Publication Information

{'id': 'https://openalex.org/W1999997395', 'doi': 'https://doi.org/10.1074/jbc.m306413200', 'title': 'The Export of Coat Protein from Enteroaggregative Escherichia coli by a Specific ATP-binding Cassette Transporter System', 'display_name': 'The Export of Coat Protein from Enteroaggregative Escherichia coli by a Specific ATP-binding Cassette Transporter System', 'publication_year': 2003, 'publication_date': '2003-11-01', 'ids': {'openalex': 'https://openalex.org/W1999997395', 'doi': 'https://doi.org/10.1074/jbc.m306413200', 'mag': '1999997395', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/12933818'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m306413200', 'pdf_url': 'http://www.jbc.org/article/S0021925820823291/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S0021925820823291/pdf', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5073533078', 'display_name': 'Junichiro Nishi', 'orcid': 'https://orcid.org/0000-0002-2839-9434'}, 'institutions': [{'id': 'https://openalex.org/I126744593', 'display_name': 'University of Maryland, Baltimore', 'ror': 'https://ror.org/04rq5mt64', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I126744593']}], 'countries': ['US'], 'is_corresponding': True, 'raw_author_name': 'Junichiro Nishi', 'raw_affiliation_strings': ['Center for Vaccine Development, Departments of Pediatrics, University of Maryland School of Medicine, Baltimore, Maryland 21201'], 'affiliations': [{'raw_affiliation_string': 'Center for Vaccine Development, Departments of Pediatrics, University of Maryland School of Medicine, Baltimore, Maryland 21201', 'institution_ids': ['https://openalex.org/I126744593']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5082843886', 'display_name': 'Jalaluddin Sheikh', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I126744593', 'display_name': 'University of Maryland, Baltimore', 'ror': 'https://ror.org/04rq5mt64', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I126744593']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Jalaluddin Sheikh', 'raw_affiliation_strings': ['Center for Vaccine Development, Departments of Pediatrics, University of Maryland School of Medicine, Baltimore, Maryland 21201'], 'affiliations': [{'raw_affiliation_string': 'Center for Vaccine Development, Departments of Pediatrics, University of Maryland School of Medicine, Baltimore, Maryland 21201', 'institution_ids': ['https://openalex.org/I126744593']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5061134485', 'display_name': 'Kenji Mizuguchi', 'orcid': 'https://orcid.org/0000-0003-3021-7078'}, 'institutions': [{'id': 'https://openalex.org/I241749', 'display_name': 'University of Cambridge', 'ror': 'https://ror.org/013meh722', 'country_code': 'GB', 'type': 'education', 'lineage': ['https://openalex.org/I241749']}], 'countries': ['GB'], 'is_corresponding': False, 'raw_author_name': 'Kenji Mizuguchi', 'raw_affiliation_strings': ['Department of Biochemistry, University of Cambridge, 80 Tennis Court Rd., Cambridge CB2 1GA, United Kingdom'], 'affiliations': [{'raw_affiliation_string': 'Department of Biochemistry, University of Cambridge, 80 Tennis Court Rd., Cambridge CB2 1GA, United Kingdom', 'institution_ids': ['https://openalex.org/I241749']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5030349470', 'display_name': 'Ben F. Luisi', 'orcid': 'https://orcid.org/0000-0003-1144-9877'}, 'institutions': [{'id': 'https://openalex.org/I241749', 'display_name': 'University of Cambridge', 'ror': 'https://ror.org/013meh722', 'country_code': 'GB', 'type': 'education', 'lineage': ['https://openalex.org/I241749']}], 'countries': ['GB'], 'is_corresponding': False, 'raw_author_name': 'Ben Luisi', 'raw_affiliation_strings': ['Department of Biochemistry, University of Cambridge, 80 Tennis Court Rd., Cambridge CB2 1GA, United Kingdom'], 'affiliations': [{'raw_affiliation_string': 'Department of Biochemistry, University of Cambridge, 80 Tennis Court Rd., Cambridge CB2 1GA, United Kingdom', 'institution_ids': ['https://openalex.org/I241749']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5080223675', 'display_name': 'Valerie Burland', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I135310074', 'display_name': 'University of Wisconsin–Madison', 'ror': 'https://ror.org/01y2jtd41', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I135310074']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Valerie Burland', 'raw_affiliation_strings': ['Laboratory for Molecular and Computational Genomics, University of Wisconsin-Madison, Madison, Wisconsin 53706'], 'affiliations': [{'raw_affiliation_string': 'Laboratory for Molecular and Computational Genomics, University of Wisconsin-Madison, Madison, Wisconsin 53706', 'institution_ids': ['https://openalex.org/I135310074']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5059284128', 'display_name': 'Adam T. Boutin', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I135310074', 'display_name': 'University of Wisconsin–Madison', 'ror': 'https://ror.org/01y2jtd41', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I135310074']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Adam Boutin', 'raw_affiliation_strings': ['Laboratory for Molecular and Computational Genomics, University of Wisconsin-Madison, Madison, Wisconsin 53706'], 'affiliations': [{'raw_affiliation_string': 'Laboratory for Molecular and Computational Genomics, University of Wisconsin-Madison, Madison, Wisconsin 53706', 'institution_ids': ['https://openalex.org/I135310074']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5110244305', 'display_name': 'Debra J. Rose', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I135310074', 'display_name': 'University of Wisconsin–Madison', 'ror': 'https://ror.org/01y2jtd41', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I135310074']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Debra J. Rose', 'raw_affiliation_strings': ['Laboratory for Molecular and Computational Genomics, University of Wisconsin-Madison, Madison, Wisconsin 53706'], 'affiliations': [{'raw_affiliation_string': 'Laboratory for Molecular and Computational Genomics, University of Wisconsin-Madison, Madison, Wisconsin 53706', 'institution_ids': ['https://openalex.org/I135310074']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5041204845', 'display_name': 'Frederick R. Blattner', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I135310074', 'display_name': 'University of Wisconsin–Madison', 'ror': 'https://ror.org/01y2jtd41', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I135310074']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Frederick R. Blattner', 'raw_affiliation_strings': ['Laboratory for Molecular and Computational Genomics, University of Wisconsin-Madison, Madison, Wisconsin 53706'], 'affiliations': [{'raw_affiliation_string': 'Laboratory for Molecular and Computational Genomics, University of Wisconsin-Madison, Madison, Wisconsin 53706', 'institution_ids': ['https://openalex.org/I135310074']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5111510413', 'display_name': 'James P. Nataro', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I126744593', 'display_name': 'University of Maryland, Baltimore', 'ror': 'https://ror.org/04rq5mt64', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I126744593']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'James P. Nataro', 'raw_affiliation_strings': ['Center for Vaccine Development, Departments of Pediatrics, University of Maryland School of Medicine, Baltimore, Maryland 21201', 'Center for Vaccine Development, Medicine, University of Maryland School of Medicine, Baltimore, Maryland 21201', 'Microbiology & Immunology, University of Maryland School of Medicine, Baltimore, Maryland 21201'], 'affiliations': [{'raw_affiliation_string': 'Center for Vaccine Development, Medicine, University of Maryland School of Medicine, Baltimore, Maryland 21201', 'institution_ids': ['https://openalex.org/I126744593']}, {'raw_affiliation_string': 'Center for Vaccine Development, Departments of Pediatrics, University of Maryland School of Medicine, Baltimore, Maryland 21201', 'institution_ids': ['https://openalex.org/I126744593']}, {'raw_affiliation_string': 'Microbiology & Immunology, University of Maryland School of Medicine, Baltimore, Maryland 21201', 'institution_ids': ['https://openalex.org/I126744593']}]}], 'institution_assertions': [], 'countries_distinct_count': 2, 'institutions_distinct_count': 3, 'corresponding_author_ids': ['https://openalex.org/A5073533078'], 'corresponding_institution_ids': ['https://openalex.org/I126744593'], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 5.312, 'has_fulltext': True, 'fulltext_origin': 'pdf', 'cited_by_count': 172, 'citation_normalized_percentile': {'value': 0.933546, 'is_in_top_1_percent': False, 'is_in_top_10_percent': True}, 'cited_by_percentile_year': {'min': 97, 'max': 98}, 'biblio': {'volume': '278', 'issue': '46', 'first_page': '45680', 'last_page': '45689'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T10943', 'display_name': 'Escherichia coli research studies', 'score': 0.9997, 'subfield': {'id': 'https://openalex.org/subfields/1310', 'display_name': 'Endocrinology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, 'topics': [{'id': 'https://openalex.org/T10943', 'display_name': 'Escherichia coli research studies', 'score': 0.9997, 'subfield': {'id': 'https://openalex.org/subfields/1310', 'display_name': 'Endocrinology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T10147', 'display_name': 'Antibiotic Resistance in Bacteria', 'score': 0.9992, 'subfield': {'id': 'https://openalex.org/subfields/1313', 'display_name': 'Molecular Medicine'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T10570', 'display_name': 'Drug Transport and Resistance Mechanisms', 'score': 0.9982, 'subfield': {'id': 'https://openalex.org/subfields/2730', 'display_name': 'Oncology'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/enteroaggregative-escherichia-coli', 'display_name': 'Enteroaggregative Escherichia coli', 'score': 0.9106496}, {'id': 'https://openalex.org/keywords/inner-membrane', 'display_name': 'Inner membrane', 'score': 0.58629847}], 'concepts': [{'id': 'https://openalex.org/C2777587559', 'wikidata': 'https://www.wikidata.org/wiki/Q1344595', 'display_name': 'Enteroaggregative Escherichia coli', 'level': 5, 'score': 0.9106496}, {'id': 'https://openalex.org/C146587185', 'wikidata': 'https://www.wikidata.org/wiki/Q258248', 'display_name': 'Bacterial outer membrane', 'level': 4, 'score': 0.8816986}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.7303434}, {'id': 'https://openalex.org/C203075996', 'wikidata': 'https://www.wikidata.org/wiki/Q139677', 'display_name': 'Operon', 'level': 4, 'score': 0.67874503}, {'id': 'https://openalex.org/C60987743', 'wikidata': 'https://www.wikidata.org/wiki/Q1460232', 'display_name': 'Virulence', 'level': 3, 'score': 0.6703114}, {'id': 'https://openalex.org/C44312359', 'wikidata': 'https://www.wikidata.org/wiki/Q286958', 'display_name': 'ATP-binding cassette transporter', 'level': 4, 'score': 0.6520707}, {'id': 'https://openalex.org/C65871279', 'wikidata': 'https://www.wikidata.org/wiki/Q42884945', 'display_name': 'Inner membrane', 'level': 3, 'score': 0.58629847}, {'id': 'https://openalex.org/C547475151', 'wikidata': 'https://www.wikidata.org/wiki/Q25419', 'display_name': 'Escherichia coli', 'level': 3, 'score': 0.5616464}, {'id': 'https://openalex.org/C89423630', 'wikidata': 'https://www.wikidata.org/wiki/Q7193', 'display_name': 'Microbiology', 'level': 1, 'score': 0.4862977}, {'id': 'https://openalex.org/C115335371', 'wikidata': 'https://www.wikidata.org/wiki/Q142943', 'display_name': 'Membrane transport protein', 'level': 4, 'score': 0.47544003}, {'id': 'https://openalex.org/C190114821', 'wikidata': 'https://www.wikidata.org/wiki/Q412861', 'display_name': 'Permease', 'level': 4, 'score': 0.47189388}, {'id': 'https://openalex.org/C49039625', 'wikidata': 'https://www.wikidata.org/wiki/Q84230', 'display_name': 'Secretion', 'level': 2, 'score': 0.47076416}, {'id': 'https://openalex.org/C144647389', 'wikidata': 'https://www.wikidata.org/wiki/Q423042', 'display_name': 'Membrane protein', 'level': 3, 'score': 0.46617913}, {'id': 'https://openalex.org/C104317684', 'wikidata': 'https://www.wikidata.org/wiki/Q7187', 'display_name': 'Gene', 'level': 2, 'score': 0.4608772}, {'id': 'https://openalex.org/C95444343', 'wikidata': 'https://www.wikidata.org/wiki/Q7141', 'display_name': 'Cell biology', 'level': 1, 'score': 0.35982758}, {'id': 'https://openalex.org/C2778910516', 'wikidata': 'https://www.wikidata.org/wiki/Q380136', 'display_name': 'Enterobacteriaceae', 'level': 4, 'score': 0.29519677}, {'id': 'https://openalex.org/C54355233', 'wikidata': 'https://www.wikidata.org/wiki/Q7162', 'display_name': 'Genetics', 'level': 1, 'score': 0.2849641}, {'id': 'https://openalex.org/C149011108', 'wikidata': 'https://www.wikidata.org/wiki/Q652985', 'display_name': 'Transporter', 'level': 3, 'score': 0.23792624}, {'id': 'https://openalex.org/C55493867', 'wikidata': 'https://www.wikidata.org/wiki/Q7094', 'display_name': 'Biochemistry', 'level': 1, 'score': 0.13486066}, {'id': 'https://openalex.org/C41625074', 'wikidata': 'https://www.wikidata.org/wiki/Q176088', 'display_name': 'Membrane', 'level': 2, 'score': 0.09213829}], 'mesh': [{'descriptor_ui': 'D018528', 'descriptor_name': 'ATP-Binding Cassette Transporters', 'qualifier_ui': 'Q000737', 'qualifier_name': 'chemistry', 'is_major_topic': True}, {'descriptor_ui': 'D000255', 'descriptor_name': 'Adenosine Triphosphate', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D004926', 'descriptor_name': 'Escherichia coli', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D018528', 'descriptor_name': 'ATP-Binding Cassette Transporters', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D018528', 'descriptor_name': 'ATP-Binding Cassette Transporters', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D000255', 'descriptor_name': 'Adenosine Triphosphate', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D000595', 'descriptor_name': 'Amino Acid Sequence', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D001422', 'descriptor_name': 'Bacterial Adhesion', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D015153', 'descriptor_name': 'Blotting, Western', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002462', 'descriptor_name': 'Cell Membrane', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D002462', 'descriptor_name': 'Cell Membrane', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D003001', 'descriptor_name': 'Cloning, Molecular', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D003902', 'descriptor_name': 'Detergents', 'qualifier_ui': 'Q000494', 'qualifier_name': 'pharmacology', 'is_major_topic': False}, {'descriptor_ui': 'D003902', 'descriptor_name': 'Detergents', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D004591', 'descriptor_name': 'Electrophoresis, Polyacrylamide Gel', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D004926', 'descriptor_name': 'Escherichia coli', 'qualifier_ui': 'Q000472', 'qualifier_name': 'pathogenicity', 'is_major_topic': False}, {'descriptor_ui': 'D004926', 'descriptor_name': 'Escherichia coli', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D029968', 'descriptor_name': 'Escherichia coli Proteins', 'qualifier_ui': 'Q000737', 'qualifier_name': 'chemistry', 'is_major_topic': False}, {'descriptor_ui': 'D029968', 'descriptor_name': 'Escherichia coli Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008854', 'descriptor_name': 'Microscopy, Electron', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008855', 'descriptor_name': 'Microscopy, Electron, Scanning', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008954', 'descriptor_name': 'Models, Biological', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008957', 'descriptor_name': 'Models, Genetic', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008958', 'descriptor_name': 'Models, Molecular', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008969', 'descriptor_name': 'Molecular Sequence Data', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D005810', 'descriptor_name': 'Multigene Family', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D016297', 'descriptor_name': 'Mutagenesis, Site-Directed', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D010957', 'descriptor_name': 'Plasmids', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D010957', 'descriptor_name': 'Plasmids', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011485', 'descriptor_name': 'Protein Binding', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D021381', 'descriptor_name': 'Protein Transport', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D020133', 'descriptor_name': 'Reverse Transcriptase Polymerase Chain Reaction', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D017386', 'descriptor_name': 'Sequence Homology, Amino Acid', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D013347', 'descriptor_name': 'Subcellular Fractions', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}], 'locations_count': 2, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m306413200', 'pdf_url': 'http://www.jbc.org/article/S0021925820823291/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/12933818', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m306413200', 'pdf_url': 'http://www.jbc.org/article/S0021925820823291/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 60, 'referenced_works': ['https://openalex.org/W1484631462', 'https://openalex.org/W1504776901', 'https://openalex.org/W1549958659', 'https://openalex.org/W1594700207', 'https://openalex.org/W1781581410', 'https://openalex.org/W1808738141', 'https://openalex.org/W1892148740', 'https://openalex.org/W1903574298', 'https://openalex.org/W1905373345', 'https://openalex.org/W1981871034', 'https://openalex.org/W1990996770', 'https://openalex.org/W1992764122', 'https://openalex.org/W2003124801', 'https://openalex.org/W2004178884', 'https://openalex.org/W2004228538', 'https://openalex.org/W2012507271', 'https://openalex.org/W2020120939', 'https://openalex.org/W2028231353', 'https://openalex.org/W2039680623', 'https://openalex.org/W2044964954', 'https://openalex.org/W2048214746', 'https://openalex.org/W205578041', 'https://openalex.org/W2062734560', 'https://openalex.org/W2080030081', 'https://openalex.org/W2087885007', 'https://openalex.org/W2089126318', 'https://openalex.org/W2089301588', 'https://openalex.org/W2091926133', 'https://openalex.org/W2096624392', 'https://openalex.org/W2096885651', 'https://openalex.org/W2099949684', 'https://openalex.org/W2100837269', 'https://openalex.org/W2100965136', 'https://openalex.org/W2112111992', 'https://openalex.org/W2114520383', 'https://openalex.org/W2114967331', 'https://openalex.org/W2117919289', 'https://openalex.org/W2118606775', 'https://openalex.org/W2122906050', 'https://openalex.org/W2124306486', 'https://openalex.org/W2129668858', 'https://openalex.org/W2131165092', 'https://openalex.org/W2132417094', 'https://openalex.org/W2141066076', 'https://openalex.org/W2141885858', 'https://openalex.org/W2142209403', 'https://openalex.org/W2143420721', 'https://openalex.org/W2146719429', 'https://openalex.org/W2150383975', 'https://openalex.org/W2155633540', 'https://openalex.org/W2160084442', 'https://openalex.org/W2163517259', 'https://openalex.org/W2165854346', 'https://openalex.org/W2168393617', 'https://openalex.org/W2171091522', 'https://openalex.org/W2208528622', 'https://openalex.org/W2804007336', 'https://openalex.org/W4206302388', 'https://openalex.org/W4206398136', 'https://openalex.org/W79381975'], 'related_works': ['https://openalex.org/W4253926625', 'https://openalex.org/W3110097868', 'https://openalex.org/W2185354132', 'https://openalex.org/W2166355312', 'https://openalex.org/W2111486247', 'https://openalex.org/W2087953740', 'https://openalex.org/W2015062108', 'https://openalex.org/W2005445119', 'https://openalex.org/W1980703147', 'https://openalex.org/W1962726995'], 'abstract_inverted_index': {'Enteroaggregative': [0, 191, 382], 'Escherichia': [1, 192, 383], 'coli': [2, 193, 384, 1567, 1720, 2239, 3949, 3959], '(EAEC)': [3, 194, 385], 'is': [4, 30, 51, 60, 152, 195, 221, 242, 251, 343, 445, 555, 666, 719, 871, 989, 1016, 1027, 1187, 1411, 3980], 'an': [5, 88, 92, 196, 279, 283, 446, 1226, 1455, 2382, 2640, 2784, 2880, 3007, 3019, 3109, 3889], 'emerging': [6, 197, 447], 'enteric': [7, 198, 448], 'pathogen': [8, 199, 449], 'characterized': [9, 23, 200, 214, 667, 1064], 'by': [10, 53, 62, 183, 201, 244, 253, 374, 577, 668, 1184, 2210, 2244, 2272, 2320, 2421, 2460, 2494, 2497, 2535, 2650, 2826, 2890, 2925, 2947, 2953, 3005, 3051, 3085, 3089, 3114, 3143, 3209, 3362, 3452, 3622, 3745, 3768, 3860, 3898, 3969, 4048], 'aggregative': [11, 202, 395, 398, 424, 427, 722, 788], 'adherence': [12, 203, 399, 428, 560, 723, 730, 789, 862], '(AA)': [13, 204, 724], 'to': [14, 111, 122, 205, 302, 313, 557, 564, 663, 764, 769, 774, 863, 1122, 1164, 1176, 1207, 1225, 1261, 1401, 1489, 1835, 1968, 2101, 2251, 2576, 2703, 2710, 2740, 2796, 2811, 2848, 2862, 3018, 3059, 3175, 3191, 3200, 3327, 3396, 3728, 3772, 3953], 'cultured': [15, 206], 'human': [16, 207, 853, 876], 'mucosal': [17, 208], 'epithelium': [18, 209], 'cells.': [19, 210], 'We': [20, 72, 104, 139, 163, 211, 263, 295, 330, 354, 782, 1393], 'have': [21, 212, 783], 'recently': [22, 213, 906], 'a': [24, 54, 63, 78, 156, 170, 176, 215, 245, 254, 269, 347, 361, 367, 672, 778, 801, 872, 931, 990, 1031, 1065, 1112, 1124, 1280, 1405, 1447, 1877, 1977, 2143, 2191, 2335, 2600, 2750, 2949, 2987, 2990, 2994, 3250, 3480, 3838, 3845, 4077], '10.2-kDa': [25, 216, 1114], 'protein,': [26, 217, 1115, 3103], 'called': [27, 218, 805], 'dispersin,': [28, 219, 1213], 'which': [29, 36, 59, 174, 220, 227, 250, 365, 519, 709, 797, 977, 1120, 1133, 1185, 1410, 1726], 'exported': [31, 52, 222, 243], 'from': [32, 223, 1446, 1533, 2310, 2334, 2792, 3108, 3386, 3435, 3605, 3756], 'the': [33, 42, 67, 75, 98, 112, 124, 136, 144, 149, 166, 179, 188, 224, 233, 258, 266, 289, 303, 315, 327, 335, 340, 357, 370, 379, 526, 559, 562, 565, 571, 664, 669, 727, 765, 770, 785, 864, 970, 973, 986, 994, 1075, 1128, 1139, 1151, 1160, 1165, 1172, 1178, 1182, 1196, 1200, 1208, 1218, 1253, 1256, 1276, 1352, 1355, 1390, 1397, 1402, 1420, 1452, 1536, 1625, 1677, 1686, 1695, 1704, 1713, 1723, 1778, 1805, 1829, 1841, 1958, 1973, 1985, 1994, 2003, 2012, 2021, 2041, 2072, 2107, 2149, 2252, 2275, 2297, 2305, 2311, 2327, 2367, 2391, 2408, 2549, 2557, 2561, 2570, 2629, 2721, 2737, 2830, 2863, 2956, 2962, 2998, 3011, 3099, 3102, 3104, 3118, 3307, 3383, 3387, 3397, 3752, 3893, 3907, 3917, 3956, 3973, 4006, 4010, 4043, 4059], 'bacteria': [34, 225], 'and': [35, 97, 226, 288, 453, 460, 573, 773, 792, 795, 1023, 1132, 1216, 1265, 1271, 1340, 1346, 1414, 1426, 1429, 1541, 1642, 2032, 2053, 2152, 2196, 2204, 2242, 2304, 2316, 2403, 2466, 2502, 2520, 2556, 2585, 2625, 2664, 2725, 2857, 2904, 2933, 2940, 2958, 2973, 2993, 3087, 3112, 3120, 3177, 3203, 3233, 3260, 3266, 3330, 3348, 3372, 3464, 3484, 3515, 3556, 3592, 3631, 3647, 3676, 3689, 3721, 3770, 3783, 3824, 3842, 3852, 3906, 3913, 3983, 3994, 4035, 4056], 'promotes': [37, 228, 1134], 'dispersal': [38, 229, 1135], 'of': [39, 66, 80, 87, 116, 148, 158, 181, 187, 230, 257, 271, 278, 307, 339, 349, 372, 378, 528, 552, 561, 579, 661, 671, 717, 993, 1020, 1034, 1072, 1136, 1144, 1162, 1167, 1202, 1354, 1419, 1454, 1535, 1729, 1838, 1843, 1957, 1966, 1972, 1984, 1993, 2002, 2011, 2020, 2066, 2071, 2099, 2104, 2109, 2148, 2247, 2254, 2285, 2288, 2299, 2302, 2307, 2322, 2329, 2369, 2372, 2375, 2393, 2560, 2564, 2569, 2593, 2607, 2613, 2618, 2628, 2653, 2817, 2836, 2893, 2961, 2971, 3010, 3022, 3101, 3128, 3134, 3146, 3268, 3289, 3318, 3377, 3445, 3469, 3503, 3511, 3518, 3553, 3559, 3597, 3615, 3636, 3704, 3781, 3822, 3840, 3855, 3863, 3892, 3916, 4003, 4014, 4020, 4024, 4027, 4030, 4033, 4037, 4070, 4084, 4091, 4096], 'EAEC': [40, 68, 182, 231, 259, 373, 515, 553, 662, 718, 761, 928, 1035, 1076, 1137, 1168, 1229, 1257, 1269, 1284, 1524, 1648, 2155], 'across': [41, 135, 232, 326], 'intestinal': [43, 234, 517, 566, 1140], 'mucosa.': [44, 235, 1141], 'Here,': [45, 236], 'we': [46, 237, 1063], 'present': [47, 238, 1029], 'evidence': [48, 239], 'that': [49, 74, 165, 240, 265, 356, 868, 1037, 1159, 1275, 1396], 'dispersin': [50, 145, 185, 241, 336, 376, 1163, 1186, 1203, 1421], 'putative': [55, 246, 1209, 1385, 1406], 'ABC': [56, 118, 172, 247, 309, 363, 1407], 'transporter': [57, 248, 1408], 'complex,': [58, 249], 'encoded': [61, 252, 799], 'genetic': [64, 255, 981], 'locus': [65, 76, 256, 267], 'virulence': [69, 159, 260, 350, 803, 873, 1210], 'plasmid': [70, 261, 804, 1220, 2289, 2395, 2414, 3864], 'pAA2.': [71, 262], 'demonstrate': [73, 264], 'comprises': [77, 268], 'cluster': [79, 151, 168, 270, 342, 359, 2044, 2151, 2572, 4045], 'five': [81, 272], 'genes': [82, 160, 273, 351, 2068, 3857], '(designated': [83, 274], 'aat-PABCD),': [84, 275], 'including': [85, 276], 'homologs': [86, 277], 'inner-membrane': [89, 280], 'permease': [90, 281], '(AatP),': [91, 282], 'ATP-binding': [93, 284], 'cassette': [94, 285], 'protein': [95, 101, 286, 292, 1125, 1382, 1975, 2982, 3045, 3082, 3186, 3305, 3385, 3764], '(AatC)': [96, 287], 'outer': [99, 113, 128, 290, 304, 319], 'membrane': [100, 114, 129, 291, 305, 320, 3431], 'TolC': [102, 293], '(AatA).': [103, 294], 'show': [105, 141, 296, 332, 1394], 'that,': [106, 142, 297, 333], 'like': [107, 143, 298, 334], 'TolC,': [108, 299], 'AatA': [109, 300, 1974, 2938, 3140, 3147, 3184, 3782], 'localizes': [110, 301], 'independently': [115, 306], 'its': [117, 308, 720], 'partner.': [119, 310], 'Dispersin': [120, 311], 'appears': [121, 312, 1121], 'require': [123, 314, 1171], 'Aat': [125, 316, 2571], 'complex': [126, 317], 'for': [127, 133, 318, 324, 861, 875, 1018, 1268, 1282, 1389, 1538, 1722, 1752, 1879, 2490, 2552, 2643, 2656, 2661, 2667, 2678, 2688, 2829, 2868, 2883, 2896, 2901, 2907, 2918, 3040, 3139, 3215, 3262, 3280, 3302, 3334, 3345, 3352, 3368, 3458, 3486, 3589, 3628, 3673, 3678, 3708], 'translocation': [130, 321, 1161, 1418], 'but': [131, 322, 1025], 'not': [132, 323, 1039, 1170], 'secretion': [134, 325, 578, 1173], 'inner': [137, 328], 'membrane.': [138, 329], 'also': [140, 331, 1028, 1221], 'gene,': [146, 337, 1725], 'transcription': [147, 338], 'aat': [150, 167, 341, 358, 2043, 2150, 3856, 4011, 4041, 4044], 'dependent': [153, 344], 'on': [154, 345, 800, 1127, 1138, 2381, 2524, 3332, 3671, 3715, 3988], 'AggR,': [155, 346, 1217], 'regulator': [157, 348], 'in': [161, 178, 352, 369, 457, 525, 569, 726, 758, 777, 1030, 1074, 1432, 1437, 1444, 1451, 1458, 1492, 1527, 1545, 1575, 1589, 1605, 1645, 1840, 1988, 1997, 2006, 2015, 2024, 2106, 2142, 2190, 2293, 2366, 2399, 2599, 2639, 2692, 2697, 2705, 2720, 2736, 2742, 2749, 2821, 2872, 2879, 2978, 3149, 3286, 3306, 3374, 3442, 3466, 3500, 3594, 3612, 3633, 3701, 3903, 3947, 3961, 4000, 4009, 4018, 4053, 4076], 'EAEC.': [162, 353], 'propose': [164, 355], 'encodes': [169, 360, 1111, 1404], 'specialized': [171, 362], 'transporter,': [173, 364], 'plays': [175, 366], 'role': [177, 368], 'pathogenesis': [180, 371, 551], 'transporting': [184, 375], 'out': [186, 377], 'bacterial': [189, 380, 1129, 3388], 'cell.': [190, 381], '1The': [386], 'abbreviations': [387, 416], 'used': [388, 417, 1431, 1526, 1644, 1875, 2687, 2696, 2867, 3261, 3819], 'are:': [389, 418], 'EAEC,': [390, 419], 'enteroaggregative': [391, 420], 'E.': [392, 421, 1566, 1719, 2238, 3155, 3948, 3958], 'coli;': [393, 422], 'AA,': [394, 423], 'adherence;': [396, 425], 'AAF,': [397, 426, 1212], 'fimbriae;': [400, 429, 1180], 'DMEM,': [401, 430], "Dulbecco's": [402, 431, 1606], 'modified': [403, 432], "Eagle's": [404, 433], 'medium;': [405, 434], 'RT,': [406, 435], 'reverse': [407, 436, 2849, 2859], 'transcriptase;': [408, 437], 'PBS,': [409, 438, 3247], 'phosphate-buffered': [410, 439], 'saline;': [411, 440], 'ORF,': [412, 441], 'open': [413, 442], 'reading': [414, 443], 'frame.1The': [415], 'frame.': [444], 'associated': [450], 'with': [451, 1449, 1593, 1615, 2499, 2513, 2590, 2673, 2783, 2802, 2913, 2930, 2935, 2989, 3016, 3028, 3091, 3211, 3227, 3236, 3311, 3350, 3479, 3691, 3747, 3831, 3992, 4067], 'endemic': [452], 'epidemic': [454], 'diarrheal': [455, 529], 'illness': [456], 'both': [458, 570, 1021, 2296], 'developing': [459], 'industrialized': [461], 'countries': [462], '(1Nataro': [463], 'J.P.': [464, 481, 496, 536, 585, 613, 631, 651, 677, 733, 808, 842, 893, 944, 1000, 1053, 1096, 1297, 1462, 1496, 1556, 1651, 1740, 1765, 1792, 1817, 1861, 1897, 2128, 2352, 2768, 3418, 3806, 3879], 'Steiner': [465], 'T.': [466], 'Guerrant': [467, 537], 'R.L.': [468, 538], 'Emerg.': [469], 'Infect.': [470, 498, 540, 594, 614, 632, 652, 701, 745, 819, 843, 894, 916, 945, 960, 1054, 1242, 1299, 1474, 1512, 1557, 1663, 1793], 'Dis.': [471, 499, 541, 746, 1243, 1300, 1475, 1513, 1664], '1998;': [472, 487, 542, 616, 683, 2449], '4:': [473], '251-261Crossref': [474], 'PubMed': [475, 490, 508, 545, 599, 619, 637, 657, 686, 706, 751, 824, 848, 899, 921, 950, 965, 1012, 1059, 1103, 1247, 1304, 1333, 1378, 1479, 1517, 1562, 1668, 1746, 1771, 1798, 1823, 1868, 1904, 1925, 1951, 2089, 2135, 2264, 2358, 2452, 2484, 2774, 3425, 3547, 3577, 3664, 3737, 3813, 3885, 3931], 'Scopus': [476, 509, 546, 752, 922, 966, 1104, 1248, 1305, 1334, 1480, 1518, 1669, 1824, 1869, 1905, 1926, 1952, 2090, 2136, 2265, 2453, 2485, 2775, 3426, 3578, 3738, 3814, 3932], '(173)': [477], 'Google': [478, 491, 511, 548, 600, 620, 638, 658, 687, 707, 754, 825, 849, 900, 924, 951, 968, 1013, 1060, 1106, 1250, 1307, 1336, 1379, 1482, 1520, 1563, 1671, 1747, 1772, 1799, 1826, 1871, 1907, 1928, 1954, 2092, 2138, 2267, 2359, 2455, 2487, 2777, 3428, 3548, 3580, 3665, 3740, 3816, 3886, 3934], 'Scholar,': [479, 492, 601, 621, 639, 688, 826, 952, 1308], '2Nataro': [480], 'Kaper': [482, 678, 734, 1237, 1294, 1465, 1654], 'J.B.': [483, 679, 735, 1238, 1295, 1466, 1655], 'Clin.': [484, 680, 1098, 1328, 1373, 1863, 1899, 2130, 3420, 3808], 'Microbiol.': [485, 681, 1329, 1374, 1819, 2770, 3572], 'Rev.': [486, 682], '11:': [488, 684], '142-201Crossref': [489, 685], '3Okeke': [493], 'I.N.': [494, 1287], 'Nataro': [495, 535, 612, 630, 650, 841, 892, 943, 1052, 1095, 1296, 1555, 1739, 1764, 1791, 1816, 1860, 1896, 2127, 2351, 2767, 3417, 3805, 3878], 'Lancet': [497], '2001;': [500, 1820, 1948, 2771], '1:': [501], '304-313Abstract': [502], 'Full': [503, 505], 'Text': [504, 506], 'PDF': [507], '(155)': [510], 'Scholar).': [512, 549, 659, 755, 850, 901, 925, 1014, 1061, 1107, 1251, 1337, 1521, 2232, 2360, 2488, 2778, 3170, 3429, 3581, 3666, 3741, 3887, 3935], 'In': [513, 756, 1142, 1205, 1252], 'addition,': [514], 'induces': [516], 'inflammation,': [518], 'can': [520], 'precipitate': [521], 'growth': [522, 1599], 'failure': [523], 'even': [524], 'absence': [527, 2816], 'symptoms': [530], '(4Steiner': [531], 'T.S.': [532, 625, 938, 1047, 1550], 'Lima': [533], 'A.A.': [534], 'J.': [539, 692, 747, 1007, 1080, 1097, 1241, 1291, 1298, 1324, 1327, 1341, 1347, 1369, 1372, 1473, 1511, 1662, 1741, 1766, 1809, 1845, 1862, 1881, 1898, 1940, 1945, 2083, 2084, 2112, 2129, 2214, 2258, 2353, 2427, 2760, 3402, 3419, 3542, 3659, 3790, 3807, 3880], '177:': [543, 2087], '88-96Crossref': [544], '(264)': [547], 'The': [550, 714, 851, 1192, 2283, 2567, 2684, 2815, 2921, 2969, 2981, 3043, 3066, 3080, 3181, 3242, 3337, 3358, 3475, 3496, 3582, 3667, 3685, 3697, 3936, 3963], 'infection': [554, 877], 'thought': [556], 'involve': [558], 'bacterium': [563], 'mucosa,': [567, 866], 'possibly': [568], 'small': [572], 'large': [574, 802, 1032], 'intestines,': [575], 'followed': [576, 2496, 2649, 2889], 'one': [580], 'or': [581, 1384, 2269, 2527, 3279, 3550, 3751, 3786, 3943], 'more': [582, 1152], 'enterotoxins': [583], '(5Nataro': [584], 'Hicks': [586, 642, 831, 882, 1085, 1783, 1810, 1850, 1886, 2117, 2761, 3407, 3795], 'S.': [587, 643, 690, 830, 832, 881, 883, 1084, 1086, 1365, 1367, 1500, 1784, 1811, 1849, 1851, 1885, 1887, 2116, 2118, 2762, 3406, 3408, 3794, 3796], 'Phillips': [588, 833, 884, 1093, 1814, 1858, 1894, 2125, 2765, 3415, 3803], 'A.D.': [589, 649, 1790, 1815, 2766], 'Vial': [590, 695, 740, 1235], 'P.A.': [591], 'Sears': [592], 'C.L.': [593], 'Immun.': [595, 615, 633, 653, 702, 820, 844, 895, 917, 946, 961, 1055, 1558, 1794], '1996;': [596, 3544, 3574], '64:': [597], '4761-4768Crossref': [598], '6Eslava': [602], 'C.': [603, 910, 915, 954, 959, 1090, 1363, 1855, 1891, 2122, 3412, 3800], 'Navarro-Garcia': [604, 628, 644, 839, 890, 941, 1050, 1553, 1785], 'F.': [605, 629, 645, 840, 891, 942, 1051, 1293, 1554, 1786], 'Czeczulin': [606, 1081, 1290, 1733, 1758, 1846, 1882, 2113, 2345, 3403, 3791, 3872], 'J.R.': [607, 623, 828, 879, 936, 1045, 1082, 1548, 1734, 1759, 1847, 1883, 2114, 2346, 3404, 3792, 3873], 'Henderson': [608, 626, 939, 1048, 1087, 1551, 1735, 1760, 1852, 1888, 2119, 2347, 3409, 3797, 3874], 'I.R.': [609, 627, 641, 940, 1049, 1088, 1552, 1736, 1761, 1782, 1853, 1889, 2120, 2348, 3410, 3798, 3875], 'Cravioto': [610, 1501], 'A.': [611, 834, 885, 1094, 1289, 1502, 1859, 1895, 2126, 3416, 3567, 3571, 3804], '66:': [617], '3155-3163Crossref': [618], '7Czeczulin': [622, 1547], 'Whittam': [624, 937, 1046, 1549], '1999;': [634, 654, 947, 1056, 1559, 1743, 1768, 1795, 2355, 3882], '67:': [635, 655, 948, 1057, 1560, 1796], '2692-2699Crossref': [636, 949, 1058, 1561], '8Henderson': [640], 'Elias': [646, 1787], 'W.P.': [647, 1732, 1757, 1788, 2344, 3871], 'Philips': [648, 1789], '5338-5344Crossref': [656, 1797], 'Adherence': [660], 'mucosa': [665], 'presence': [670, 1842, 2108], 'thick,': [673], 'aggregating': [674], 'biofilm': [675], '(2Nataro': [676], '9Tzipori': [689], 'Montanaro': [691], 'Robins-Browne': [693, 736], 'R.M.': [694], 'P.': [696, 741, 912, 956, 1092, 1236, 1857, 1893, 2124, 3414, 3535, 3802], 'Gibson': [697], 'R.': [698, 737, 836, 887], 'Levine': [699, 742, 817, 1239, 1471, 1507, 1660], 'M.M.': [700, 743, 818, 1240, 1464, 1472, 1508, 1653, 1661], '1992;': [703, 821, 1922, 3928], '60:': [704, 822], '5302-5306Crossref': [705], 'Scholar),': [708, 969, 1380, 2268, 2456], 'may': [710, 1278], 'promote': [711], 'persistent': [712], 'infection.': [713], 'defining': [715], 'feature': [716], 'characteristic': [721], 'phenotype': [725], 'standard': [728, 2211, 3729, 3777], 'HEp-2': [729], 'assay': [731], '(10Nataro': [732], 'Prado': [738], 'V.': [739, 2444, 2472], 'Pediatr.': [744], '1987;': [748], '6:': [749], '829-831Crossref': [750], '(479)': [753], 'this': [757, 869, 1145, 1484, 1646, 2698], 'vitro': [759], 'assay,': [760], 'strains': [762, 929, 1036, 1285, 1525, 1568, 1583, 1641, 3275], 'adhere': [763], 'epithelial': [766], 'cell': [767, 1130, 3389, 3483], 'surface,': [768, 3390], 'glass': [771], 'substratum,': [772], 'each': [775, 2614, 2619, 4092, 4097], 'other': [776], 'distinctive': [779], 'stacked-brick': [780], 'formation.': [781], 'described': [784, 908, 1523, 1544, 2424, 2758, 3153, 3400, 3695, 3868, 3902], 'related': [786], 'adhesins': [787], 'fimbriae': [790], 'I': [791, 2501, 2805], 'II': [793, 2278, 2537], '(AAF/I': [794], 'AAF/II),': [796], 'are': [798, 1435, 2690, 2870, 2976], 'pAA': [806, 975, 1219], '(11Nataro': [807], 'Deng': [809, 1497], 'Y.': [810, 1498, 3654], 'Maneval': [811], 'D.R.': [812, 3531], 'German': [813], 'A.L.': [814, 1312], 'Martin': [815], 'W.C.': [816], '2297-2304Crossref': [823], '12Czeczulin': [827], 'Balepur': [829, 880], 'Hall': [835, 886], 'Kothary': [837, 888], 'M.H.': [838, 889], '1997;': [845, 896, 3661], '65:': [846, 897], '4135-4145Crossref': [847, 898], 'proven': [852], 'pathogenic': [854, 1283], 'strain': [855, 1077, 1485, 2401, 2837, 3960, 3965, 3977], '042': [856, 1078, 1441, 2271, 3978], 'requires': [857], 'AAF/II': [858], 'fimbrial': [859], 'antigen': [860], 'colonic': [865], 'suggesting': [867], 'adhesin': [870, 904, 934], 'factor': [874], '(12Czeczulin': [878], 'An': [902], 'AAF/III': [903], 'has': [905, 1148, 1357, 1486, 2573], 'been': [907, 1149, 1358, 1487, 2574], '(13Bernier': [909], 'Gounon': [911, 955, 1091, 1856, 1892, 2123, 3413, 3801], 'Le': [913, 957], 'Bouguenec': [914, 958], '2002;': [918, 962, 1100, 1865, 1901, 2132, 3422, 3810], '70:': [919, 963], '4302-4311Crossref': [920, 964], '(184)': [923, 967], 'Whereas': [926, 1351], 'most': [927], 'lack': [930], 'recognizable': [932], 'AAF': [933, 1043, 1179], '(7Czeczulin': [935, 1044], '13Bernier': [953], 'majority': [971], 'carry': [972], '∼100-kb': [974], 'plasmid,': [976], 'harbors': [978, 1222], 'several': [979], 'conserved': [980], 'loci.': [982], 'Most': [983], 'prominent': [984], 'among': [985, 2154], 'plasmid-encoded': [987], 'factors': [988, 1211], 'transcriptional': [991], 'activator': [992], 'AraC': [995], 'class': [996], 'designated': [997, 1116], 'AggR': [998, 1015, 1839, 2105], '(14Nataro': [999], 'Yikang': [1001], 'D.': [1002, 1004, 2079, 2257, 3157, 3658], 'Yingkang': [1003], 'Walker': [1005], 'K.': [1006, 1944, 3563], 'Bacteriol.': [1008, 1742, 1767, 2085, 2354, 3543, 3660, 3881], '1994;': [1009], '176:': [1010], '4691-4699Crossref': [1011], 'required': [1017, 1175, 1415], 'expression': [1019, 1837, 1910, 1930, 1971, 2062, 2065, 2103, 2963, 3002, 3024], 'AAF/I': [1022], 'AAF/II,': [1024], 'it': [1026], 'percentage': [1033], 'do': [1038], 'express': [1040], 'any': [1041], 'identified': [1042], 'Recently,': [1062], 'novel': [1066, 1109], 'AggR-dependent': [1067], 'gene': [1068, 1110, 1831, 1960, 1987, 1996, 2005, 2014, 2023, 2835, 2943, 3895], 'lying': [1069], 'immediately': [1070, 3234], 'upstream': [1071], 'aggR': [1073, 1806, 1830, 2153], '(15Sheikh': [1079, 3401, 3789], 'Harrington': [1083, 1848, 1884, 2115, 3405, 3793], 'LeBouguenec': [1089, 1854, 1890, 2121, 3411, 3799], 'Invest.': [1099, 1864, 1900, 2131, 3421, 3809], '110:': [1101, 1866, 1902, 2133, 3423, 3811], '1329-1337Crossref': [1102, 1867, 1903, 2134, 3424, 3812], '(213)': [1105, 1870, 1906, 2137, 3427, 3815], 'This': [1108, 3997], 'secreted': [1113], 'Aap': [1117, 1147, 3384], '(anti-aggregation': [1118], 'protein),': [1119], 'form': [1123], 'capsule': [1126], 'surface': [1131, 1166], 'light': [1143], 'property,': [1146], 'given': [1150], 'descriptive': [1153], 'name': [1154], 'dispersin.': [1155], 'Initial': [1156], 'studies': [1157, 1434], 'revealed': [1158], 'does': [1169], 'apparatus': [1174], 'construct': [1177, 3012], 'however,': [1181], 'mechanism': [1183, 1201], 'translocated': [1188], 'remained': [1189], 'initially': [1190], 'unclear.': [1191], 'current': [1193], 'work': [1194], 'provides': [1195], 'first': [1197], 'insight': [1198], 'into': [1199, 1676, 1685, 1694, 1703, 1712, 1777, 1804, 1833, 1962, 2035, 2046, 2056, 2095, 2237, 2270, 2468, 2955, 3911, 3955, 4005, 4058], 'secretion.': [1204], 'addition': [1206], 'Pet,': [1214], 'EAST1,': [1215], 'sequences': [1223, 2331, 2686, 2970], 'homologous': [1224, 4007], 'empirically': [1227], 'derived': [1228], 'probe': [1230, 1258, 1277, 1356, 1403], '(16Baudry': [1231], 'B.': [1232], 'Savarino': [1233, 1503], 'S.J.': [1234, 1504], '1990;': [1244], '161:': [1245], '1249-1251Crossref': [1246], '(272)': [1249], 'original': [1254], 'report,': [1255], 'was': [1259, 1387, 1442, 2235, 2291, 2364, 2397, 2405, 2418, 2511, 2543, 2754, 2781, 2824, 2846, 2945, 2983, 3003, 3025, 3046, 3069, 3083, 3106, 3141, 3173, 3189, 3207, 3244, 3309, 3325, 3339, 3360, 3394, 3498, 3584, 3669, 3687, 3699, 3713, 3829, 3896, 3909, 3966, 4046], 'found': [1260], 'be': [1262], '89%': [1263], 'sensitive': [1264], '99%': [1266], 'specific': [1267, 3138], 'detection,': [1270], 'subsequent': [1272], 'data': [1273, 2521], 'suggest': [1274], 'constitute': [1279], 'marker': [1281], '(17Okeke': [1286], 'Lamikanra': [1288], 'Dubovsky': [1292], '2000;': [1301], '181:': [1302, 1744, 1769, 2356, 3883], '252-260Crossref': [1303], '(150)': [1306], '18Piva': [1309], 'I.C.': [1310], 'Pereira': [1311], 'Ferraz': [1313], 'L.R.': [1314, 1738, 1763, 2350, 3877], 'Silva': [1315], 'R.S.': [1316], 'Vieira': [1317], 'A.C.': [1318], 'Blanco': [1319, 1321, 1323, 3530], 'J.E.': [1320], 'M.': [1322, 1813, 2764, 3569], 'Giugliano': [1325], 'L.G.': [1326], '2003;': [1330], '41:': [1331, 1821, 2772], '1827-1832Crossref': [1332], '(76)': [1335], '2M.': [1338], 'Cohen': [1339, 1345], 'Nataro,': [1342, 1348], 'unpublished': [1343, 1349], 'data.2M.': [1344], 'data.': [1350], 'sequence': [1353, 2284, 2362, 2541, 2568, 2719, 2735], 'reported': [1359, 2340], '(19Schmidt': [1360], 'H': [1361], 'Knop': [1362], 'Franke': [1364], 'Aleksic': [1366], 'Heesemann': [1368], 'Karch': [1370], 'H.': [1371, 3533], '1995;': [1375, 1514, 2086], '33:': [1376], '701-705Crossref': [1377], 'no': [1381], 'product': [1383, 2944, 3908], 'function': [1386], 'suggested': [1388], 'corresponding': [1391, 1400], 'genes.': [1392], 'here': [1395], 'pAA2': [1398, 2290, 2396], 'region': [1399], 'apparatus,': [1409], 'co-regulated': [1412], 'with,': [1413], 'for,': [1416], 'efficient': [1417], 'protein.': [1422], 'Bacterial': [1423], 'Strains,': [1424], 'Plasmids,': [1425], 'Growth': [1427], 'Condition—Strains': [1428], 'plasmids': [1430, 1643, 3938], 'molecular': [1433, 3254], 'listed': [1436, 4052], 'Table': [1438, 2146, 2693, 2873, 2979, 3904, 4054], 'I.': [1439], 'Strain': [1440], 'isolated': [1443, 2406], '1983': [1445], 'child': [1448], 'diarrhea': [1450, 1491], 'course': [1453], 'epidemiological': [1456], 'study': [1457], 'Lima,': [1459], 'Peru': [1460], '(20Nataro': [1461], 'Baldini': [1463, 1652], 'Black': [1467, 1656], 'R.E.': [1468, 1657], 'Bravo': [1469, 1658], 'N.': [1470, 1659], '1985;': [1476, 1665], '152:': [1477, 1666], '560-565Crossref': [1478, 1667], '(265)': [1481, 1670], 'Scholar);': [1483], 'shown': [1488, 2691, 2716, 2732, 2871, 2977], 'cause': [1490], 'adult': [1493], 'volunteers': [1494], '(21Nataro': [1495], 'Cookson': [1499], 'Guers': [1505], 'L.D.': [1506], 'Tacket': [1509], 'C.O.': [1510], '171:': [1515], '465-468Crossref': [1516], '(273)': [1519], 'Previously': [1522], 'PCR': [1528, 2495, 2689, 2828, 2954, 3899, 4049], 'analysis': [1529, 2542], '(Table': [1530], 'II)': [1531], 'were': [1532, 1542, 1569, 1584, 1622, 2208, 2314, 2318, 2332, 2458, 2492, 2522, 2533, 2588, 2637, 2800, 2877, 2923, 3225, 3276, 3433, 3450, 3477, 3603, 3620, 3743, 3766, 3818, 3858, 3945, 3986, 4065], 'collections': [1534], 'Center': [1537, 2551], 'Vaccine': [1539], 'Development': [1540], 'originally': [1543], 'Ref.': [1546], 'Scholar.': [1564], 'All': [1565, 1582], 'grown': [1570, 3277, 3437, 3607], 'aerobically': [1571], 'at': [1572, 1586, 1600, 1624, 2295, 2390, 2646, 2675, 2886, 2915, 2997, 3013, 3117, 3218, 3283, 3298, 3341, 3355, 3364, 3439, 3454, 3461, 3489, 3493, 3586, 3609, 3624, 3681, 3820, 3837], '37': [1573, 1601, 3014, 3284, 3440, 3610], '°C': [1574, 1588, 1602, 2655, 2660, 2666, 2677, 2895, 2900, 2906, 2917, 3015, 3285, 3441, 3463, 3611], 'Luria-Bertani': [1576], '(LB)': [1577], 'medium': [1578, 1609, 3398], 'unless': [1579, 2681], 'otherwise': [1580, 2682], 'stated.': [1581, 2683], 'stored': [1585], '-70': [1587], 'Trypticase': [1590], 'soy': [1591], 'broth': [1592], '15%': [1594], 'glycerol.': [1595], 'AggR-inducing': [1596], 'conditions': [1597, 3050], 'comprised': [1598], 'without': [1603], 'shaking': [1604, 2795, 3017], 'minimal': [1607], 'essential': [1608], '(Life': [1610], 'Technologies,': [1611, 1613], 'Inc./Life': [1612], 'Inc.)': [1614], '0.45%': [1616, 3291], 'glucose': [1617, 3292, 3294, 3447, 3617], '(DMEM': [1618], 'high': [1619, 3446, 3616], 'glucose).': [1620], 'Antibiotics': [1621], 'added': [1623, 3326, 3395], 'following': [1626], 'concentrations': [1627], 'where': [1628], 'appropriate:': [1629], 'ampicillin,': [1630], '100': [1631, 3702], 'μg/ml;': [1632, 1635], 'kanamycin,': [1633], '50': [1634, 1638, 2659, 2899, 3375, 3595], 'nalidixic': [1636, 3981, 3995], 'acid,': [1637], 'μg/ml.Table': [1639], 'IBacterial': [1640], 'studyDesignationCharacteristicsReference/sourceStrains042Wild-type': [1647], 'prototype': [1649], 'strain20Nataro': [1650], 'Scholar042aatP042': [1672], 'harboring': [1673, 1682, 1691, 1700, 1709, 1774], 'pJP5603': [1674, 1683, 1692, 1701, 1710, 1775, 3865, 3921, 4015], 'integrated': [1675, 1684, 1693, 1702, 1711, 1776], 'aatP': [1678, 1986, 2052], 'gene.': [1679, 1688, 1697, 1706, 1715, 1780, 1807, 4012], 'KmRThis': [1680, 1689, 1698, 1707, 1716], 'work042aatA042': [1681], 'aatA': [1687, 1959, 1995, 2004, 2054, 2942], 'work042aatB042': [1690], 'aatB': [1696], 'work042aatC042': [1699], 'aatC': [1705, 2013], 'work042aatD042': [1708], 'aatD': [1714, 2022, 2033], 'workDH5α': [1717], 'λpirK12': [1718], 'lysogenized': [1721, 1751], 'pir': [1724], 'permits': [1727], 'replication': [1728], 'pJP560324Elias': [1730], 'Jr.,': [1731, 1756, 2343, 3870], 'Trabulsi': [1737, 1762, 2349, 3876], '1779-1785Crossref': [1745, 1770, 2357, 3884], 'ScholarS17-1': [1748], 'λpirConjugative': [1749], 'K12': [1750], 'pir.': [1753], 'TetR,': [1754], 'KmR24Elias': [1755], 'Scholar042pet042': [1773], 'pet': [1779], 'KmR8Henderson': [1781], 'Scholar042aggR042': [1800], 'carrying': [1801, 1828, 1873], 'TnphoA': [1802], 'inserted': [1803], 'KmR27Sheikh': [1808], "Dall'Agnol": [1812, 2763], 'Mol.': [1818, 1946, 2259, 2769], '983-997Crossref': [1822, 2773], '(180)': [1825, 2776], 'Scholar042aggR(pBADaggR)042aggR': [1827], 'cloned': [1832, 1961, 2034, 2045, 2055, 2094, 2467, 3910, 4057], 'pBAD30': [1834, 1874, 2100], 'permit': [1836, 2102], 'arabinose15Sheikh': [1844], 'Scholar042aggR(pBAD30)042aggR': [1872], 'as': [1876, 1976, 2339, 2423, 2597, 2717, 2733, 2756, 2986, 3152, 3314, 3399, 3694, 3866, 4074], 'control': [1878, 2070], '042aggR(pBADaggR)15Sheikh': [1880], 'ScholarPlasmidspET21a(+)T7': [1908], 'promoter-driven': [1909], 'vector.': [1911, 1938], 'ApRNovagenpJP56033.1-kb': [1912], 'R6K': [1913], 'suicide': [1914, 3919], 'plasmid.': [1915], 'KmR33Penfold': [1916], 'R.J.': [1917, 3923], 'Pemberton': [1918, 3924], 'J.M.': [1919, 3925], 'Gene': [1920, 2276, 2447, 3926], '(Amst.).': [1921, 2448, 3927], '118:': [1923, 3929], '145-146Crossref': [1924, 3930], '(247)': [1927, 3933], 'ScholarpSE3804.1-kb': [1929], 'vector;': [1931], 'trc': [1932], 'promoter,': [1933], 'lacIq,': [1934], 'ApRInvitrogenPZC3207.5-kb': [1935], 'single': [1936, 4060], 'copy': [1937, 2060, 4061], 'ApR34Shi': [1939], 'Blundell': [1941], 'T.L.': [1942], 'Mizuguchi': [1943], 'Biol.': [1947, 2260], '310:': [1949], '243-257Crossref': [1950], '(1081)': [1953], 'ScholarpAatA1065-bp': [1955], 'fragment': [1956, 1983, 1992, 2001, 2010, 2019, 2027, 2039, 2050, 2951], 'multiple': [1963, 2096], 'cloning': [1964, 2097, 2948], 'site': [1965, 2098, 2714, 2730, 4008], 'pET21a(+)': [1967, 2965], 'provide': [1969], 'IPTG-inducible': [1970], 'His6': [1978, 3182], 'fusion,': [1979], 'ApRThis': [1980, 2037, 2048, 2058], 'workpINTP517-bp': [1981], 'internal': [1982, 1991, 2000, 2009, 2018, 3890], 'pJP5603This': [1989, 1998, 2007, 2016, 2025], 'workpINTA520-bp': [1990], 'workpINTB440-bp': [1999], 'workpINTC300-bp': [2008], 'workpINTD500-bp': [2017], 'workpJNAD4.5-kb': [2026], 'encoding': [2028, 2040, 2051], 'aatA,': [2029, 4028], 'aatB,': [2030, 4031], 'aatC,': [2031, 4034], 'pZC320.': [2036, 2047, 2057, 4063], 'workpJNW6.5-kb': [2038], 'complete': [2042], 'workpJNPA3.9-kb': [2049], 'workpBAD30High': [2059], 'number': [2061, 2580, 2708, 2745], 'vector': [2063, 2964, 3920, 4062], 'permitting': [2064], 'foreign': [2067], 'under': [2069, 2578, 3048], 'arabinose': [2073], 'operon': [2074], 'promoter.': [2075], 'ApR59Guzman': [2076], 'L.M.': [2077], 'Belin': [2078], 'Carson': [2080], 'M.J.': [2081], 'Beckwith': [2082], '4121-4130Crossref': [2088], '(3923)': [2091], 'ScholarpBADaggRAggR': [2093], 'arabinose.': [2110], 'ApR15Sheikh': [2111], 'Scholar': [2139], 'Open': [2140, 2188, 2747], 'table': [2141, 2189, 2748], 'new': [2144, 2192, 2751], 'tab': [2145, 2193, 2752], 'IIDistribution': [2147], 'isolatesNo.StrainaatAaatBCDaggR1042': [2156], '(Peru)+++217-2': [2157], '(Chile)+++3Brazil': [2158], '236+++4Mexico': [2159], '60A+++5Peru': [2160], '11145-1+++6Peru': [2161], '11194-2+++7Peru': [2162], '11232-1+++8Peru': [2163], '1132-1++-9Peru': [2164], '1146-2++-10Peru': [2165], '1177-1+++11Peru': [2166], '1192-1+++12Peru': [2167], '133+++13Phil': [2168], 'DS244-R3+++14Phil': [2169], 'DS61-R2++-15Phil': [2170], 'DS67-R2+++16Thai': [2171], '103-1-1+++17Thai': [2172], '144-1-1+++18Thai': [2173], '199-1-4+++19Thai': [2174], '253-1-1+++20Thai': [2175], '309-1-1+++21Thai': [2176], '44-1-1+++22Thai': [2177], '6-1-1+++23Peru': [2178], '11223-1-++24Peru': [2179], '1111-1--+25Peru': [2180], '11191-1--+26Peru': [2181], '1172-2---27Phil': [2182], 'DS65-R3---28Thai': [2183], '435-1-1---29Thai': [2184], '501-1-1--+30Japan': [2185], '101-1---31Serbia': [2186], '1096---': [2187], 'Molecular': [2194, 2217], 'Cloning': [2195], 'Sequencing': [2197, 2510], 'Procedures—Plasmid': [2198], 'DNA': [2199, 2234, 2361, 2404, 2415, 2596, 2609, 2820, 4073, 4087], 'purification,': [2200], 'restriction,': [2201], 'ligation,': [2202], 'transformation,': [2203], 'agarose': [2205, 2461, 2927], 'gel': [2206, 2462, 3111], 'electrophoresis': [2207], 'performed': [2209, 2365, 2512, 2544, 2589, 2638, 2755, 2878, 3174, 3714, 4066], 'methods': [2212], '(22Sambrook': [2213], 'Russel': [2215], 'D.W.': [2216], 'Cloning:': [2218], 'A': [2219, 3020, 3159], 'Laboratory': [2220, 3160], 'Manual.': [2221, 3161], '3rd': [2222], 'ed.': [2223], 'Cold': [2224, 2228, 3162, 3166], 'Spring': [2225, 2229, 3163, 3167], 'Harbor': [2226, 3164], 'Laboratory,': [2227, 3165], 'Harbor,': [2230, 3168], 'NY2001Google': [2231], 'Plasmid': [2233], 'introduced': [2236], 'DH5α,': [2240], 'DH5αλpir,': [2241], 'S17-1λpir': [2243], 'heat-shock': [2245], 'transformation': [2246, 3954], 'competent': [2248], 'cells': [2249, 3476], 'according': [2250, 2861, 3058, 3199, 3727], 'method': [2253], 'Hanahan': [2255], '(23Hanahan': [2256], '1983;': [2261], '166:': [2262], '557-580Crossref': [2263], '(8147)': [2266], 'electroporation': [2273], 'using': [2274, 2407, 2545, 2853, 3249, 3776, 3844, 3900, 4050], 'Pulser': [2277], 'system': [2279], '(Bio-Rad,': [2280], 'Hercules,': [2281], 'CA).': [2282, 2634, 3065, 3760], 'relevant': [2286], 'regions': [2287], 'determined': [2292, 2333], 'laboratories': [2294], 'University': [2298, 2306, 2328, 2368, 2392, 3126], 'Maryland': [2300, 2370], 'School': [2301, 2371, 3127], 'Medicine': [2303, 2373], 'Wisconsin.': [2308], 'Sequences': [2309], 'two': [2312], 'facilities': [2313], 'compared,': [2315], 'discrepancies': [2317], 'reconciled': [2319], 'sequencing': [2321, 2389, 2491], 'selected': [2323, 3987], 'library': [2324], 'templates.': [2325], 'At': [2326], 'Maryland,': [2330], 'random': [2336], 'pBluescript': [2337], 'library,': [2338], 'previously': [2341, 2425, 2757, 3867], '(24Elias': [2342, 3869], 'determination': [2363], 'Department': [2374], 'Microbiology': [2376], '&': [2377], 'Immunology': [2378], 'Biopolymer': [2379], 'Facility': [2380], 'Applied': [2383, 2807], 'Biosystems': [2384, 2517], 'model': [2385], '373A': [2386], 'sequencer.': [2387], 'For': [2388, 3761, 3779], 'Wisconsin,': [2394], 'propagated': [2398, 3946], 'host': [2400], 'HB101,': [2402], 'Large': [2409], 'Construct': [2410], 'Kit': [2411], '(Qiagen).': [2412], 'Purified': [2413], '(5': [2416], 'μg)': [2417, 2845], 'randomly': [2419], 'sheared': [2420], 'nebulization': [2422], '(25Mahillon': [2426], 'Kirkpatrick': [2428], 'H.A.': [2429], 'Kijenski': [2430], 'H.L.': [2431], 'Bloch': [2432], 'C.A.': [2433], 'Rode': [2434], 'C.K.': [2435], 'Mayhew': [2436], 'G.F.': [2437], 'Rose': [2438], 'D.J.': [2439], 'Plunkett': [2440, 2473], '3rd.,': [2441, 2474], 'G.': [2442, 2475], 'Burland': [2443], 'Blattner': [2445, 2478], 'F.R.': [2446, 2479], '223:': [2450], '47-54Crossref': [2451], '(20)': [2454], 'fragments': [2457], 'size-fractionated': [2459], 'electrophoresis,': [2463], 'then': [2464, 3026, 3967], 'end-repaired': [2465], 'M13': [2469], 'Janus': [2470], '(26Burland': [2471], 'Daniels': [2476], 'D.L.': [2477], 'Genomics.': [2480], '1993;': [2481], '16:': [2482], '551-561Crossref': [2483], '(167)': [2486], 'Templates': [2489], 'prepared': [2493], 'treatment': [2498], 'exonuclease': [2500], 'shrimp': [2503], 'alkaline': [2504], 'phosphatase': [2505], '(USB': [2506], 'Corp.,': [2507], 'Cleveland,': [2508], 'OH).': [2509], 'dye-terminator': [2514], 'chemistry': [2515], '(Applied': [2516], 'Prism': [2518], 'reagents),': [2519], 'collected': [2523, 3361, 3688], 'ABI': [2525], '377': [2526], '3700': [2528], 'automated': [2529], 'sequencers.': [2530], 'Sequence': [2531], 'reads': [2532], 'assembled': [2534], 'Seqman': [2536], '(DNASTAR)': [2538], 'software.': [2539], 'Nucleotide': [2540], 'programs': [2546], 'available': [2547], 'through': [2548, 3053], 'National': [2550], 'Biotechnology': [2553], 'Information': [2554], '(www.ncbi.nlm.nih.gov)': [2555], 'ExPASy': [2558], 'server': [2559], 'Swiss': [2562], 'Institute': [2563], 'Bioinformatics': [2565], '(www.expasy.ch).': [2566], 'submitted': [2575], 'GenBank™': [2577, 2706, 2743], 'accession': [2579, 2707, 2744], 'AY351860.': [2581], 'Polymerase': [2582], 'Chain': [2583], 'Reaction': [2584], 'Reverse': [2586], 'Transcriptase-PCR—Amplifications': [2587], '500': [2591, 3634, 4068], 'ng': [2592, 4069], 'purified': [2594, 3047, 4071], 'genomic': [2595, 2819, 4072], 'template': [2598], '50-μl': [2601, 4078], 'reaction': [2602, 4079], 'mixture': [2603, 4080], 'containing': [2604, 3074, 3321, 4081], '2.5': [2605, 4082], 'units': [2606, 4083], 'Taq': [2608], 'polymerase,': [2610, 4088], '0.5': [2611, 4089], 'μm': [2612, 4090], 'primer,': [2615, 4093], '0.2': [2616, 3228], 'mm': [2617, 2623, 3030, 3471, 3505, 3640, 3645, 4095], 'deoxynucleoside': [2620, 4098], 'triphosphate,': [2621, 4099], '2': [2622, 3216], 'MgCl2,': [2624], '5': [2626, 2644, 2884, 3287, 3303, 3613], 'μl': [2627, 3376, 3502, 3510, 3517, 3552, 3558, 3596, 3635, 3703], "manufacturer's": [2630, 2864, 3060, 3201], 'buffer': [2631, 3638, 3707], '(Invitrogen,': [2632], 'Carlsbad,': [2633], 'Amplification': [2635, 2875], 'reactions': [2636, 2852, 2876], 'MJ': [2641, 2881], 'Minicycler': [2642, 2882], 'min': [2645, 2669, 2680, 2885, 2909, 3347, 3354, 3460, 3488, 3591, 3630, 3680], '94': [2647, 2654, 2887, 2894], '°C,': [2648, 2888], '30': [2651, 2657, 2891, 2897, 3335, 3487, 3674], 'cycles': [2652, 2892], 's,': [2658, 2663, 2898, 2903], '40': [2662, 2902], '72': [2665, 2676, 2905, 2916], '1': [2668, 2908, 3237, 3519], 'per': [2670, 2910], 'kilobase,': [2671, 2911], 'concluding': [2672, 2912], 'extension': [2674, 2914], '10': [2679, 2919, 3459, 3470, 3504, 3629], 'primer': [2685], 'III.Table': [2694], 'IIIPrimers': [2695], 'studyApplicationPrimer': [2699], 'nameGene(s)': [2700], 'amplifiedMap': [2701], 'coordinatesbCorresponds': [2702], 'coordinates': [2704, 2741], 'AY351860Sequence(5′': [2709], '3′)REaRestriction': [2711], 'endonuclease': [2712, 2728], 'cleavage': [2713, 2729], 'introduced;': [2715, 2731], 'underlined': [2718, 2734], 'primerPCRaatA-FaatA2723-2744acggatccatgttaccagatataaatatagBamHIaatA-RaatA3766-3787acgaattccatttcccctgtattggaaatgEcoRIaatPint-FaatP1623-1642actctagatatcgacctaaaacggtaggXbaIaatPint-RaatP2120-2139acgaattcccttggcgtttaaagatgtgEcoRIaatAint-FaatA2893-2910actctagatgaaatgcttagtgagagXbaIaatAint-RaatA3395-3412acgaattcgatacccagactagcactEcoRIaatBint-FaatB3861-3880actctagacttgaggacatgattgaaggXbaIaatBint-RaatB4281-4300acgaattctttcctgttatactgaccggEcoRIaatCint-FaatC4610-4630actctagaagttggaaagacttcactgcXbaIaatCint-RaatC4889-4909acgaattccggagagaaatgatacattaEcoRIaatDint-FaatD5361-5380actctagaagttcttatgggttacttggXbaIaatDint-RaatD5841-5860acgaattcatcccatatttgtagtggagEcoRIaatW-Faat': [2722], 'cluster001-022acggatccggagacgtttggaggtgtatgggBamHIaatW-Raat': [2723], 'cluster6446-6465acgcggccgctagcgttattgttcaacgccNotIaat-PA-RaatP': [2724], 'aatA3864-3886acgcggccgcacattaccttcaatcatgtcctcNotIaatD-FaatD5142-5158acggatccatgaaattcgctattgtcttattgtBamHIaatD-RaatD6330-6356actctagatcatatctgtgtaaataaaaaaggttcXbaIaatAgtg-FaatA2552-2576acgaattcgtgagacacatattatactcatttcEcoRIaatAatg-FaatA2723-2744acgagctcatgttaccagatataaatatagSacIaatA(BAD)-RaatA3766-3787actctagatcacatttcccctgtattggaaatgXbaIRT-PCRaatP-FaatP1432-1457ctttgcactattatctaaatgaggcgaatP-RaatP2522-2548atctttccttttattgcattaacagggaatA-FaatA2723-2744atgttaccagatataaatatagaatA-RaatA3766-3787catttcccctgtattggaaatgaatB-FaatB3687-3709atgaaacagaaaatgaatttcagaatB-RaatB4483-4508ctaatcatctattataatctcaaacgaatC-FaatC4501-4523atgattagagtaaaaatacataaaatC-RaatC5108-5130ctatgtatttaatagttggattaaatD-FaatD5142-5166atgaaattcgctattgtcttattgtaatD-RaatD6328-6356tcatatctgtgtaaataaaaaaggttccgaatPmid-FaatP2004-2023ctcgataacagagtcaatgcCAT-FcatNAtcactggatataccaccgttCAT-RcatNAccactcatcgcagtactgtta': [2726], 'Restriction': [2727], 'primerb': [2738], 'Corresponds': [2739], 'AY351860': [2746], 'RT-PCR': [2753, 2869], '(27Sheikh': [2759], 'Total': [2779], 'RNA': [2780, 2822, 2843], 'extracted': [2782, 3434, 3604], 'RNeasy': [2785], 'mini': [2786], 'kit': [2787, 3755, 3848], '(Qiagen': [2788], 'Inc.,': [2789], 'Valencia,': [2790], 'CA)': [2791], 'LB': [2793, 3008, 3989], 'cultures': [2794, 3436, 3606], 'mid-log': [2797], 'phase;': [2798], 'preparations': [2799, 2823, 3148], 'treated': [2801], 'RNase-free': [2803], 'DNase': [2804], '(Roche': [2806], 'Science,': [2808], 'Indianapolis,': [2809], 'IN)': [2810], 'eliminate': [2812], 'contaminating': [2813, 2818], 'DNA.': [2814], 'verified': [2825], 'performing': [2827], 'chromosomal': [2831], 'chloramphenicol': [2832], 'acetyltransferase': [2833], '(cat)': [2834], '042.': [2838], 'To': [2839, 3097, 3381, 4039], 'synthesize': [2840], 'cDNA,': [2841], 'total': [2842], '(2': [2844], 'subjected': [2847], 'transcriptase': [2850], '(RT)': [2851], 'Thermoscript': [2854], 'RT': [2855], '(Invitrogen)': [2856], 'gene-specific': [2858], 'primers': [2860, 2975, 3901, 4051], 'instructions.': [2865], 'Primers': [2866], 'III.': [2874, 2980], 'min.': [2920, 3336], 'products': [2922], 'separated': [2924, 3084, 3767], '0.7-1.0%': [2926], 'gels,': [2928], 'stained': [2929], 'ethidium': [2931], 'bromide,': [2932], 'visualized': [2934, 3843], 'UV': [2936], 'transillumination.': [2937], 'Expression': [2939], 'Purification—The': [2941], 'expressed': [2946, 2985], '1064-bp': [2950], 'generated': [2952, 3897], 'BamHI': [2957], 'EcoRI': [2959, 3914], 'sites': [2960, 3915], '(Novagen,': [2966], 'Madison,': [2967], 'WI).': [2968], 'aatA-F': [2972], 'aatA-R': [2974], 'thereby': [2984], 'fusion': [2988, 3044, 3081, 3185], '6-histidine': [2991], 'tag': [2992, 2996, 3183], 'T7': [2995], 'C': [2999], 'terminus.': [3000], 'Protein': [3001, 3119], 'achieved': [3004], 'incubating': [3006], 'culture': [3009, 3272, 3328], '600': [3021], '0.5-0.6;': [3023], 'induced': [3027], '0.4': [3029], '(final': [3031], 'concentration)': [3032], 'isopropyl-β-d-thiogalactopyranoside': [3033], '(Sigma': [3034], 'Chemical': [3035], 'Co.,': [3036], 'St.': [3037], 'Louis,': [3038], 'MO)': [3039], '3': [3041, 3644], 'h.': [3042], 'denaturing': [3049], 'passage': [3052], 'Talon': [3054], 'metal': [3055], 'affinity': [3056], 'resin': [3057], 'protocols': [3061, 3730], '(Clontech,': [3062], 'Palo': [3063, 3130], 'Alto,': [3064, 3131], 'column': [3067], 'eluate': [3068, 3243], 'dialyzed': [3070, 3245], 'overnight': [3071, 3278, 3438, 3608], 'against': [3072, 3246], 'PBS': [3073], '8': [3075], 'm': [3076, 3229, 3238, 3520], 'urea': [3077], '(pH': [3078, 3231, 3240], '7.4).': [3079], 'SDS-PAGE': [3086, 3110, 3712, 3769], 'detected': [3088, 3744, 3830], 'staining': [3090, 3746], 'Coomassie': [3092, 3748], 'Brilliant': [3093, 3749], 'Blue': [3094, 3750], 'R250': [3095], '(Sigma).': [3096], 'confirm': [3098], 'identity': [3100], 'band': [3105], 'excised': [3107], 'analyzed': [3113], 'mass': [3115], 'spectrometry': [3116], 'Nucleic': [3121], 'Acid': [3122], 'Research': [3123], 'Facility,': [3124], 'Stanford': [3125], 'Medicine,': [3129], 'CA.': [3132], 'Generation': [3133], 'AatA-specific': [3135, 3179], 'Antibodies—Rabbit': [3136], 'antiserum': [3137, 3206, 3788], 'raised': [3142], 'subcutaneous': [3144], 'injection': [3145], "Freund's": [3150], 'adjuvant': [3151], '(28Harlow': [3154], 'Lane': [3156], 'Antibodies:': [3158], 'NY1998Google': [3169], 'Affinity': [3171], 'purification': [3172], 'concentrate': [3176], 'purify': [3178], 'antibodies.': [3180], '(10': [3187], 'mg)': [3188], 'coupled': [3190], 'CNBr-activated': [3192], 'Sepharose': [3193, 3214], '4B': [3194], '(Amersham': [3195, 3849], 'Biosciences,': [3196], 'Uppsala,': [3197], 'Sweden)': [3198], 'protocols,': [3202], 'hyperimmune': [3204], 'rabbit': [3205], 'absorbed': [3208], 'mixing': [3210], 'His6-AatA': [3212], 'protein-coupled': [3213], 'h': [3217, 3282], 'room': [3219, 3356, 3587], 'temperature.': [3220, 3357], 'After': [3221, 3296], 'washing,': [3222], 'bound': [3223], 'antibodies': [3224], 'eluted': [3226], 'glycine': [3230], '1.85)': [3232], 'neutralized': [3235], 'Tris-HCl': [3239], '8.5).': [3241], 'concentrated': [3248], 'Vivaspin': [3251], '20,': [3252], '50,000': [3253], 'weight': [3255], 'cut-off': [3256], '(Vivascience,': [3257], 'Hannover,': [3258], 'Germany),': [3259], 'Western': [3263], 'immunoblotting.': [3264], 'Preparation': [3265], 'Analysis': [3267], 'Cellular': [3269], 'Fractions—To': [3270], 'prepare': [3271], 'supernatant': [3273, 3308, 3686], 'fractions,': [3274], '6': [3281], 'ml': [3288, 3444, 3468, 3614], 'DMEM': [3290], '(high': [3293], 'DMEM).': [3295], 'centrifugation': [3297, 3363, 3453, 3623], '13,000': [3299, 3490], '×': [3300, 3343, 3366, 3456, 3491, 3626, 3683], 'g': [3301, 3344, 3367, 3457, 3492, 3627], 'min,': [3304, 3370, 3675], 'precipitated': [3310, 3690], 'trichloroacetic': [3312, 3319, 3692], 'acid': [3313, 3320, 3693], 'follows.': [3315], 'One-fourth': [3316], 'volume': [3317], '0.4%': [3322], '(w/v)': [3323, 3717, 3723], 'deoxycholate': [3324], 'supernatants': [3329], 'incubated': [3331, 3585], 'ice': [3333, 3672], 'pellet': [3338, 3359, 3497, 3583, 3698], 'centrifuged': [3340, 3485, 3677], '14,000': [3342, 3365], '15': [3346, 3353, 3369, 3679], 'washed': [3349], 'acetone': [3351], 'dried,': [3371], 'suspended': [3373], 'Laemmli': [3378, 3598, 3705], 'sample': [3379, 3599, 3706], 'buffer.': [3380, 3600], 'remove': [3382], '0.1%': [3391], 'Triton': [3392, 3513, 3649], 'X-100': [3393], 'Outer': [3430], 'proteins': [3432, 3602], '20': [3443, 3590], 'DMEM.': [3448, 3618], 'Bacteria': [3449, 3619], 'harvested': [3451, 3621], '6,000': [3455], '4': [3462, 3494], 'resuspended': [3465, 3499, 3593, 3632, 3700], '3.0': [3467], 'Tris,': [3472, 3506, 3641], 'pH': [3473, 3507, 3642], '8.0.': [3474], 'lysed': [3478], 'French': [3481], 'pressure': [3482], '°C.': [3495], '240': [3501], '8.0,': [3508, 3643], '60': [3509], '10%': [3512], 'X-100,': [3514], '1.5': [3516], 'MgCl2': [3521], '(29Skare': [3522], 'J.T.': [3523], 'Champion': [3524], 'C.I.': [3525], 'Mirzabekov': [3526], 'T.A.': [3527], 'Shang': [3528], 'E.S.': [3529], 'Erdjument-Bromage': [3532], 'Tempst': [3534], 'Kagan': [3536], 'B.L.': [3537], 'Miller': [3538], 'J.N.': [3539], 'Lovett': [3540], 'M.A.': [3541], '178:': [3545], '4909-4918Crossref': [3546], 'Scholar)': [3549, 3817], '35': [3551], 'distilled': [3554], 'H2O': [3555], '265': [3557], '20%': [3560], 'Sarkosyl': [3561], '(30Amako': [3562], 'Wai': [3564], 'S.N.': [3565], 'Umeda': [3566], 'Shigematsu': [3568], 'Takade': [3570], 'Immunol.': [3573], '40:': [3575], '749-754Crossref': [3576], '(15)': [3579], 'temperature': [3588], 'Periplasmic': [3601], '3800': [3625, 3682], 'lysis': [3637], '(50': [3639], 'EDTA,': [3646], '1%': [3648], 'X-100)': [3650], '(31Thorstenson': [3651], 'Y.R.': [3652], 'Zhang': [3653], 'Olson': [3655], 'P.S.': [3656], 'Mascarenhas': [3657], '179:': [3662], '5333-5339Crossref': [3663], 'suspension': [3668], 'kept': [3670], 'g.': [3684], 'above.': [3696], 'separate': [3709], 'analysis.': [3710], 'One-dimensional': [3711], '10-15%': [3716], 'acrylamide': [3718, 3724], 'separating': [3719], 'gels': [3720, 3726], '4.0%': [3722], 'stacking': [3725], '(32Laemmli': [3731], 'U.K.': [3732], 'Nature.': [3733], '1970;': [3734], '227:': [3735], '680-685Crossref': [3736], '(206658)': [3739], 'Proteins': [3742], 'Silver': [3753], 'Stain': [3754], 'Bio-Rad': [3757], 'Laboratories': [3758], '(Hercules,': [3759], 'immunoblot': [3762], 'analyses,': [3763], 'samples': [3765], 'transferred': [3771], 'Immobilon-P': [3773], 'membranes': [3774], '(Millipore)': [3775], 'protocols.': [3778], 'detection': [3780], 'Aap,': [3784], 'anti-AatA': [3785], 'anti-Aap': [3787], 'dilutions': [3821], '1:1,000': [3823], '1:8,000,': [3825], 'respectively;': [3826], 'antibody': [3827], 'binding': [3828], 'horseradish': [3832], 'peroxidase-conjugated': [3833], 'goat': [3834], 'anti-rabbit': [3835], 'IgG': [3836], 'dilution': [3839], '1:40,000': [3841], 'chemiluminescence': [3846], 'ECL': [3847], 'Biosciences).': [3850], 'Mutagenesis': [3851], 'Complementation—Insertional': [3853], 'mutants': [3854], 'constructed': [3859], 'single-crossover': [3861], 'insertion': [3862], 'Briefly,': [3888], 'portion': [3891], 'target': [3894], 'III,': [3905], 'XbaI': [3912], 'π-dependent': [3918], '(33Penfold': [3922], 'resulting': [3937], '(pINTP,': [3939], 'pINTA,': [3940], 'pINTB,': [3941], 'pINTC,': [3942], 'pINTD)': [3944], 'DH5α': [3950], 'λpir': [3951], 'prior': [3952], 'donor': [3957], 'S17-1λpir.': [3962], 'mutant': [3964], 'obtained': [3968], 'conjugal': [3970], 'mating': [3971], 'between': [3972], 'wild': [3974], 'type': [3975], 'parent': [3976], '(which': [3979], 'acid-resistant)': [3982], 'S17-1λpir(pINT).': [3984], 'Transconjugants': [3985], 'agar': [3990], 'supplemented': [3991], 'kanamycin': [3993], 'acid.': [3996], 'process': [3998], 'resulted': [3999, 4017], 'merodiploid': [4001], 'integration': [4002], 'pINT': [4004], 'Integration': [4013], 'constructs': [4016], 'duplication': [4019], 'predicted': [4021], 'codons': [4022], '64-230': [4023], 'aatP,': [4025], '100-272': [4026], '58-204': [4029], '36-136': [4032], '73-239': [4036], 'aatD.': [4038], 'complement': [4040], 'mutants,': [4042], 'amplified': [4047], 'III': [4055], 'Amplifications': [4064], 'templates': [4075], 'Platinum': [4085], 'Pfx': [4086], '0.3': [4094]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W1999997395', 'counts_by_year': [{'year': 2024, 'cited_by_count': 2}, {'year': 2023, 'cited_by_count': 3}, {'year': 2022, 'cited_by_count': 5}, {'year': 2021, 'cited_by_count': 12}, {'year': 2020, 'cited_by_count': 12}, {'year': 2019, 'cited_by_count': 2}, {'year': 2018, 'cited_by_count': 12}, {'year': 2017, 'cited_by_count': 6}, {'year': 2016, 'cited_by_count': 12}, {'year': 2015, 'cited_by_count': 6}, {'year': 2014, 'cited_by_count': 10}, {'year': 2013, 'cited_by_count': 11}, {'year': 2012, 'cited_by_count': 10}], 'updated_date': '2024-12-17T14:28:42.266796', 'created_date': '2016-06-24'}