 4490], 'neurons.': [2610, 3147, 4317, 5016], 'Co-expression': [2611, 2796], 'Ceruloplasmin': [2613, 5034], 'Points': [2614], 'Biosynthetic': [2617], 'Function': [2618], 'WNDP—One': [2620], 'deliver': [2633, 4286], 'incorporation': [2640], 'CP': [2644, 2745, 2767, 2800, 2807, 3708, 3833, 3847, 3887, 3900, 3913, 3932, 3945, 3949, 3965, 4000, 4022, 4038, 4051, 4256, 4924, 4940, 4976, 4990, 5006, 5010, 5103, 5129, 5154], 'ferroxidase,': [2648], '(19Harris': [2660, 5053], 'Z.L.': [2661, 5054], 'Takahashi': [2662, 5055], 'Miyajima': [2664, 5057], 'Serizawa': [2666, 5059], 'MacGillivray': [2668, 5061], 'R.T.': [2669, 5062], 'J.D.': [2671, 2720, 4075, 5064], 'Proc.': [2672, 4598, 5065], 'Natl.': [2673, 4599, 5066], 'Acad.': [2674, 4600, 5067], 'Sci.': [2675, 4601, 5068], 'U.': [2676, 4602, 5069], '1995;': [2679, 4535, 4573, 5072], '92:': [2680, 5073], '2539-2543Crossref': [2681, 5074], '(515)': [2684, 5077], '20Patel': [2687, 5080], 'B.N.': [2688, 5081], 'Dunn': [2689, 5082], 'Jeong': [2691, 5084], 'S.Y.': [2692, 5085], 'Zhu': [2693, 5086], 'Q.': [2694, 5087], 'Julien': [2695, 5088], 'David': [2697, 5090], '22:': [2702, 5095], '6578-6586Crossref': [2703, 5096], 'synthesized': [2709], '(21Klomp': [2713], 'L.W.': [2714], 'Farhangrazi': [2715], 'Z.S.': [2716], 'Dugan': [2717], 'L.L.': [2718], 'Investig.': [2723], '98:': [2725], '207-215Crossref': [2726], '(175)': [2729], 'compared': [2748, 2932, 3370, 3538, 3673, 4147], 'cerebellar': [2750, 5176], 'CP.': [2759], 'Our': [2760, 4190], 'revealed': [2762, 2949, 3608, 3866], 'primarily': [2770], 'weaker': [2776], 'basket': [2781], 'granular': [2785], 'layer': [2786], 'but': [2787, 4259, 4622, 4836], 'suggests': [2802, 4715, 4949], 'participates': [2805], 'biosynthesis.': [2808], 'We': [2809, 2930, 3819, 4208, 4274, 4443, 5193, 5256], 'co-localization': [2812, 3957, 4251], 'suggesting': [2817, 2992, 3099, 3683, 3911], 'WNDP.': [2828, 3214, 3490, 4685, 4734], 'Developmentally': [2834], 'Regulated—': [2835], 'Previous': [2836, 3215], '13-day-old': [2839], '(22Murata': [2848], 'Kodama': [2850, 4455], 'Abe': [2852, 4461], 'Ishida': [2854], 'Levinson': [2858], 'B.': [2859], 'Pediatr.': [2864], '42:': [2867], '436-442Crossref': [2868], '(74)': [2871], 'contrast': [2875], 'finding': [2878], 'mice.': [2890, 3067], 'apparent': [2892, 3611, 4768, 4812], 'discrepancy': [2893], 'could': [2894, 3138, 4782], 'be': [2895, 3139, 3468, 3479, 3851, 4439, 4783], 'because': [2896, 4114, 4723, 5001], 'changes': [2899, 4477], 'occurring': [2900], 'expression.': [2903, 3041, 3105, 4991], 'test': [2905, 4042], 'this': [2906, 3201, 3777, 4043, 4224, 4482, 5021, 5190], 'possibility': [2907], '2nd': [2919], '(P2),': [2920], '13th': [2921], '(P13),': [2922], '18th': [2924], '(P18)': [2925], 'day': [2926, 4504], 'same': [2945, 3732], 'stages.': [2946], 'markedly': [2950, 3188, 3282], 'different': [2951, 3143, 3160, 3189, 3283, 3343, 4863], 'distributions': [2952], 'showed': [2963], 'At': [2976, 3730], 'P2,': [2977], 'neurons,': [2984, 3046, 3136, 4248, 4980], '2),': [2991, 3079], 'early': [2995, 3124], 'growth': [2996], 'require': [3002, 4833], 'functioning': [3004], 'ATPases.': [3008], 'P6': [3022], '(our': [3023, 5170], 'data,': [3024, 5171], 'not': [3025, 3186, 3580, 3762, 4124, 4260, 4695, 4832, 5172], 'shown)': [3026, 5173], 'P13': [3028], '2).': [3030], 'However': [3031], 'later,': [3032], 'P18,': [3034], 'occurs': [3038, 4502, 4931], 'addition': [3043, 3859, 4356], 'appears': [3050], '2,': [3055], 'arrow)': [3056], 'confined': [3059], 'exclusively': [3060], 'consistently': [3072], 'throughout': [3076], 'only': [3082, 4110, 4875], 'seen': [3084], 'age-dependent': [3092], 'decrease': [3093], 'intensity': [3096], 'age-related': [3101], 'down-regulation': [3102, 5004], 'Properties': [3107], 'Are': [3112], 'Distinct—': [3113], 'points': [3126, 5184], 'complementary': [3128], 'subcellular': [3144], 'location': [3145], 'Alternatively,': [3148], 'might': [3152], 'affinities': [3155], 'substrate': [3158, 3643, 3656], 'and/or': [3159], 'efficiency,': [3162], 'would': [3164, 3826, 4033, 4645], 'help': [3165, 5249], 'achieve': [3167], 'more': [3169, 3689], 'fine': [3170], 'tuned': [3171], 'copper.': [3175, 4409, 4750, 4766], 'Examination': [3176], 'did': [3185], 'reveal': [3187], 'proteins,': [3193], 'although': [3194], 'necessary': [3198], 'verify': [3200, 3570], 'conclusion.': [3202], 'Consequently,': [3203], 'decided': [3205], 'characteristics': [3210, 3372, 4267], 'suggested': [3218], 'may': [3221, 3686, 4377, 4837], 'higher': [3223, 3556, 4811], 'turnover': [3224, 3485, 3558, 4809], 'rate': [3225, 3559], '23Voskoboinik': [3252, 3441], 'Mar': [3254, 3291, 3443], '2001;': [3263, 3300, 3452], '276:': [3264, 3301, 3453], '28620-28627Abstract': [3265, 3302, 3454], '(109)': [3273, 3310, 3462], 'However,': [3276, 3863], 'conditions': [3284, 3497, 3693], '(detergent-solubilized': [3285], 'immunoprecipitated': [3287], '(23Voskoboinik': [3289], 'versus': [3313], 'Scholar))': [3339], 'types,': [3345], 'all': [3346], 'preclude': [3349], 'accurate': [3350], 'comparison.': [3351], 'overcome': [3353], 'problems,': [3355], 'baculovirus-mediated': [3366], 'infection': [3367], 'form': [3380], 'under': [3381, 3495, 3691, 4849], 'conditions.': [3383, 4851], 'steps': [3386, 3466], 'cycle': [3393], 'transient': [3395], 'dephosphorylation,': [3399], 'coupled,': [3402], 'respectively,': [3403, 3679], 'binding': [3406], 'release': [3408], 'intramembrane': [3413], 'sites': [3414], '3A)': [3416], 'can': [3467, 3478], 'monitored': [3469], 'vitro,': [3471], 'kinetics': [3474], 'reactions': [3477, 3578], 'assess': [3482], 'relative': [3484], '3B': [3492], 'illustrates': [3493], '∼6-fold': [3504], '(t½': [3509, 3532], '=': [3510, 3520, 3533, 3547, 3631, 3681], '0.095': [3511], '+': [3512, 3516, 3535, 3541, 3623, 3627], '0.018': [3513], '0.59': [3515], 'n': [3519, 3546, 3630, 3680], '4,': [3521], 'respectively).': [3522], 'step': [3525], 'considerably': [3528, 4731], '0.35': [3534], '0.14': [3536], '1.85': [3540], '0.7': [3542, 3677], '4)': [3548], '3C).': [3550], 'significantly': [3555, 4838], '(and': [3563], 'hence': [3564], 'transport)': [3566], 'partial': [3577], 'due': [3581], 'potential': [3583, 5187], 'folding': [3588], 'characterized': [3595], 'Km': [3612, 3652, 4769], '(1.1': [3622, 3669], '0.3': [3624], '1.0': [3626], '0.4': [3628], '3,': [3632], 'respectively),': [3633, 4249], 'indicating': [3634], 'bind': [3640, 3687], 'equally': [3645], 'high': [3646, 4834, 4843], 'affinity': [3647, 4764, 4813, 4844], '4A).': [3649], 'Interestingly,': [3650, 4354], 'another': [3655], 'activation': [3659], 'lower': [3663, 4776, 4808], '±': [3670, 3676], '0.2': [3671], '2.4': [3675], '5)': [3682], 'efficiently': [3690], 'copper-limiting': [3692, 4850], '4B).': [3697], 'Lack': [3699], 'Results': [3703], 'Switch': [3706], 'Neurons': [3712], 'Glia—MNKP': [3715], 'structurally': [3719], 'similar': [3721], 'sharing': [3722], 'over': [3723], 'identity': [3726], '(53%': [3727], 'mice).': [3729], 'time,': [3733], 'distribution,': [3742], 'differ': [3743], 'profiles,': [3748], 'properties.': [3753], 'raises': [3755], 'question': [3757], 'whether': [3760], 'there': [3763, 4138, 4788], 'any': [3765], 'redundancy': [3767], 'transporters': [3771], 'cerebellum.': [3774, 4207, 4899], 'issue': [3778], 'lack': [3785, 3987, 4154, 5146, 5158], 'hypothesized': [3820], 'inactivation': [3823], 'disrupt': [3827], 'and,': [3837], 'therefore,': [3838], 'restore': [3842, 4034], 'instead': [3855], '(or': [3857], 'to)': [3860], 'mice,': [3871, 3899, 3910, 4137, 4909], 'remains': [3875], '5).': [3881], 'clearly': [3889, 4100], 'changed.': [3890], 'Unlike': [3891], 'predominantly': [3903], 'depends': [3915], 'copper-ATPase': [3922], 'cell.': [3925], 'switch': [3927, 3995, 4493], 'double': [3939], 'labeling': [3940], 'marker': [3954], 'SK3.': [3955], 'Clear': [3956], 'SK3,': [3967], '6A).': [3978], 'No': [3979], 'evident,': [3983], 'confirming': [3984], 'activity': [3990], 'transporter,': [4011, 4722], 'active.': [4014], 'seemed': [4016], 'likely': [4017, 4163, 4299, 5151], 'WNDP-deficient': [4026, 4979, 5015], 'hypothesis': [4044], 'property': [4049], 'produce': [4053], 'bands': [4056], 'copper-bound': [4060], '(holo-CP)': [4061], 'unbound': [4063], 'forms': [4064], '(apoCP),': [4065], 'when': [4066, 4508], 'non-reducing': [4070], '(24Sato': [4072], '1991;': [4079], '266:': [4080], '5128-5134Abstract': [4081], 'holo-CP': [4095, 4146], 'apoCP': [4097, 4111], 'visible': [4101], '6B).': [4103], 'expected,': [4105], 'detected,': [4113], 'inactivated,': [4120], 'liver.': [4128], 'amount': [4144, 4426], 'wild-type.': [4150], 'despite': [4152], 'delivered': [4159, 4616], 'most': [4162, 4413, 5150], 'Defects': [4166], 'consequences': [4172], 'function;': [4175], 'however,': [4176, 4698], 'shed': [4192], 'light': [4193], 'transporters,': [4201], 'demonstrated': [4209, 4487], 'region': [4225], 'distinct.': [4230], 'conclusion': [4232], 'based': [4234], '(i)': [4236], '(in': [4243, 4339], '(ii)': [4250], '(iii)': [4264], 'transporters.': [4273], 'propose': [4275], 'major': [4278, 4656], 'perhaps': [4308], 'export': [4311, 4662, 4747], 'finding.': [4330], 'independent': [4337], 'methods': [4338], 'immunohistochemistry),': [4343], 'consistent': [4346, 4819], 'resolution.': [4353], 'bodies,': [4362], 'see': [4365], 'processes': [4370], 'BG.': [4372], 'facilitate': [4378], 'local': [4379], 'synthesis': [4383], 'response': [4385], 'environmental': [4387], 'cues': [4388], '(25Mothe': [4389], 'A.J.': [4390], 'Brown': [4391], 'I.R.': [4392], 'Brain': [4393, 4396], '76:': [4399], '73-84Crossref': [4400], '(15)': [4403], 'such': [4406], 'elevated': [4408], 'Under': [4410], 'standard': [4411], 'conditions,': [4412], 'bodies.': [4424], 'processes,': [4431], 'if': [4432], 'any,': [4433], 'apparently': [4435], 'too': [4436], 'low': [4437], 'immunohistochemistry.': [4442], 'attribute': [4444], 'reported': [4447], '(26Murata': [4453], 'Mori': [4457], 'Kobayashi': [4459], 'Inherit.': [4464], 'Metab.': [4465], 'Dis.': [4466], '21:': [4468], '199-202Crossref': [4469], '(16)': [4472], 'directly': [4486], 'work.': [4491, 5255], 'around': [4503], '18': [4505], 'development,': [4507], 'formation': [4510], 'close': [4512], 'connections': [4513], 'being': [4519], 'completed': [4520], '(27Reichenbach': [4521, 4559], 'Siegel': [4523, 4561], 'Rickmann': [4525, 4563], 'Wolff': [4527, 4565], 'J.R.': [4528, 4566], 'Noone': [4529, 4567], 'Robinson': [4531, 4569], 'S.R.': [4532, 4570], 'Hirnforsch.': [4534, 4572], '36:': [4536, 4574], '509-517PubMed': [4537, 4575], 'insulate': [4545], 'maintaining': [4547], 'structure': [4549], 'supplying': [4553], 'trophic': [4554], 'factors': [4555], '28Furuya': [4578], 'Tabata': [4580], 'Mitoma': [4582], 'Yamada': [4584], 'Yamasaki': [4586], 'Makino': [4588], 'Yamamoto': [4590], 'Watanabe': [4592], 'Kano': [4594], 'Hirabayashi': [4596], '97:': [4606], '11528-11533Crossref': [4607], '(164)': [4610], 'How': [4613], 'unknown,': [4621], 'tempting': [4625], 'speculate': [4627], 'exports': [4633], 'utilization': [4637, 4666], 'specifically': [4641], 'PN.': [4643], 'parallel': [4646], 'intestinal': [4652], 'epithelia,': [4653], 'tissues.': [4669], 'During': [4670], 'after': [4675], 'birth,': [4676], 'found': [4679], 'mainly': [4680], 'Why': [4686], 'needed': [4690], 'yet': [4696], 'clear;': [4697], 'comparison': [4700], 'properties': [4704, 4757, 4865], 'offers': [4709], 'some': [4710], 'clues.': [4711], 'measurement': [4714], 'undergoes': [4725], 'Therefore,': [4735, 4900], 'hypothesize': [4737], 'homeostatic': [4743], 'mediating': [4745], 'efficient': [4746], 'Another': [4751], 'potentially': [4752], '2–3-fold': [4775], 'significant': [4784, 4904, 4950], 'vivo': [4786], 'free': [4792], '(29Prohaska': [4794], 'Gybina': [4796], 'A.A.': [4797], 'Nutr.': [4799], '135:': [4801], '1003-1006Crossref': [4802], '(242)': [4804], 'metal': [4825], 'does': [4831], 'throughput': [4835], 'depend': [4839], 'relatively': [4842], 'emphasize': [4856], 'that,': [4857], 'currently,': [4858], 'proposed': [4860], 'attractive': [4877], 'hypothesis,': [4878], 'requires': [4880], 'testing.': [4882], 'Altogether,': [4883], 'point': [4886], 'seems': [4902], 'particularly': [4903], 'compensation': [4913], 'restoration': [4919], 'interdependence': [4952], 'metabolism': [4955], 'cells.': [4958], 'accumulation': [4967, 5107], 'disrupted': [4972], 'communicated': [4982], 'resulting': [4986], 'induction': [4988], 'Simultaneously,': [4992], 'CP-related': [4994], 'disappears': [4996], 'coordinated': [5003], 'diminished': [5009], 'mRNA/protein': [5011], 'stability': [5012], 'Dissecting': [5017], 'mechanism': [5019], 'unexpected': [5022], 'interesting': [5024], 'phenomenon': [5025], 'goal': [5029], 'future': [5032], 'studies.': [5033], 'enzyme,': [5039], 'Genetic': [5100], 'defects': [5101], '(30Miyajima': [5115], 'Neuropathology.': [5117], '23:': [5119], '345-350Crossref': [5120], '(108)': [5123], 'co-expression': [5127], 'compensating': [5143], 'restoring': [5152], 'conspicuous': [5157], 'abnormalities': [5162], 'infrequent': [5175], "Wilson's": [5180], 'patients': [5182], 'importance': [5188], 'compensation.': [5192], 'thank': [5194, 5257], 'Mee': [5195], 'Min': [5196], 'N-terminal': [5203], 'Dr.': [5206, 5234, 5242, 5246, 5263, 5266, 5270], 'Betty': [5207], 'kind': [5211], 'gift': [5212], 'Drs.': [5221], 'John': [5222], 'Adelman': [5223], 'Chris': [5225], 'Bond': [5226], 'anti-SK3': [5229], 'helpful': [5232, 5278], 'discussions,': [5233], 'Michael': [5235], 'Petris': [5236], 'cDNA,': [5240], 'Gary': [5243], 'Banker': [5244], 'Ryabinin': [5247], 'advice': [5251], 'members': [5258], 'laboratory,': [5261], 'Craig': [5264], 'Jahr,': [5265], 'Jack': [5267], 'Kaplan,': [5268], 'Elaine': [5271], 'Lewis': [5272], 'reading': [5274], 'manuscript': [5276], 'comments.': [5279]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W2007131731', 'counts_by_year': [{'year': 2024, 'cited_by_count': 13}, {'year': 2023, 'cited_by_count': 3}, {'year': 2022, 'cited_by_count': 6}, {'year': 2021, 'cited_by_count': 8}, {'year': 2020, 'cited_by_count': 10}, {'year': 2019, 'cited_by_count': 11}, {'year': 2018, 'cited_by_count': 10}, {'year': 2017, 'cited_by_count': 7}, {'year': 2016, 'cited_by_count': 6}, {'year': 2015, 'cited_by_count': 8}, {'year': 2014, 'cited_by_count': 5}, {'year': 2013, 'cited_by_count': 8}, {'year': 2012, 'cited_by_count': 13}], 'updated_date': '2025-01-04T18:06:11.537842', 'created_date': '2016-06-24'}
Publication Information

Basic Information

Access and Citation

AI Researcher Chatbot

Primary Location

Authors

Topics

Keywords

Related Works
