Glycogen Synthase Kinase-3β Inhibits the Xenobiotic and Antioxidant Cell Response by Direct Phosphorylation and Nuclear Exclusion of the Transcription Factor Nrf2

Name: Work Video:
Duration: 3 min 30 s
María Salazar‐Roa; Ana I. Rojo; Diego Velasco; Rosa María de Sagarra; Antonio Cuadrado
{'id': 'https://openalex.org/W1999148207', 'doi': 'https://doi.org/10.1074/jbc.m513737200', 'title': 'Glycogen Synthase Kinase-3β Inhibits the Xenobiotic and Antioxidant Cell Response by Direct Phosphorylation and Nuclear Exclusion of the Transcription Factor Nrf2', 'display_name': 'Glycogen Synthase Kinase-3β Inhibits the Xenobiotic and Antioxidant Cell Response by Direct Phosphorylation and Nuclear Exclusion of the Transcription Factor Nrf2', 'publication_year': 2006, 'publication_date': '2006-03-22', 'ids': {'openalex': 'https://openalex.org/W1999148207', 'doi': 'https://doi.org/10.1074/jbc.m513737200', 'mag': '1999148207', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/16551619'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m513737200', 'pdf_url': 'http://www.jbc.org/article/S0021925820724282/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S0021925820724282/pdf', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5042903683', 'display_name': 'María Salazar‐Roa', 'orcid': 'https://orcid.org/0000-0001-6784-9541'}, 'institutions': [{'id': 'https://openalex.org/I63634437', 'display_name': 'Universidad Autónoma de Madrid', 'ror': 'https://ror.org/01cby8j38', 'country_code': 'ES', 'type': 'education', 'lineage': ['https://openalex.org/I63634437']}], 'countries': ['ES'], 'is_corresponding': False, 'raw_author_name': 'María Salazar', 'raw_affiliation_strings': ['Instituto de Investigaciones Biomédicas and Departamento de Bioquímica, Facultad de Medicina, Universidad Autónoma de Madrid, 28029 Madrid, Spain'], 'affiliations': [{'raw_affiliation_string': 'Instituto de Investigaciones Biomédicas and Departamento de Bioquímica, Facultad de Medicina, Universidad Autónoma de Madrid, 28029 Madrid, Spain', 'institution_ids': ['https://openalex.org/I63634437']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5081442628', 'display_name': 'Ana I. Rojo', 'orcid': 'https://orcid.org/0000-0002-0312-5867'}, 'institutions': [{'id': 'https://openalex.org/I63634437', 'display_name': 'Universidad Autónoma de Madrid', 'ror': 'https://ror.org/01cby8j38', 'country_code': 'ES', 'type': 'education', 'lineage': ['https://openalex.org/I63634437']}], 'countries': ['ES'], 'is_corresponding': False, 'raw_author_name': 'Ana I. Rojo', 'raw_affiliation_strings': ['Instituto de Investigaciones Biomédicas and Departamento de Bioquímica, Facultad de Medicina, Universidad Autónoma de Madrid, 28029 Madrid, Spain'], 'affiliations': [{'raw_affiliation_string': 'Instituto de Investigaciones Biomédicas and Departamento de Bioquímica, Facultad de Medicina, Universidad Autónoma de Madrid, 28029 Madrid, Spain', 'institution_ids': ['https://openalex.org/I63634437']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5108283056', 'display_name': 'Diego Velasco', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I63634437', 'display_name': 'Universidad Autónoma de Madrid', 'ror': 'https://ror.org/01cby8j38', 'country_code': 'ES', 'type': 'education', 'lineage': ['https://openalex.org/I63634437']}], 'countries': ['ES'], 'is_corresponding': False, 'raw_author_name': 'Diego Velasco', 'raw_affiliation_strings': ['Instituto de Investigaciones Biomédicas and Departamento de Bioquímica, Facultad de Medicina, Universidad Autónoma de Madrid, 28029 Madrid, Spain'], 'affiliations': [{'raw_affiliation_string': 'Instituto de Investigaciones Biomédicas and Departamento de Bioquímica, Facultad de Medicina, Universidad Autónoma de Madrid, 28029 Madrid, Spain', 'institution_ids': ['https://openalex.org/I63634437']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5079674460', 'display_name': 'Rosa María de Sagarra', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I63634437', 'display_name': 'Universidad Autónoma de Madrid', 'ror': 'https://ror.org/01cby8j38', 'country_code': 'ES', 'type': 'education', 'lineage': ['https://openalex.org/I63634437']}], 'countries': ['ES'], 'is_corresponding': False, 'raw_author_name': 'Rosa María de Sagarra', 'raw_affiliation_strings': ['Instituto de Investigaciones Biomédicas and Departamento de Bioquímica, Facultad de Medicina, Universidad Autónoma de Madrid, 28029 Madrid, Spain'], 'affiliations': [{'raw_affiliation_string': 'Instituto de Investigaciones Biomédicas and Departamento de Bioquímica, Facultad de Medicina, Universidad Autónoma de Madrid, 28029 Madrid, Spain', 'institution_ids': ['https://openalex.org/I63634437']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5067010957', 'display_name': 'Antonio Cuadrado', 'orcid': 'https://orcid.org/0000-0002-4039-7140'}, 'institutions': [{'id': 'https://openalex.org/I63634437', 'display_name': 'Universidad Autónoma de Madrid', 'ror': 'https://ror.org/01cby8j38', 'country_code': 'ES', 'type': 'education', 'lineage': ['https://openalex.org/I63634437']}], 'countries': ['ES'], 'is_corresponding': False, 'raw_author_name': 'Antonio Cuadrado', 'raw_affiliation_strings': ['Instituto de Investigaciones Biomédicas and Departamento de Bioquímica, Facultad de Medicina, Universidad Autónoma de Madrid, 28029 Madrid, Spain'], 'affiliations': [{'raw_affiliation_string': 'Instituto de Investigaciones Biomédicas and Departamento de Bioquímica, Facultad de Medicina, Universidad Autónoma de Madrid, 28029 Madrid, Spain', 'institution_ids': ['https://openalex.org/I63634437']}]}], 'institution_assertions': [], 'countries_distinct_count': 1, 'institutions_distinct_count': 1, 'corresponding_author_ids': [], 'corresponding_institution_ids': [], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 6.175, 'has_fulltext': True, 'fulltext_origin': 'ngrams', 'cited_by_count': 475, 'citation_normalized_percentile': {'value': 0.999981, 'is_in_top_1_percent': True, 'is_in_top_10_percent': True}, 'cited_by_percentile_year': {'min': 99, 'max': 100}, 'biblio': {'volume': '281', 'issue': '21', 'first_page': '14841', 'last_page': '14851'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T11332', 'display_name': 'Genomics, phytochemicals, and oxidative stress', 'score': 0.9999, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, 'topics': [{'id': 'https://openalex.org/T11332', 'display_name': 'Genomics, phytochemicals, and oxidative stress', 'score': 0.9999, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T12187', 'display_name': 'Glutathione Transferases and Polymorphisms', 'score': 0.9564, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/gsk3b', 'display_name': 'GSK3B', 'score': 0.49517313}], 'concepts': [{'id': 'https://openalex.org/C75217442', 'wikidata': 'https://www.wikidata.org/wiki/Q423650', 'display_name': 'Protein kinase B', 'level': 3, 'score': 0.6222527}, {'id': 'https://openalex.org/C182996813', 'wikidata': 'https://www.wikidata.org/wiki/Q910847', 'display_name': 'GSK-3', 'level': 3, 'score': 0.6132698}, {'id': 'https://openalex.org/C11960822', 'wikidata': 'https://www.wikidata.org/wiki/Q242736', 'display_name': 'Phosphorylation', 'level': 2, 'score': 0.55518866}, {'id': 'https://openalex.org/C153911025', 'wikidata': 'https://www.wikidata.org/wiki/Q7202', 'display_name': 'Molecular biology', 'level': 1, 'score': 0.5143064}, {'id': 'https://openalex.org/C104629339', 'wikidata': 'https://www.wikidata.org/wiki/Q18258585', 'display_name': 'GSK3B', 'level': 4, 'score': 0.49517313}, {'id': 'https://openalex.org/C86554907', 'wikidata': 'https://www.wikidata.org/wiki/Q285613', 'display_name': 'PI3K/AKT/mTOR pathway', 'level': 3, 'score': 0.48912865}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.4744181}, {'id': 'https://openalex.org/C86339819', 'wikidata': 'https://www.wikidata.org/wiki/Q407384', 'display_name': 'Transcription factor', 'level': 3, 'score': 0.4713542}, {'id': 'https://openalex.org/C55493867', 'wikidata': 'https://www.wikidata.org/wiki/Q7094', 'display_name': 'Biochemistry', 'level': 1, 'score': 0.46714374}, {'id': 'https://openalex.org/C185592680', 'wikidata': 'https://www.wikidata.org/wiki/Q2329', 'display_name': 'Chemistry', 'level': 0, 'score': 0.40696648}, {'id': 'https://openalex.org/C95444343', 'wikidata': 'https://www.wikidata.org/wiki/Q7141', 'display_name': 'Cell biology', 'level': 1, 'score': 0.3991985}, {'id': 'https://openalex.org/C62478195', 'wikidata': 'https://www.wikidata.org/wiki/Q828130', 'display_name': 'Signal transduction', 'level': 2, 'score': 0.34371793}, {'id': 'https://openalex.org/C104317684', 'wikidata': 'https://www.wikidata.org/wiki/Q7187', 'display_name': 'Gene', 'level': 2, 'score': 0.052738637}], 'mesh': [{'descriptor_ui': 'D000975', 'descriptor_name': 'Antioxidants', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D002467', 'descriptor_name': 'Cell Nucleus', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D038362', 'descriptor_name': 'Glycogen Synthase Kinase 3', 'qualifier_ui': 'Q000502', 'qualifier_name': 'physiology', 'is_major_topic': True}, {'descriptor_ui': 'D051267', 'descriptor_name': 'NF-E2-Related Factor 2', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D015262', 'descriptor_name': 'Xenobiotics', 'qualifier_ui': 'Q000494', 'qualifier_name': 'pharmacology', 'is_major_topic': True}, {'descriptor_ui': 'D000975', 'descriptor_name': 'Antioxidants', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002460', 'descriptor_name': 'Cell Line', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002467', 'descriptor_name': 'Cell Nucleus', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D038362', 'descriptor_name': 'Glycogen Synthase Kinase 3', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D038362', 'descriptor_name': 'Glycogen Synthase Kinase 3', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D000071679', 'descriptor_name': 'Glycogen Synthase Kinase 3 beta', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D006801', 'descriptor_name': 'Humans', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D006861', 'descriptor_name': 'Hydrogen Peroxide', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D006861', 'descriptor_name': 'Hydrogen Peroxide', 'qualifier_ui': 'Q000494', 'qualifier_name': 'pharmacology', 'is_major_topic': False}, {'descriptor_ui': 'D007770', 'descriptor_name': 'L-Lactate Dehydrogenase', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D007770', 'descriptor_name': 'L-Lactate Dehydrogenase', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D008856', 'descriptor_name': 'Microscopy, Fluorescence', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D051267', 'descriptor_name': 'NF-E2-Related Factor 2', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D018384', 'descriptor_name': 'Oxidative Stress', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D010766', 'descriptor_name': 'Phosphorylation', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D010957', 'descriptor_name': 'Plasmids', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D010957', 'descriptor_name': 'Plasmids', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D015262', 'descriptor_name': 'Xenobiotics', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}], 'locations_count': 2, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m513737200', 'pdf_url': 'http://www.jbc.org/article/S0021925820724282/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/16551619', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m513737200', 'pdf_url': 'http://www.jbc.org/article/S0021925820724282/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 58, 'referenced_works': ['https://openalex.org/W1546972840', 'https://openalex.org/W1558003391', 'https://openalex.org/W1900912696', 'https://openalex.org/W1965093955', 'https://openalex.org/W1971465028', 'https://openalex.org/W1976320711', 'https://openalex.org/W1976919988', 'https://openalex.org/W1978483995', 'https://openalex.org/W1983480912', 'https://openalex.org/W1987777210', 'https://openalex.org/W1991265255', 'https://openalex.org/W1999440837', 'https://openalex.org/W2003603472', 'https://openalex.org/W2005065484', 'https://openalex.org/W2005568856', 'https://openalex.org/W2008344420', 'https://openalex.org/W2009052914', 'https://openalex.org/W2030365747', 'https://openalex.org/W2036246693', 'https://openalex.org/W2039842713', 'https://openalex.org/W2040114786', 'https://openalex.org/W2043959412', 'https://openalex.org/W2049840630', 'https://openalex.org/W2053350368', 'https://openalex.org/W2053671318', 'https://openalex.org/W2059524588', 'https://openalex.org/W2062934426', 'https://openalex.org/W2064956702', 'https://openalex.org/W2070760917', 'https://openalex.org/W2071677331', 'https://openalex.org/W2076405456', 'https://openalex.org/W2079464266', 'https://openalex.org/W2079714141', 'https://openalex.org/W2080435498', 'https://openalex.org/W2083165373', 'https://openalex.org/W2087311397', 'https://openalex.org/W2093507774', 'https://openalex.org/W2094961464', 'https://openalex.org/W2096576561', 'https://openalex.org/W2099244520', 'https://openalex.org/W2099491441', 'https://openalex.org/W2119080788', 'https://openalex.org/W2119109207', 'https://openalex.org/W2121966499', 'https://openalex.org/W2132004503', 'https://openalex.org/W2137909108', 'https://openalex.org/W2148454550', 'https://openalex.org/W2154111513', 'https://openalex.org/W2155324869', 'https://openalex.org/W2155905348', 'https://openalex.org/W2159820690', 'https://openalex.org/W2165468754', 'https://openalex.org/W2168395641', 'https://openalex.org/W2168713325', 'https://openalex.org/W4319704909', 'https://openalex.org/W68369576', 'https://openalex.org/W80953942', 'https://openalex.org/W95988660'], 'related_works': ['https://openalex.org/W4205189596', 'https://openalex.org/W3183179750', 'https://openalex.org/W3116479654', 'https://openalex.org/W2916964185', 'https://openalex.org/W2422815049', 'https://openalex.org/W2225898801', 'https://openalex.org/W2098584395', 'https://openalex.org/W2070783513', 'https://openalex.org/W2024933597', 'https://openalex.org/W1578127299'], 'abstract_inverted_index': {'The': [0, 248, 644, 825, 2778, 2839, 2857, 2982, 3145, 3274, 3370, 3419, 3436, 3700, 3900, 4079, 4154], 'transcription': [1, 170, 249, 418, 1034, 1113, 1695, 2207], 'factor': [2, 5, 7, 171, 250, 253, 255, 419, 1035, 1038, 1114, 1619], 'Nrf2': [3, 31, 136, 146, 165, 175, 251, 279, 384, 394, 413, 423, 1104, 1283, 1305, 1343, 1354, 1537, 1561, 1600, 1613, 1762, 2166, 2197, 3026], '(nuclear': [4, 252], 'E2-related': [6, 254], '2)': [8, 256], 'regulates': [9, 257], 'the': [10, 36, 47, 54, 73, 126, 131, 159, 173, 177, 221, 224, 231, 241, 258, 284, 295, 302, 321, 374, 379, 407, 421, 425, 469, 472, 479, 489, 618, 634, 841, 848, 1033, 1046, 1109, 1172, 1239, 1293, 1335, 1346, 1357, 1364, 1544, 1550, 1553, 1560, 1565, 1591, 1596, 1626, 1691, 1758, 1765, 1879, 1884, 1943, 1963, 1975, 2076, 2124, 2144, 2150, 2153, 2189, 2203, 2246, 2430, 2532, 2539, 2695, 2828, 2843, 2904, 2909, 3015, 3053, 3074, 3216, 3222, 3238, 3407, 3412, 3538, 3612, 3616, 3638, 3672, 3682, 3685, 3689, 3697, 3735, 3746, 3760, 3771, 3797, 3826, 3834, 3856, 3892, 3904, 3930, 3998, 4004, 4027, 4119, 4157, 4161, 4176, 4185], 'expression': [11, 178, 212, 259, 426, 460, 1052, 2431, 4200], 'of': [12, 100, 111, 130, 161, 164, 179, 204, 244, 260, 348, 359, 378, 409, 412, 427, 452, 492, 611, 636, 647, 767, 834, 870, 950, 970, 1048, 1053, 1059, 1108, 1171, 1334, 1552, 1559, 1569, 1598, 1628, 1693, 1761, 1767, 1785, 1872, 1878, 1886, 1892, 1905, 1939, 2078, 2152, 2170, 2192, 2196, 2205, 2237, 2319, 2322, 2331, 2336, 2365, 2372, 2393, 2424, 2441, 2487, 2713, 2788, 2866, 2917, 3061, 3079, 3084, 3154, 3237, 3514, 3528, 3540, 3543, 3549, 3556, 3576, 3583, 3607, 3632, 3641, 3650, 3684, 3691, 3738, 3763, 3790, 3903, 3924, 3934, 3977, 3987, 3993, 4012, 4024, 4038, 4048, 4081, 4088, 4106, 4113, 4163, 4206, 4215, 4247], 'antioxidant': [13, 127, 232, 261, 375, 480, 546, 594, 761, 893, 986, 2155], 'phase': [14, 85, 209, 233, 262, 333, 457, 481, 771, 971, 1054, 1336, 1570, 3591, 4180], 'II': [15, 86, 210, 234, 263, 334, 458, 482, 772, 972, 1055, 1337, 1571, 3592, 4181], 'genes': [16, 264, 769, 774, 810, 1056, 1572, 3593], 'and': [17, 23, 46, 93, 97, 106, 108, 115, 123, 134, 149, 153, 189, 192, 199, 213, 230, 237, 265, 271, 294, 341, 345, 354, 356, 363, 371, 382, 397, 401, 437, 440, 447, 461, 478, 485, 639, 662, 821, 839, 881, 946, 1050, 1188, 1218, 1238, 1284, 1350, 1360, 1567, 1609, 1614, 1794, 1971, 1988, 2065, 2149, 2172, 2199, 2211, 2231, 2259, 2264, 2276, 2310, 2326, 2484, 2513, 2526, 2565, 2589, 2603, 2614, 2636, 2682, 2700, 2715, 2718, 2768, 2850, 2953, 2988, 2992, 3020, 3076, 3099, 3122, 3135, 3224, 3245, 3264, 3289, 3310, 3341, 3380, 3398, 3452, 3478, 3491, 3580, 3599, 3662, 3674, 3688, 3711, 3718, 3745, 3770, 3810, 3828, 3877, 3894, 3946, 3982, 4007, 4056, 4076, 4097, 4209, 4225, 4241, 4259], 'contributes': [18, 266], 'to': [19, 28, 167, 219, 267, 276, 415, 467, 500, 621, 641, 830, 845, 884, 1215, 1226, 1295, 1564, 1595, 1623, 1796, 1908, 1949, 1985, 2158, 2201, 2538, 2684, 2842, 3119, 3124, 3232, 3611, 3825, 3897, 3906, 4032, 4053, 4102, 4128, 4160, 4178, 4218], 'preserve': [20, 268], 'redox': [21, 269, 623, 754], 'homeostasis': [22, 270], 'cell': [24, 38, 200, 235, 272, 286, 448, 483, 619, 642, 1911, 1940, 2676, 2779, 3146], 'viability': [25, 273], 'in': [26, 140, 147, 150, 274, 388, 395, 398, 633, 653, 1045, 1292, 1557, 1612, 1690, 1764, 1782, 1820, 1901, 1983, 2074, 2123, 2220, 2280, 2397, 2502, 2547, 2680, 2784, 2848, 2862, 2903, 2913, 2962, 2986, 3003, 3081, 3093, 3116, 3150, 3198, 3219, 3253, 3287, 3295, 3322, 3386, 3427, 3465, 3537, 3553, 3696, 3783, 3847, 3969, 4156, 4237], 'response': [27, 128, 275, 376, 547, 595, 883, 987, 1984, 2156], 'oxidant': [29, 214, 277, 462, 1547, 1954], 'insults.': [30, 278], 'should': [32, 280], 'be': [33, 281, 1308, 2159], 'coordinated': [34, 282], 'with': [35, 283, 1169, 1232, 1288, 1345, 2226, 2242, 2429, 2515, 2531, 2633, 2640, 2765, 2852, 2990, 3014, 3024, 3033, 3044, 3073, 3109, 3132, 3283, 3312, 3326, 3338, 3351, 3358, 3363, 3374, 3396, 3400, 3417, 3506, 3713, 3734, 3759, 3841, 3891, 3915, 3960, 4009, 4017, 4151, 4199, 4212, 4255], 'canonical': [37, 285], 'survival': [39, 225, 287, 473, 1964, 4187], 'pathway': [40, 288, 1965, 1980, 4188], 'represented': [41, 289, 1966, 4085], 'by': [42, 69, 228, 290, 317, 476, 847, 1229, 1356, 1363, 1621, 1825, 1875, 1962, 1967, 1992, 2069, 2118, 2314, 2360, 2381, 2708, 2770, 2970, 3137, 3206, 3278, 3343, 3706, 4184], 'phosphatidylinositol': [43, 291, 514, 562], '3-kinase': [44, 292], '(PI3K)': [45, 293, 1970], 'Ser/Thr': [48, 296, 1779, 1976], 'kinase': [49, 297, 1780, 1969, 1977, 2177, 3054, 3075], 'Akt': [50, 94, 298, 342, 2066, 4252], 'but': [51, 299, 1757, 1942, 1990], 'so': [52, 300], 'far': [53, 301], 'mechanistic': [55, 303, 2186], 'connections': [56, 304], 'remain': [57, 305, 1602], 'undefined.': [58, 306], 'Here': [59, 307], 'we': [60, 88, 308, 336, 2164, 2173, 3614, 4173], 'identify': [61, 309, 2165], 'glycogen': [62, 310, 517, 565, 1790], 'synthase': [63, 311, 518, 566, 1774], 'kinase-3β': [64, 312, 1775], '(GSK-3β),': [65, 313], 'which': [66, 314, 631], 'is': [67, 166, 315, 414, 889, 976, 1041, 1105, 1302, 1684, 1777, 1956, 1959, 1981, 2115, 2395], 'inhibited': [68, 316], 'Akt-mediated': [70, 318, 2119], 'phosphorylation,': [71, 319], 'as': [72, 82, 137, 240, 320, 330, 385, 488, 608, 1236, 1898, 1935, 1953, 1996, 2167, 2723, 3594, 3596, 3817, 3845, 3952, 3967, 4086, 4191], 'link': [74, 322], 'between': [75, 223, 323, 471, 2147, 3221, 4131], 'both': [76, 91, 208, 324, 339, 456, 1282, 3051], 'processes.': [77, 325], 'Using': [78, 326], 'heme': [79, 327, 543, 591, 822, 829, 874], 'oxygenase-1': [80, 328, 823], '(HO-1)': [81, 329], 'a': [83, 331, 609, 625, 765, 871, 890, 980, 1042, 1106, 1117, 1685, 1778, 1783, 1887, 1902, 1936, 2168, 2185, 2334, 2548, 2963, 3199, 3254, 3387, 3428, 3647, 3741, 3766, 3784, 3864, 3988, 4033, 4069, 4192], 'model': [84, 332], 'gene,': [87, 335], 'found': [89, 337], 'that': [90, 120, 158, 338, 368, 406, 601, 763, 1032, 1281, 1304, 1617, 1788, 1870, 2071, 2175, 3030, 3604, 3887], 'PI3K': [92, 340, 2064, 4207], 'increased': [95, 343, 4245, 4256], 'mRNA': [96, 344, 4224, 4258], 'protein': [98, 346, 1241, 1348, 1538, 3223, 3908, 4114, 4226, 4260], 'levels': [99, 347, 616, 949, 1306, 1333, 1539, 3789, 3923, 4227, 4246, 4261], 'this': [101, 141, 169, 245, 349, 389, 417, 493, 1351, 1618, 2142, 2162, 2176, 2206], 'enzyme.': [102, 350], 'Pharmacological': [103, 351], 'inhibitors': [104, 352, 1896], '(LiCl': [105, 353], 'PDZD-8)': [107, 355], 'genetic': [109, 357], 'variants': [110, 358], 'GSK-3β': [112, 124, 144, 206, 239, 360, 372, 392, 454, 487, 1818, 1873, 1932, 1946, 1958, 2079, 2113, 2171, 2193, 2250, 3064, 3598], '(constitutively': [113, 361], 'active': [114, 205, 362, 453, 3062, 4249], 'dominant': [116, 364, 1889], 'negative': [117, 365, 1227, 1890, 2329], 'mutants)': [118, 366], 'indicated': [119, 367, 2698, 2907, 3736, 3761, 3846], 'PI3K/Akt': [121, 229, 369, 477, 4186], 'activates': [122, 370], 'inhibits': [125, 373], 'elements': [129, 377], 'ho1': [132, 380], 'promoter': [133, 381], 'pointed': [135, 383], 'directly': [138, 386], 'involved': [139, 387, 1781], 'process.': [142, 390], 'Indeed,': [143, 391], 'phosphorylated': [145, 393], 'vitro': [148, 396, 2999], 'vivo.': [151, 399], 'Immunocytochemistry': [152, 400], 'subcellular': [154, 402, 1769, 2180], 'fractionation': [155, 403], 'analyses': [156, 404], 'demonstrated': [157, 405], 'effect': [160, 408], 'GSK-3β-mediated': [162, 410], 'phosphorylation': [163, 411, 1763, 2120, 3000], 'exclude': [168, 416], 'from': [172, 420, 1829, 2248, 2255, 2262, 2269, 2452, 2521, 2618, 3039, 3318, 3516, 3885, 3912, 4003, 4026, 4233], 'nucleus.': [174, 422], 'up-regulated': [176, 424], 'HO-1,': [180, 428, 975], 'glutathione': [181, 183, 197, 429, 431, 445, 815, 819, 3792], 'peroxidase,': [182, 430], 'S-transferase': [184, 432], 'A1,': [185, 433], 'NAD(P)H:': [186, 434], 'quinone': [187, 435], 'oxidoreductase': [188, 436, 813, 3780], 'glutamate-cysteine': [190, 438, 538, 586, 817], 'ligase': [191, 439, 539, 587], 'protected': [193, 441], 'against': [194, 442], 'hydrogen': [195, 443], 'peroxide-induced': [196, 444], 'depletion': [198, 446], 'death,': [201, 449], 'whereas': [202, 450], 'co-expression': [203, 451], 'attenuated': [207, 455], 'gene': [211, 459, 1338, 3680, 4182], 'protection.': [215, 463], 'These': [216, 464, 809, 2690], 'results': [217, 465, 632, 1900], 'contribute': [218, 466, 2200], 'clarify': [220, 468], 'cross-talk': [222, 470], 'signal': [226, 474], 'elicited': [227, 475], 'response,': [236, 484], 'introduce': [238, 486], 'key': [242, 490], 'mediator': [243, 491], 'regulation': [246, 494, 1047, 1058, 1228, 1624, 1692, 1766, 2151, 2204], 'mechanism.': [247, 495], 'Cells': [496, 2629], 'are': [497, 602, 952, 1223, 1340, 1540, 2278], 'continuously': [498], 'exposed': [499, 3123], 'reactive': [501, 510, 558], 'oxygen': [502, 511, 559], 'species': [503], '(ROS)': [504], '3The': [505, 553], 'abbreviations': [506, 554], 'used': [507, 555, 2560, 3438, 3464, 3677, 4127], 'are:': [508, 556], 'ROS,': [509, 557], 'species;': [512, 560], 'PI3K,': [513, 561], '3-kinase;': [515, 563], 'GSK-3β,': [516, 564, 1893], 'kinase-3β;': [519, 567], 'PBS,': [520, 568, 3359], 'phosphate-buffered': [521, 569], 'saline;': [522, 570], 'MOPS,': [523, 571, 3096], '4-morpholinepropanesulfonic': [524, 572], 'acid;': [525, 573], 'DAPI,': [526, 574], '4′,6-diamidino-2-phenylindole;': [527, 575], 'LDH,': [528, 576], 'lactate': [529, 577], 'dehydrogenase;': [530, 578], 'HA,': [531, 579], 'hemagglutinin;': [532, 580], 'ELISA,': [533, 581], 'enzyme-linked': [534, 582], 'immunosorbent': [535, 583], 'assay;': [536, 584], 'GSTA,': [537, 585], 'modulatory': [540, 588], 'subunit;': [541, 589], 'HO,': [542, 590], 'oxygenase;': [544, 592], 'ARE,': [545, 593], 'element;': [548, 596], 'BSO,': [549, 597], 'l-buthionine-(S,R)-sulfoximine;': [550, 598], '4HT,': [551, 599, 2258], '4-hydroxytamoxifen.': [552, 600], 'generated': [603], 'during': [604, 3855], 'aerobic': [605, 756], 'metabolism': [606], 'or': [607, 1297, 1883, 1894, 2854, 3027, 3035, 3047, 3126, 4109], 'result': [610], 'extracellular': [612, 3925, 3994, 4082], 'aggression.': [613], 'When': [614], 'ROS': [615, 648], 'exceed': [617], 'capacity': [620], 'maintain': [622, 753], 'homeostasis,': [624, 755], 'condition': [626], 'termed': [627, 770, 985], 'oxidative': [628, 885, 1816], 'stress': [629], 'occurs,': [630], 'oxidation': [635], 'cellular': [637, 1629, 3502], 'macromolecules': [638], 'leads': [640], 'death.': [643], 'detrimental': [645], 'accumulation': [646, 1601], 'plays': [649], 'an': [650, 760, 879, 3621, 4213], 'important': [651], 'role': [652, 1760], 'multiple': [654], 'pathologies,': [655], 'including': [656, 974], 'neurodegenerative': [657], 'disorders,': [658], 'cancer,': [659], 'atherosclerosis,': [660], 'diabetes,': [661], 'aging': [663], '(1Moreira': [664], 'P.I.': [665], 'Smith': [666], 'M.A.': [667], 'Zhu': [668], 'X.': [669, 1638], 'Nunomura': [670], 'A.': [671, 743, 914, 937, 1148, 1157, 1395, 2007, 2052, 2316, 2408], 'Castellani': [672], 'R.J.': [673], 'Perry': [674], 'G.': [675, 2621], 'Ann.': [676], 'N.': [677, 780, 1125, 1424, 2003, 2285, 2454], 'Y.': [678, 1403, 1474], 'Acad.': [679, 739, 910, 933, 1153], 'Sci.': [680, 740, 911, 934, 1154], '2005;': [681, 710, 861, 964, 1206, 1254, 1381, 1478, 1582, 1648, 1670, 2086, 2133], '1043:': [682], '545-552Crossref': [683], 'PubMed': [684, 698, 718, 747, 789, 804, 864, 918, 941, 965, 1007, 1021, 1101, 1136, 1161, 1183, 1209, 1262, 1275, 1324, 1389, 1416, 1442, 1466, 1481, 1502, 1528, 1585, 1656, 1678, 1711, 1733, 1752, 1810, 1859, 1926, 2019, 2035, 2058, 2089, 2107, 2136, 2303, 2414, 2479, 2752], 'Scopus': [685, 699, 719, 748, 790, 805, 865, 919, 942, 1008, 1022, 1137, 1162, 1184, 1210, 1263, 1276, 1325, 1390, 1417, 1443, 1467, 1482, 1503, 1529, 1586, 1657, 1679, 1712, 1734, 1753, 1811, 1860, 1927, 2020, 2036, 2059, 2090, 2108, 2137, 2304, 2415, 2480, 2753], '(141)': [686], 'Google': [687, 701, 721, 750, 792, 807, 867, 921, 944, 966, 1010, 1024, 1084, 1102, 1139, 1164, 1186, 1212, 1265, 1278, 1327, 1392, 1419, 1445, 1469, 1484, 1505, 1531, 1588, 1659, 1681, 1714, 1736, 1755, 1813, 1862, 1929, 2022, 2038, 2061, 2092, 2110, 2139, 2306, 2417, 2482, 2755], 'Scholar,': [688, 702, 722, 793, 922, 1011, 1085, 1140, 1266, 1393, 1420, 1446, 1470, 1485, 1506, 1660, 1715, 1737, 2023, 2093], '2Dennery': [689], 'P.A.': [690, 2473], 'Free': [691, 783, 1014, 1317], 'Radic.': [692, 784, 1015, 1318], 'Biol.': [693, 997, 1016, 1132, 1205, 1252, 1319, 1379, 1412, 1432, 1456, 1477, 1498, 1518, 1646, 1668, 1707, 1806, 2009, 2085, 2132, 2293, 2742], 'Med.': [694, 1017, 1097, 1320], '2006;': [695], '40:': [696], '1-2Crossref': [697], '(23)': [700], '3Balaban': [703], 'R.S.': [704, 1717], 'Nemoto': [705], 'S.': [706, 742, 895, 913, 936, 1156, 1244, 1268, 1801, 1916, 2097, 2471, 2736], 'Finkel': [707], 'T.': [708, 778, 991, 1196, 1312, 1405, 1508, 2005, 2467], 'Cell.': [709, 1131, 1204, 1411, 1476, 1497, 1706, 1805], '120:': [711], '483-495Abstract': [712], 'Full': [713, 715, 1002, 1004, 1257, 1259, 1384, 1386, 1437, 1439, 1461, 1463, 1523, 1525, 1651, 1653, 1673, 1675, 2014, 2016, 2298, 2300, 2747, 2749], 'Text': [714, 716, 1003, 1005, 1258, 1260, 1385, 1387, 1438, 1440, 1462, 1464, 1524, 1526, 1652, 1654, 1674, 1676, 2015, 2017, 2299, 2301, 2748, 2750], 'PDF': [717, 1006, 1261, 1388, 1441, 1465, 1527, 1655, 1677, 2018, 2302, 2751], '(3242)': [720], '4Suh': [723], 'J.H.': [724, 1840], 'Shenvi': [725], 'S.V.': [726], 'Dixon': [727], 'B.M.': [728, 1704], 'Liu': [729, 733], 'H.': [730, 1194, 1198, 1399, 1836], 'Jaiswal': [731, 1176, 1249, 1269, 1665], 'A.K.': [732, 1013, 1177, 1246, 1250, 1270, 1662, 1666], 'R.M.': [734], 'Hagen': [735], 'T.M.': [736], 'Proc.': [737, 908, 931, 1151], 'Natl.': [738, 909, 932, 1152], 'U.': [741, 912, 935, 1155], '2004;': [744, 1018, 1321, 1413, 1434, 1499, 1856, 1923, 2104, 2295, 2411], '101:': [745], '3381-3386Crossref': [746], '(628)': [749], 'Scholar).': [751, 808, 868, 967, 1025, 1103, 1165, 1279, 1328, 1532, 1589, 1682, 1814, 1863, 1930, 2140, 2756], 'To': [752, 3214, 3410, 3602, 4042], 'cells': [757, 1948, 2217, 2239, 2426, 2499, 2506, 2523, 2760, 3041, 3292, 3299, 3320, 3335, 3360, 3391, 3414, 3804, 3838, 3886, 3940, 3957, 4029, 4195, 4243], 'have': [758, 1028, 1606, 1615], 'developed': [759], 'armamentarium': [762], 'includes': [764], 'group': [766], 'antixenobiotic': [768], 'detoxification': [773], '(5Itoh': [775], 'K.': [776, 1064, 1089, 1121, 1123, 1144, 1407, 1426, 1450, 2287, 2362], 'Ishii': [777, 1195], 'Wakabayashi': [779], 'Yamamoto': [781, 1065, 1090, 1128, 1201, 1408, 1427, 1451, 2288], 'M.': [782, 897, 926, 1062, 1066, 1091, 1127, 1129, 1202, 1377, 1401, 1409, 1422, 1428, 1448, 1452, 1472, 1495, 1723, 1914, 2001, 2025, 2044, 2050, 2095, 2283, 2289, 2383, 2402, 2738], 'Res.': [785, 859, 1080, 1922, 2103], '1999;': [786, 915, 2744], '31:': [787], '319-324Crossref': [788], '(299)': [791, 1587], '6Rushmore': [794], 'T.H.': [795], 'Kong': [796, 1643], 'A.N.': [797, 1644], 'Curr.': [798, 2082, 2129], 'Drug': [799], 'Metab.': [800], '2002;': [801, 938, 1272, 2011], '3:': [802], '481-490Crossref': [803], '(375)': [806], 'include': [811, 1789], 'NAD(P)H:quinone': [812, 3753, 3779], '1,': [814], 'S-transferases,': [816], 'ligase,': [818], 'peroxidases,': [820], '(HO-1).': [824], 'enzyme': [826, 850], 'HO-1': [827, 877, 4190, 4223, 4257], 'degrades': [828], 'release': [831], 'equimolar': [832], 'amounts': [833, 3511, 3606], 'free': [835], 'iron,': [836], 'carbon': [837], 'monoxide,': [838], 'biliverdin,': [840], 'latter': [842], 'being': [843], 'converted': [844], 'bilirubin': [846, 888], 'ubiquitous': [849], 'biliverdin': [851], 'reductase': [852], '(7Maines': [853], 'M.D.': [854], 'Gibbs': [855], 'P.E.': [856], 'Biochem.': [857, 1178, 2030], 'Biophys.': [858], 'Commun.': [860], '338:': [862], '568-577Crossref': [863], '(198)': [866], 'Induction': [869], 'moderate': [872], 'intracellular': [873, 4039], 'catabolism': [875], 'through': [876, 1057, 1823, 2194], 'represents': [878], 'adaptive': [880], 'protective': [882], 'injury': [886, 1955], 'because': [887, 947, 2112], 'very': [891], 'potent': [892], '(8Dore': [894], 'Takahashi': [896], 'Ferris': [898, 927], 'C.D.': [899, 928], 'Zakhary': [900], 'R.': [901, 1642, 2046, 2406], 'Hester': [902], 'L.D.': [903], 'Guastella': [904], 'D.': [905, 1999, 2042, 2404], 'Snyder': [906, 929], 'S.H.': [907, 930, 1832, 1834], '96:': [916], '2445-2450Crossref': [917], '(617)': [920], '9Baranano': [923], 'D.E.': [924], 'Rao': [925], '99:': [939], '16093-16098Crossref': [940], '(882)': [943], 'Scholar)': [945, 1187, 1213, 1756, 2111], 'low': [948], 'CO': [951], 'cytoprotective': [953], '(10Kim': [954], 'H.P.': [955], 'Ryter': [956], 'S.W.': [957], 'Choi': [958], 'A.M.': [959, 1698], 'Annu.': [960], 'Rev.': [961, 1803], 'Pharmacol.': [962, 1179], 'Toxicol.': [963], 'Transcriptional': [968], 'up-regulation': [969, 1568], 'genes,': [973], 'critically': [977], 'dependent': [978], 'on': [979, 2638, 3302, 3807, 3943], 'common': [981, 1686], 'cis-acting': [982], 'enhancer': [983], 'sequence,': [984], 'element': [988], '(ARE)': [989], '(11Nguyen': [990], 'Huang': [992, 1511], 'H.C.': [993, 1512], 'Pickett': [994, 1315, 1515], 'C.B.': [995, 1316, 1516], 'J.': [996, 1175, 1251, 1378, 1431, 1455, 1517, 1645, 1667, 1729, 1844, 2008, 2031, 2053, 2292, 2338, 2339, 2384, 2409, 2438, 2475, 2489, 2620, 2741], 'Chem.': [998, 1253, 1380, 1433, 1457, 1519, 1647, 1669, 2010, 2294, 2743], '2000;': [999, 1180, 1730], '275:': [1000, 1750], '15466-15473Abstract': [1001], '(322)': [1009], '12Jaiswal': [1012], '36:': [1019], '1199-1207Crossref': [1020], '(1014)': [1023], 'Numerous': [1026], 'studies': [1027], 'provided': [1029, 2313, 2359, 2380], 'clear': [1030, 1303], 'evidence': [1031], 'nuclear': [1036, 1599, 2719, 2858], 'factor-E2-related': [1037], '2': [1039], '(Nrf2)': [1040], 'crucial': [1043], 'molecule': [1044], 'basal': [1049], 'induced': [1051], 'AREs': [1060, 1217, 1222], '(13McMahon': [1061], 'Itoh': [1063, 1088, 1425, 1449, 2286], 'Chanas': [1067], 'S.A.': [1068], 'Henderson': [1069], 'C.J.': [1070], 'McLellan': [1071], 'L.I.': [1072], 'Wolf': [1073], 'C.R.': [1074, 1739], 'Cavin': [1075], 'C.': [1076, 1636, 1920, 2101, 2740], 'Hayes': [1077, 1429, 1453, 2290], 'J.D.': [1078, 1200, 1430, 1454, 2291], 'Cancer': [1079, 2492], '2001;': [1081, 1098, 1708, 1807, 2055], '61:': [1082], '3299-3307PubMed': [1083], '14Kwak': [1086], 'M.K.': [1087], 'Sutter': [1092], 'T.R.': [1093], 'Kensler': [1094], 'T.W.': [1095], 'Mol.': [1096, 1130, 1203, 1410, 1475, 1496, 1705, 1804], '7:': [1099, 1583], '135-145Crossref': [1100], 'member': [1107], 'basic': [1110], 'leucine': [1111], 'zipper': [1112], 'family': [1115], 'featuring': [1116], "cap'n'collar": [1118], 'motif': [1119], '(15Itoh': [1120], 'Igarashi': [1122, 1406, 2363], 'Hayashi': [1124], 'Nishizawa': [1126], '1995;': [1133, 2476], '15:': [1134], '4184-4193Crossref': [1135], '(358)': [1138], '16Moi': [1141], 'P.': [1142, 1745, 1799, 2027, 2730, 2732], 'Chan': [1143], 'Asunis': [1145], 'I.': [1146], 'Cao': [1147], 'Kan': [1149], 'Y.W.': [1150], '1994;': [1158], '91:': [1159], '9926-9930Crossref': [1160], '(1206)': [1163], 'It': [1166], 'forms': [1167], 'heterodimers': [1168, 1230, 1287], 'members': [1170], 'Jun': [1173], '(17Jeyapaul': [1174], '59:': [1181], '1433-1439Crossref': [1182], '(177)': [1185], 'small': [1189, 1233, 1289], 'Maf': [1190, 1290], '(18Katsuoka': [1191], 'F.': [1192], 'Motohashi': [1193], 'Aburatani': [1197], 'Engel': [1199], '25:': [1207, 1479, 1857], '8044-8051Crossref': [1208], '(210)': [1211], 'proteins': [1214, 1291], 'bind': [1216], 'transactivate': [1219], 'ARE-containing': [1220], 'genes.': [1221], 'also': [1224, 1991], 'subjected': [1225, 1622], 'made': [1231], 'Mafs,': [1234], 'such': [1235, 1897, 1952, 1995], 'MafK,': [1237], 'heme-binding': [1240], 'Bach1': [1242, 1285], '(19Dhakshinamoorthy': [1243], 'Jain': [1245, 1633], 'Bloom': [1247, 1663], 'D.A.': [1248, 1664], '280:': [1255, 1382, 1649, 1671], '16891-16900Abstract': [1256], '(315)': [1264], '20Dhakshinamoorthy': [1267], 'Oncogene.': [1271], '21:': [1273, 1709], '5301-5312Crossref': [1274], '(63)': [1277], 'Considering': [1280], 'form': [1286], 'nucleus': [1294], 'activate': [1296], 'repress': [1298], 'AREs,': [1299], 'respectively,': [1300, 3038], 'it': [1301, 1866], 'must': [1307], 'tightly': [1309, 1960], 'regulated': [1310, 1961, 2117], '(21Nguyen': [1311], 'Yang': [1313, 1513, 1841], 'C.S.': [1314, 1514], '37:': [1322], '433-441Crossref': [1323], '(424)': [1326], 'Under': [1329], 'conditions': [1330, 2906, 3719, 4177], 'where': [1331], 'high': [1332], 'products': [1339, 3703], 'not': [1341, 3889, 4221], 'required,': [1342], 'interacts': [1344], 'BTB-Kelch': [1347], 'Keap1,': [1349], 'association': [1352, 3220], 'promotes': [1353], 'ubiquitination': [1355], 'cullin-3-ROK1': [1358], 'complex': [1359], 'subsequent': [1361], 'degradation': [1362], 'proteasome': [1365], '(22Zhang': [1366], 'D.D.': [1367, 1487], 'Lo': [1368, 1488], 'S.C.': [1369, 1489], 'Sun': [1370], 'Z.': [1371], 'Habib': [1372], 'G.M.': [1373], 'Lieberman': [1374], 'M.W.': [1375], 'Hannink': [1376, 1494], '30091-30099Abstract': [1383], '(235)': [1391], '23Kobayashi': [1394], 'Kang': [1396], 'M.I.': [1397], 'Okawa': [1398], 'Ohtsuji': [1400], 'Zenke': [1402], 'Chiba': [1404], '24:': [1414, 1500, 2412], '7130-7139Crossref': [1415], '(1613)': [1418], '24McMahon': [1421, 2282], 'Thomas': [1423, 2284], '279:': [1435, 2296], '31556-31567Abstract': [1436, 2297], '(314)': [1444, 2305], '25McMahon': [1447], '2003;': [1458, 1520], '278:': [1459, 1521], '21592-21600Abstract': [1460], '(860)': [1468], '26Furukawa': [1471], 'Xiong': [1473], '162-171Crossref': [1480], '(578)': [1483], '27Zhang': [1486], 'Cross': [1490], 'J.V.': [1491], 'Templeton': [1492], 'D.J.': [1493], '10941-10953Crossref': [1501], '(954)': [1504], '28Nguyen': [1507], 'Sherratt': [1509], 'P.J.': [1510], '4536-4541Abstract': [1522], '(499)': [1530], 'Therefore,': [1533, 1931], 'under': [1534, 3406, 3750, 3775], 'normal': [1535], 'conditions,': [1536], 'barely': [1541], 'detectable.': [1542], 'On': [1543], 'other': [1545], 'hand,': [1546], 'insults': [1548, 1951], 'promote': [1549], 'dissociation': [1551], 'Nrf2-Keap1': [1554], 'complex,': [1555], 'resulting': [1556], 'stabilization': [1558], 'protein,': [1562, 1881], 'translocation': [1563], 'nucleus,': [1566], '(29Kang': [1573], 'K.W.': [1574], 'Lee': [1575], 'S.J.': [1576], 'Kim': [1577, 1833, 1837, 1839, 1843, 1845, 1851], 'S.G.': [1578], 'Antioxid.': [1579], 'Redox.': [1580], 'Signal.': [1581], '1664-1673Crossref': [1584], 'However,': [1590], 'molecular': [1592], 'mechanisms': [1593, 2070], 'leading': [1594], 'control': [1597, 4091], 'unexplored.': [1603], 'Recent': [1604], 'reports': [1605], 'characterized': [1607], 'import': [1608], 'export': [1610], 'signals': [1611], 'suggested': [1616], 'might': [1620], 'at': [1625, 2121, 2772, 2832, 2959, 2972, 2979, 3106, 3139, 3195, 3208, 3251, 3271, 3348, 3383, 3628, 3637, 3653, 3658, 3665, 4061, 4073, 4147, 4164], 'level': [1627], 'location': [1630], '(30Li': [1631], 'W.': [1632], 'M.R.': [1634], 'Chen': [1635], 'Yue': [1637], 'Hebbar': [1639], 'V.': [1640], 'Zhou': [1641], '28430-28438Abstract': [1650], '(81)': [1658, 1861], '31Jain': [1661], '29158-29168Abstract': [1672], '(187)': [1680], 'Phosphorylation': [1683], 'post-translational': [1687], 'modification': [1688], 'implicated': [1689], 'numerous': [1694], 'factors': [1696, 1987], '(32Brownawell': [1697], 'Kops': [1699], 'G.J.': [1700], 'Macara': [1701], 'I.G.': [1702], 'Burgering': [1703], '3534-3546Crossref': [1710], '(267)': [1713], '33Ginger': [1716], 'Dalton': [1718], 'E.C.': [1719], 'Ryves': [1720], 'W.J.': [1721], 'Fukuzawa': [1722], 'Williams': [1724], 'J.G.': [1725, 1838], 'Harwood': [1726], 'A.J.': [1727], 'EMBO': [1728, 2474], '19:': [1731], '5483-5491Crossref': [1732], '(58)': [1735], '34Beals': [1738], 'Sheridan': [1740], 'C.M.': [1741], 'Turck': [1742], 'C.W.': [1743], 'Gardner': [1744], 'Crabtree': [1746], 'G.R.': [1747], 'Science.': [1748], '1997;': [1749], '1930-1934Crossref': [1751], '(634)': [1754], 'possible': [1759, 2145], 'its': [1768, 1972, 2179, 3225, 3916], 'distribution': [1770], 'remains': [1771, 2157], 'unknown.': [1772, 1957], 'Glycogen': [1773], '(GSK-3β)': [1776], 'variety': [1784], 'metabolic': [1786], 'processes': [1787], 'metabolism,': [1791], 'Wnt': [1792], 'signaling': [1793], 'sensitization': [1795], 'apoptosis': [1797, 1822, 2068], '(35Cohen': [1798], 'Frame': [1800], 'Nat.': [1802], '2:': [1808], '769-776Crossref': [1809], '(1287)': [1812], 'Regarding': [1815], 'stress,': [1817], 'intervenes': [1819], 'oxidative-stress-mediated': [1821], 'caspase-3': [1824], 'releasing': [1826], 'cytochrome': [1827], 'c': [1828], 'mitochondria': [1830], '(36Koh': [1831], 'Kwon': [1835], 'K.H.': [1842], 'S.U.': [1846], 'Yu': [1847], 'H.J.': [1848], 'Do': [1849], 'B.R.': [1850], 'K.S.': [1852], 'Jung': [1853], 'H.K.': [1854], 'Neurotoxicology.': [1855], '793-802Crossref': [1858], 'In': [1864, 2161, 2995, 3050], 'fact,': [1865], 'has': [1867, 1933], 'been': [1868], 'shown': [1869, 4236], 'inhibition': [1871, 2195], 'activity': [1874, 2114, 2530, 4045], 'either': [1876], 'overexpression': [1877], 'GSK-3β-binding': [1880], 'FRAT-1,': [1882], 'use': [1885], 'kinase-dead': [1888], 'mutant': [1891], 'pharmacological': [1895], 'lithium,': [1899], 'decreased': [1903], 'susceptibility': [1904], 'cortical': [1906], 'neurons': [1907], 'trophic': [1909], 'withdrawal-induced': [1910], 'death': [1912, 1941], '(37Schafer': [1913], 'Goodenough': [1915, 2096], 'Moosmann': [1917, 2098], 'B.': [1918, 2099], 'Behl': [1919, 2100], 'Brain': [1921, 2102], '1005:': [1924, 2105], '84-89Crossref': [1925, 2106], '(84)': [1928, 2109], 'emerged': [1934], 'new': [1937, 3785], 'regulator': [1938], 'mechanism': [1944], 'whereby': [1945], 'sensitizes': [1947], 'external': [1950, 1993], 'phosphatidylinositol-3': [1968], 'downstream': [1973], 'effector': [1974], 'Akt.': [1978, 4250], 'This': [1979], 'activated': [1982], 'growth': [1986], 'neurotrophins': [1989], 'oxidants': [1994], 'H2O2': [1997, 2260, 3844, 3963], '(38Martin': [1998], 'Salinas': [2000, 2043, 2401], 'Fujita': [2002], 'Tsuruo': [2004], 'Cuadrado': [2006, 2051, 2407], '277:': [2012], '42943-42952Abstract': [2013], '(161)': [2021], '39Shaw': [2024], 'Cohen': [2026], 'Alessi': [2028], 'D.R.': [2029], '1998;': [2032], '336:': [2033], '241-246Crossref': [2034], '(239)': [2037], 'Scholar),': [2039, 2062, 2483], 'β-amyloid': [2040], '(40Martin': [2041], 'Lopez-Valdaliso': [2045], 'Serrano': [2047], 'E.': [2048, 2727], 'Recuero': [2049], 'Neurochem.': [2054], '78:': [2056], '1000-1008Crossref': [2057], '(133)': [2060], 'etc.': [2063], 'inhibit': [2067], 'may': [2072], 'involve': [2073], 'part': [2075], 'inactivation': [2077], '(41Woodgett': [2080, 2127], 'J.R.': [2081, 2128], 'Opin.': [2083, 2130], 'Cell': [2084, 2131, 2209], '17:': [2087, 2134], '150-157Crossref': [2088, 2135], '(309)': [2091, 2138], '37Schafer': [2094], 'negatively': [2116], 'Ser-9': [2122], 'pseudosubstrate': [2125], 'domain': [2126], 'At': [2141], 'time,': [2143, 3873], 'connection': [2146], 'PI3K/Akt/GSK-3β': [2148], 'Nrf2-induced': [2154], 'established.': [2160], 'study,': [2163], 'substrate': [2169, 3070], 'show': [2174], 'governs': [2178], 'location.': [2181], 'Our': [2182], 'observations': [2183], 'provide': [2184], 'interpretation': [2187], 'for': [2188, 2510, 2528, 2775, 2836, 2956, 2976, 3103, 3142, 3192, 3211, 3248, 3267, 3307, 3345, 3367, 3377, 3403, 3443, 3449, 3459, 3588, 3625, 3678, 3694, 3720, 3728, 3830, 3964, 3991, 4036, 4058, 4202], 'proapoptotic': [2190], 'effects': [2191], 'function': [2198], 'elucidate': [2202], 'factor.': [2208], 'Culture': [2210], 'Reagents—Human': [2212], 'embryonic': [2213], 'kidney': [2214], '(HEK)': [2215], '293T': [2216], 'were': [2218, 2261, 2312, 2427, 2500, 2524, 2545, 2561, 2630, 2678, 2692, 2706, 2721, 2761, 2911, 2954, 3031, 3056, 3114, 3129, 3190, 3204, 3241, 3276, 3293, 3336, 3361, 3372, 3392, 3415, 3422, 3439, 3467, 3484, 3519, 3609, 3704, 3794, 3805, 3815, 3839, 3860, 3888, 3927, 3941, 3950, 3958, 3979, 4030, 4051, 4116, 4145, 4196, 4228], 'grown': [2219], 'Dulbecco′s': [2221], 'modified': [2222, 4014], 'Eagle′s': [2223], 'medium': [2224, 3827, 4000, 4016], 'supplemented': [2225], '10%': [2227, 2670, 3184], 'fetal': [2228], 'bovine': [2229], 'serum': [2230], '80': [2232], 'μg/ml': [2233, 2673, 2825, 2899, 2951, 3187], 'gentamycin.': [2234], 'Transient': [2235], 'transfection': [2236, 4216], 'these': [2238], 'was': [2240, 2253, 2267, 2333, 2357, 2378, 2781, 2830, 2846, 2860, 2968, 2984, 3001, 3071, 3148, 3230, 3260, 3504, 3551, 3635, 3732, 3757, 3823, 3853, 3883, 3895, 3910, 4001, 4066, 4084, 4126, 4138], 'performed': [2241, 2428, 3002, 3057, 3552, 3636, 4146], 'calcium': [2243, 2516, 3313], 'phosphate,': [2244], 'using': [2245, 2694, 3008, 3022, 3058, 3424, 3525, 3646, 3740, 3765, 3796, 3863, 3929, 4068, 4118, 4189], 'reagents': [2247], 'Sigma-Aldrich.': [2249], 'inhibitor': [2251], 'TDZD-8': [2252], 'purchased': [2254, 2268], 'Calbiochem;': [2256], 'Hemin,': [2257], 'Sigma-Aldrich,': [2263], 'lithium': [2265, 3327], 'chloride': [2266, 3328], 'Merck.': [2270], 'Plasmids—Expression': [2271], 'vectors': [2272, 2432, 4201], 'pcDNA3.1/V5HisB-mNrf2,': [2273], 'pcDNA3.1/V5HisB-mNrf2ΔETGE,': [2274], 'pcDNA3.1/V5HisB-mKeap1,': [2275], 'pET-mNrf2': [2277], 'described': [2279, 2396, 2725, 3749, 3774], 'Ref.': [2281, 2398], 'Scholar.': [2307, 2418], 'Vectors': [2308], 'pCGN-GSK-3βwt': [2309], 'pCGN-GSK-3β-Δ9': [2311], 'Dr.': [2315, 2337, 2361, 2382, 2453, 2488, 2619], 'Kikuchi': [2317], '(Department': [2318, 2364], 'Biochemistry,': [2320], 'Faculty': [2321], 'Medicine,': [2323], 'Hiroshima': [2324, 2368], 'University)': [2325], 'pcDNA3-GSK-3β(K85R)': [2327], '(dominant': [2328], 'version': [2330], 'GSK-3β)': [2332], 'gift': [2335, 2486], 'Lucas': [2340], '(Centro': [2341], 'de': [2342, 2349, 2387, 2624, 2728], 'Biología': [2343], 'Molecular': [2344, 2442], '"Severo': [2345], 'Ochoa",': [2346], 'Consejo': [2347], 'Superior': [2348], 'Investigaciones': [2350, 2388, 2625], 'Científicas,': [2351], 'Madrid,': [2352, 2390, 2459, 2627], 'Spain).': [2353, 2391, 2628], 'Expression': [2354], 'vector': [2355], 'pcDNA3.1-FLAG-Bach1': [2356], 'kindly': [2358, 2379], 'Biomedical': [2366, 2373, 2553], 'Chemistry,': [2367], 'University': [2369], 'Graduate': [2370], 'School': [2371], 'Sciences,': [2374], 'Hiroshima,': [2375], 'Japan).': [2376], 'pCEFL-AU5-c-jun': [2377], 'Marinissen': [2385], '(Instituto': [2386], 'Biomédicas,': [2389, 2626], 'Generation': [2392], 'pcDNA3-myr-Akt1-HA-ER': [2394], '42Rojo': [2399], 'A.I.': [2400], 'Martin': [2403], 'Perona': [2405], 'Neurosci.': [2410], '7324-7334Crossref': [2413], '(167)': [2416], 'For': [2419], 'luciferase': [2420, 2529, 2533], 'assays,': [2421], 'transient': [2422], 'transfections': [2423], 'HEK293T': [2425, 3040, 4194], 'pGL3basic,': [2433], 'pHO1-15-LUC,': [2434], '3XARE-LUC,': [2435], 'pEF-ΔNrf2(DN)': [2436], '(Dr.': [2437], 'Alam,': [2439], 'Department': [2440], 'Genetics,': [2443], 'Ochsner': [2444], 'Clinic': [2445], 'Foundation,': [2446], 'New': [2447], 'Orleans,': [2448], 'LA),': [2449], 'pcDNA3.1-HSF(DN)': [2450], '(gift': [2451, 2617], 'Vilaboa,': [2455], 'Hospital': [2456], 'La': [2457], 'Paz,': [2458], 'Spain),': [2460], 'pcDNA3-IκB(S32A/S36A)': [2461], '(57Traenckner': [2462], 'E.B.': [2463], 'Pahl': [2464], 'H.L.': [2465], 'Henkel': [2466], 'Schmidt': [2468], 'K.N.': [2469], 'Wilk': [2470], 'Baenerle': [2472], '14:': [2477], '2876-2883Crossref': [2478], '(930)': [2481], 'pSG5p110αPI3KCAAX,': [2485], 'Downward,': [2490], '(Imperial': [2491], 'Research': [2493], 'Fund,': [2494], 'London,': [2495], 'UK).': [2496], 'Luciferase': [2497], 'Assays—HEK293T': [2498], 'seeded': [2501, 3294, 3806, 3942], '24-well': [2503, 3296, 3808, 3944], 'plates': [2504, 3297, 3809, 3945], '(75,000': [2505, 3298], 'per': [2507, 3067, 3243, 3300, 3975], 'well),': [2508, 3301], 'cultured': [2509, 3306], '16': [2511, 3308, 3811], 'h': [2512, 2520, 3250, 3309, 3317, 3379, 3812, 3966, 4232], 'transfected': [2514, 3043, 3311, 3816, 3951, 4198], 'phosphate.': [2517, 3314], 'After': [2518, 2901, 3315, 3354, 3620, 3954], '24': [2519, 3316, 3831, 3955, 4231], 'transfection,': [2522, 3319], 'lysed': [2525, 2637, 4028], 'assayed': [2527], 'assay': [2534, 3999], 'system': [2535, 3018], '(Promega),': [2536], 'according': [2537], "manufacturer's": [2540], 'instructions.': [2541], 'Relative': [2542], 'light': [2543], 'units': [2544, 3527, 3542, 3575], 'measured': [2546, 4067], 'BG1': [2549], 'Optocomp': [2550], 'I,': [2551], 'GEM': [2552], 'luminometer': [2554], '(Sparks,': [2555], 'NV).': [2556], 'Immunoblotting—The': [2557], 'primary': [2558, 2696, 3375], 'antibodies': [2559, 2609, 2697, 3376, 3402, 3463, 3483], 'anti-Nrf2(C-20),': [2562], 'anti-Akt1': [2563], '(C-20),': [2564], 'anti-Sp1': [2566, 2993], '(Santa': [2567], 'Cruz': [2568], 'Biotechnology,': [2569], 'Santa': [2570], 'Cruz,': [2571], 'CA);': [2572, 2601, 2607], 'anti-phospho-Thr308': [2573], 'Akt-1': [2574], '(New': [2575], 'England': [2576], 'Biolabs,': [2577], 'Beverly,': [2578], 'MA);': [2579], 'anti-phospho-Ser9-GSK-3β': [2580], '(Cell': [2581], 'Signaling': [2582], 'Technology,': [2583], 'Inc.,': [2584], 'Lake': [2585], 'Placid,': [2586], 'NY);': [2587], 'anti-HO-1': [2588], 'anti-HO-2': [2590], '(Stressgen': [2591], 'Biotech': [2592], 'Corp.,': [2593], 'Victoria,': [2594], 'British': [2595], 'Columbia,': [2596], 'Canada);': [2597], 'anti-V5': [2598, 2853, 2991, 3469], '(Invitrogen,': [2599], 'Carlsbad,': [2600], 'anti-HA': [2602, 3480], 'anti-AU5': [2604, 3476], '(Covance,': [2605], 'Berkeley,': [2606], 'antiphospho-Ser': [2608], '(Biomol,': [2610], 'Plymouth': [2611], 'Meeting,': [2612], 'PA)': [2613], 'anti-protein-disulfide': [2615], 'isomerase': [2616], 'Castaño,': [2622], 'Instituto': [2623], 'washed': [2631, 2762, 3130, 3280, 3337, 3393], 'once': [2632, 3131], 'cold': [2634, 2766, 2789, 2867, 2919, 3133, 3155, 3339], 'PBS': [2635, 2767, 3134, 3340, 3397], 'ice': [2639], 'lysis': [2641, 3156, 3284], 'buffer': [2642, 2790, 2868, 2920, 3086, 3157], '(137': [2643], 'mm': [2644, 2647, 2653, 2657, 2660, 2664, 2793, 2798, 2801, 2804, 2807, 2811, 2814, 2818, 2871, 2876, 2879, 2883, 2886, 2890, 2923, 2928, 2931, 2935, 2938, 2942, 3088, 3095, 3101, 3159, 3162, 3167, 3171, 3174, 3178, 3330, 3561, 3566, 3569, 3843, 3962], 'NaCl,': [2645, 2897, 2949, 3160], '20': [2646, 2656, 2810, 2882, 2934, 2977, 3104, 3161, 3170, 3193, 3541], 'Tris': [2648], 'HCl,': [2649], 'pH': [2650, 2795, 2873, 2925, 3097, 3164, 3563], '7.5,': [2651, 3165], '1': [2652, 2659, 2663, 2672, 2806, 2813, 2817, 2824, 2878, 2885, 2889, 2898, 2930, 2937, 2941, 2950, 3100, 3166, 3173, 3177, 3186, 3378, 3670, 4010], 'phenylmethylsulfonyl': [2654, 2808, 2880, 2932, 3168], 'fluoride,': [2655, 2809, 2881, 2933, 3169], 'NaF,': [2658, 2812, 2884, 2936, 3172], 'sodium': [2661, 2665, 2815, 2819, 2887, 2891, 2939, 2943, 3175, 3179], 'pyrophosphate,': [2662, 2816, 2888, 2940, 3176], 'orthovanadate,': [2666, 2820, 2892, 2944, 3180], '1%': [2667, 2821, 3181, 4018], 'Nonidet': [2668, 2822, 3182, 3365], 'P-40,': [2669, 2823, 3183], 'glycerol,': [2671, 2894, 2946, 3185], 'leupeptin).': [2674, 2826, 2900, 3188], 'Precleared': [2675], 'lysates': [2677], 'resolved': [2679, 2847, 2985, 3115, 3286, 3705], 'SDS-PAGE': [2681, 2849, 2987], 'transferred': [2683, 3118, 3983, 4031], 'Immobilon-P': [2685], 'membranes': [2686, 2691], '(Millipore,': [2687], 'Billerica,': [2688], 'MA).': [2689], 'analyzed': [2693, 3861, 4229], 'above': [2699], 'appropriate': [2701, 3425], 'peroxidase-conjugated': [2702], 'secondary': [2703, 3401], 'antibodies.': [2704, 2856, 2994], 'Proteins': [2705], 'detected': [2707], 'enhanced': [2709], 'chemiluminescence': [2710], '(Pierce).': [2711], 'Preparation': [2712], 'Nuclear': [2714, 2966], 'Cytosolic': [2716], 'Extracts—Cytosolic': [2717], 'fractions': [2720], 'prepared': [2722], 'previously': [2724], '(58Minc': [2726], 'Coppet': [2729], 'Masson': [2731], 'Thiery': [2733], 'L.': [2734], 'Dutertre': [2735], 'Amor-Gueret': [2737], 'Jaulin': [2739], '274:': [2745], '503-509Abstract': [2746], '(76)': [2754], 'Briefly,': [2757], '5': [2758, 2837, 3059, 3077, 3235, 3329, 3526, 3568], 'million': [2759], 'three': [2763, 2785, 3151, 3355, 3394, 4149, 4166], 'times': [2764, 3282, 3395, 4150], 'harvested': [2769, 3136, 3277], 'centrifugation': [2771, 2902, 2971, 3138, 3207], '1100': [2773, 3140], 'rpm': [2774, 3141, 3210], '10': [2776, 2803, 3143, 3212, 3368, 3560], 'min.': [2777, 2838, 3144, 3213, 3369], 'pellet': [2780, 2786, 2859, 2864, 2915, 3147, 3152], 'resuspended': [2782, 2861, 2912, 3149], 'carefully': [2783, 3980], 'volumes': [2787, 2865, 2916, 3153], 'A': [2791, 4133], '(20': [2792], 'HEPES,': [2794, 2872, 2924], '7.0,': [2796, 3098], '0.15': [2797], 'EDTA,': [2799, 2877, 2929], '0.015': [2800], 'EGTA,': [2802], 'KCl,': [2805, 3567], 'Then,': [2827, 3202, 3334, 3390, 3972, 3997], 'homogenate': [2829], 'centrifuged': [2831], '500': [2833], '×': [2834, 2974], 'g': [2835, 2975], 'supernatant': [2840, 2983, 3978, 4025], 'corresponding': [2841, 3239, 3917, 3985, 4101], 'cytosolic': [2844], 'fraction': [2845, 4080], 'immunoblotted': [2851, 2989], 'anti-PDI': [2855], 'five': [2863, 3281], 'B': [2869], '(10': [2870, 2922, 3087], '8.0,': [2874, 2926], '0.1': [2875, 2895, 2927], '25%': [2893, 2945], 'm': [2896, 2948], 'same': [2905, 3408], 'above,': [2908], 'nuclei': [2910], 'two': [2914, 3004], 'hypertonic': [2918], 'C': [2921], '0.4': [2947], 'leupeptin)': [2952], 'incubated': [2955, 3072, 3191, 3266, 3373, 3399, 3829, 3890, 4057], '30': [2957, 3107, 3381, 3651, 3657, 3663, 4059], 'min': [2958, 2978, 3105, 3194, 3347, 3382, 3405, 3627, 4060], '4': [2960, 2980, 3196, 3272], '°C': [2961, 3108, 3197, 3385, 3655, 3660, 3667], 'rotating': [2964, 3200, 3255], 'wheel.': [2965, 3201], 'debris': [2967], 'removed': [2969, 3981, 4002], '900': [2973], '°C.': [2981, 3273], 'Vitro': [2996], 'Kinase': [2997, 3112], 'Assays—In': [2998], 'different': [3005], 'ways:': [3006], '(i)': [3007], 'bacterially': [3009], 'expressed': [3010], 'His-tagged': [3011], 'Nrf2,': [3012], 'isolated': [3013], 'ProBond™': [3016], 'purification': [3017], '(Invitrogen),': [3019], '(ii)': [3021], 'immunocomplexes': [3023], 'V5-tagged': [3025], 'AU5-tagged': [3028], 'c-Jun,': [3029], 'immunoprecipitated': [3032], 'anti-V5-': [3034], 'anti-AU5-specific': [3036], 'antibodies,': [3037], 'transiently': [3042, 4197], 'pcDNA3.1': [3045], 'Nrf2ΔETGE-V5': [3046], 'pCEFL': [3048], 'AU5-c-Jun.': [3049], 'cases,': [3052, 3324], 'assays': [3055], 'ng': [3060], 'recombinant': [3063], '(Upstate': [3065], 'Biotechnology)': [3066], 'reaction;': [3068], 'briefly,': [3069], 'μCi': [3078], '[γ32P]ATP': [3080], '25': [3082, 3554], 'μl': [3083, 3236, 3555, 3974, 4023, 4047], 'reaction': [3085, 4049], 'MgCl2,': [3089, 3570], '100': [3090, 3850, 3973, 4022, 4046], 'μm': [3091, 3820, 3851], 'ATP': [3092], '40': [3094], 'EDTA)': [3102], 'continuous': [3110], 'shaking.': [3111], 'reactions': [3113], 'SDS-PAGE,': [3117, 3288], 'immobilon-P': [3120], 'membranes,': [3121], 'autoradiography': [3125], 'immunoblotted.': [3127, 3290], 'Immunoprecipitation—Cells': [3128], '(340': [3158], 'Tris-HCl,': [3163, 3562], 'Lysates': [3189], 'they': [3203, 3814, 3949], 'precleared': [3205], '13,000': [3209], 'prevent': [3215], 'NaCl': [3217, 3228], 'interference': [3218], 'specific': [3226], 'antibody,': [3227], 'concentration': [3229], 'diluted': [3231], '200': [3233, 3819], 'mm.': [3234], 'antibody': [3240], 'added': [3242, 3261, 3610, 3824, 3854, 4052], 'lysate,': [3244], 'after': [3246, 4230], 'incubation': [3247, 3344], '3': [3249, 3626], '4°C': [3252], 'wheel,': [3256], 'gamma-bind': [3257], 'Sepharose-protein': [3258], 'G': [3259], '(Amersham': [3262], 'Biosciences),': [3263], 'then': [3265], 'one': [3268], 'more': [3269], 'hour': [3270], 'complexes': [3275], 'centrifugation,': [3279], 'buffer,': [3285, 3558], 'Immunocytochemistry—HEK293T': [3291], 'poly-d-Lys': [3303], 'covered': [3304], 'slides,': [3305], 'were,': [3321], 'some': [3323], 'treated': [3325, 3840, 3959], '(for': [3331], '6': [3332, 3836, 3965], 'h).': [3333], 'fixed': [3342], '15': [3346, 3581], 'room': [3349, 4062], 'temperature': [3350], '4%': [3352], 'paraformaldehyde.': [3353], '5-min': [3356], 'washes': [3357], 'permeabilized': [3362], '0.25%': [3364], 'P-40': [3366], 'slides': [3371], '37': [3384], 'humidified': [3388], 'chamber.': [3389], '45': [3404], 'conditions.': [3409], 'visualize': [3411], 'nuclei,': [3413], 'stained': [3416, 3712], 'DAPI.': [3418], 'fluorescence': [3420, 3451], 'images': [3421], 'captured': [3423], 'filters': [3426], 'Leica': [3429], 'DMIRE2TCS': [3430], 'SP2': [3431], 'confocal': [3432], 'microscope': [3433], '(Nussloch,': [3434], 'Germany).': [3435], 'lasers': [3437], 'Ar': [3440], '488': [3441], 'nm': [3442, 3448, 3456, 3458, 4075], 'green': [3444], 'fluorescence,': [3445], 'Ar/HeNe': [3446], '543': [3447], 'red': [3450], 'finally': [3453], 'ArUV': [3454], '351': [3455], '364': [3457], 'UV': [3460], 'fluorescence.': [3461], 'Primary': [3462], 'immunocytochemistry': [3466], 'mouse': [3468, 3471, 3475], '(Invitrogen);': [3470], 'anti-FLAG': [3472], '(Sigma': [3473], 'Aldrich);': [3474], '(Covance),': [3477], 'rabbit': [3479], '(Abcam).': [3481], 'Secondary': [3482], 'Alexa': [3485, 3492], 'Fluor': [3486, 3493], '488-conjugated': [3487], 'goat': [3488, 3495], 'anti-mouse': [3489], 'IgG': [3490, 3497], '546-conjugated': [3494], 'anti-rabbit': [3496], '(Molecular': [3498, 3801], 'Probes).': [3499, 3802], 'Semiquantitative': [3500, 3546], 'RT-PCR—Total': [3501], 'RNA': [3503, 3515], 'extracted': [3505], 'TRIzol': [3507], 'reagent': [3508], '(Invitrogen).': [3509], 'Equal': [3510], '(1': [3512], 'μg)': [3513], 'each': [3517, 3584, 3633, 3679, 3913, 4054], 'treatment': [3518], 'reverse-transcribed': [3520], '(75': [3521], 'min,': [3522], '42': [3523], '°C),': [3524], 'avian': [3529], 'myeloblastosis': [3530], 'virus': [3531], 'reverse': [3532, 3675], 'transcriptase': [3533], '(Promega,': [3534], 'Madison,': [3535], 'WI)': [3536], 'presence': [3539], 'RNAsin': [3544], '(Promega).': [3545], 'PCR': [3547, 3557, 3686, 3692, 3702, 3722], 'amplification': [3548, 3631, 3695], 'cDNA': [3550, 3608, 3634, 3743, 3768], 'containing': [3559], '9.0,': [3564], '50': [3565], '0.1%': [3571], 'Triton': [3572, 4019], 'X-100,': [3573], '0.6': [3574], 'TaqDNA': [3577], 'polymerase': [3578], '(Promega)': [3579], 'pmol': [3582], 'synthetic': [3585], 'gene-specific': [3586], 'primer': [3587], 'selected': [3589], 'human': [3590, 3597], 'well': [3595, 3976], 'murine': [3600], 'Nrf2.': [3601], 'ensure': [3603], 'equal': [3605], 'PCR,': [3613], 'amplified': [3615, 3701], 'β-actin': [3617], 'housekeeping': [3618], 'gene.': [3619], 'initial': [3622], 'denaturation': [3623], 'step': [3624], '94': [3629, 3654], '°C,': [3630], 'optimal': [3639], 'number': [3640, 3690, 3737, 3762], 'cycles': [3642, 3693, 3739, 3764], 'within': [3643], 'linear': [3644, 3698, 3729], 'range,': [3645], 'thermal': [3648, 3747, 3772], 'profile': [3649, 3748, 3773], 's': [3652, 3664], '(denaturalization),': [3656], '58': [3659], '(annealing),': [3661], '72': [3666], '(elongation).': [3668], 'Table': [3669], 'shows': [3671], 'forward': [3673], 'primers': [3676], 'analyzed,': [3681], 'size': [3683], 'fragment': [3687], 'range.': [3699], '5%': [3707], 'acrylamide/bisacrylamide': [3708], 'gel': [3709], 'electrophoresis': [3710], 'ethidium': [3714, 4103], 'bromide.TABLE': [3715], '1Genes,': [3716], 'primers,': [3717], 'semiquantitative': [3721], 'amplificationGene': [3723], 'productForward': [3724], 'primerReverse': [3725], 'primerFragment': [3726], 'sizeCycles': [3727], 'rangeaLinear': [3730], 'range': [3731, 3756], 'achieved': [3733, 3758], '20-ng': [3742, 3767], 'template': [3744, 3769], '"Experimental': [3751, 3776], 'Procedures"bpNrf25′–ATCCAGACAGACACCAGTGGATC–3′5′–GGCAGTGAAGACTGAACTTTCA–3′17920GSK-3β5′–TACCCATACGATGTTCCAGAT–3′5′–ACCCTGCCCAGGAGTTGCCAC–3′12030HO-15′–TGCTCAACATCCAGCTCTTTGA–3′5′–GCAGAATCTTGCACTTTGTTGCT–3′12030HO-25′–ATGGAGCTGCACCGGAAGGAG–3′5′–CTCCGGCTCGTTCTGCCCTAT–3′13030GSTA15′–CCTGCCTTTGAAAAAGTCTTAAAG–3′5′–AAGTTCCACCAGGTGAATGTCA–3′8632Gpx45′–CCGAAGTAAACTACACTCAGCTCGTC–3′5′–TTGATCTCTTCGTTACTCCCTGGC–3′12422GCL-M5′–GCTGTATCAGTGGGCACAG–3′5′–CGCTTGAATGTCAGGAATGC–3′19622NQO1bNQO1,': [3752], 'oxidoreductase5′–AGGCTGGTTTGAGCGAGT–3′5′–ATTGAATTCGGGCGTCTGCTG–3′26930β-Actin5′–TGTTTGAGACCTTCAACACC–3′5′–CGCTCATTGCCGATAGTGAT–3′20721a': [3754], 'Linear': [3755], 'Procedures"b': [3777], 'NQO1,': [3778], 'Open': [3781], 'table': [3782], 'tab': [3786], 'GSH': [3787], 'Levels—The': [3788, 3922], 'reduced': [3791], '(GSH)': [3793], 'determined': [3795, 3884, 3928], 'GSH-sensitive': [3798], 'probe': [3799, 3893, 3905], 'monochlorobimane': [3800, 3852], '60,000': [3803, 3939], 'later,': [3813, 3948], 'indicated.': [3818, 3953], 'l-buthionine-(S,R)-sulfoximine': [3821], '(BSO)': [3822], 'h.': [3832], 'During': [3833], 'last': [3835, 3857], 'h,': [3837, 3956], '0.5': [3842, 3961], 'Fig.': [3848, 3970, 4238], '8A.': [3849], 'hour.': [3858], 'Plates': [3859], 'immediately': [3862], 'Fluoroscan': [3865], 'fluorometer': [3866], '(Labsystems': [3867], 'Oy,': [3868], 'Helsinki,': [3869], 'Finland)': [3870], '(20-ms': [3871], 'integration': [3872], '355-nm': [3874], 'excitation': [3875], 'filter,': [3876], '485-nm': [3878], 'emission': [3879], 'filter).': [3880], 'Basal': [3881], 'autofluorescence': [3882], 'subtracted': [3896, 3911], 'all': [3898, 4143], 'samples.': [3899, 4167], 'background': [3901], 'incorporation': [3902], '-SH': [3907], 'groups': [3909], 'sample': [3914, 4055], 'BSO-treated': [3918], 'GSH-depleted': [3919], 'controls.': [3920], 'LDH': [3921, 3926, 3935, 3995, 4040, 4044, 4083], 'cytotoxicity': [3931], 'detection': [3932, 4105, 4112], 'kit': [3933], '(Roche': [3936], 'Applied': [3937], 'Science).': [3938], '16-h': [3947], 'showed': [3968], '8B.': [3971], 'into': [3984], 'wells': [3986], '96-well': [3989, 4034], 'micro-plate': [3990], 'determination': [3992, 4037], 'levels.': [3996, 4041], 'adherent': [4005], 'cells,': [4006], 'replaced': [4008], 'ml': [4011], "Dulbecco's": [4013], "Eagle's": [4015], 'X-100.': [4020], 'Again,': [4021], 'microplate': [4035, 4070], 'determine': [4043], 'mixture': [4050], 'temperature.': [4063], 'Optical': [4064], 'density': [4065], 'reader': [4071], '(ELISA),': [4072], '490': [4074], '600': [4077], 'nm.': [4078], 'fold': [4087], 'increase': [4089], 'over': [4090], 'untreated': [4092], 'cells.': [4093], 'Image': [4094, 4121], 'Analysis,': [4095], 'Quantification,': [4096], 'Statistics—Different': [4098], 'band': [4099], 'intensities': [4100], 'bromide': [4104], 'DNA': [4107], 'samples': [4108, 4115], 'Western': [4110], 'blot': [4111], 'quantified': [4117], 'Scion': [4120], 'program.': [4122], "Student's": [4123], 't': [4124], 'test': [4125], 'assess': [4129], 'differences': [4130], 'groups.': [4132], 'p': [4134], 'value': [4135], '<': [4136], '0.001': [4137], 'considered': [4139], 'significant.': [4140], 'Unless': [4141], 'indicated,': [4142], 'experiments': [4144], 'least': [4148, 4165], 'similar': [4152], 'results.': [4153], 'values': [4155], 'graphs': [4158], 'correspond': [4159], 'mean': [4162], 'Error': [4168], 'bars': [4169], 'indicate': [4170], 'S.D.': [4171], 'First,': [4172], 'set': [4174], 'up': [4175], 'investigate': [4179], 'induction': [4183], 'model.': [4193], 'active,': [4203], 'membrane-targeted': [4204], 'versions': [4205], '(PI3K-CAAX)': [4208], 'Akt1': [4210], '(myr-Akt1),': [4211], 'efficiency': [4214], 'close': [4217], '90%': [4219], '(data': [4220], 'shown).': [4222], 'transfection.': [4234], 'As': [4235], '1A,': [4239], 'PI3K-CAAX-': [4240], 'myr-Akt1-transfected': [4242], 'exhibited': [4244], 'Thr308-phosphorylated,': [4248], 'Interestingly,': [4251], 'activation': [4253], 'correlated': [4254], 'dete': [4262]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W1999148207', 'counts_by_year': [{'year': 2024, 'cited_by_count': 30}, {'year': 2023, 'cited_by_count': 23}, {'year': 2022, 'cited_by_count': 48}, {'year': 2021, 'cited_by_count': 47}, {'year': 2020, 'cited_by_count': 37}, {'year': 2019, 'cited_by_count': 32}, {'year': 2018, 'cited_by_count': 25}, {'year': 2017, 'cited_by_count': 20}, {'year': 2016, 'cited_by_count': 27}, {'year': 2015, 'cited_by_count': 26}, {'year': 2014, 'cited_by_count': 27}, {'year': 2013, 'cited_by_count': 20}, {'year': 2012, 'cited_by_count': 29}], 'updated_date': '2025-01-07T11:08:15.002698', 'created_date': '2016-06-24'}
Publication Information

Basic Information

Access and Citation

AI Researcher Chatbot

Primary Location

Authors

Topics

Keywords

Related Works
