Publication Information

{'id': 'https://openalex.org/W1997323954', 'doi': 'https://doi.org/10.1074/jbc.m010764200', 'title': 'Estrogen Decreases Osteoclast Formation by Down-regulating Receptor Activator of NF-κB Ligand (RANKL)-induced JNK Activation', 'display_name': 'Estrogen Decreases Osteoclast Formation by Down-regulating Receptor Activator of NF-κB Ligand (RANKL)-induced JNK Activation', 'publication_year': 2001, 'publication_date': '2001-03-01', 'ids': {'openalex': 'https://openalex.org/W1997323954', 'doi': 'https://doi.org/10.1074/jbc.m010764200', 'mag': '1997323954', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/11121427'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m010764200', 'pdf_url': 'http://www.jbc.org/article/S0021925819461759/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S0021925819461759/pdf', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5101897130', 'display_name': 'Sunil Kumar Srivastava', 'orcid': 'https://orcid.org/0000-0002-1425-3143'}, 'institutions': [], 'countries': [], 'is_corresponding': False, 'raw_author_name': 'Sunil Srivastava', 'raw_affiliation_strings': ['Division of Bone and Mineral Diseases'], 'affiliations': [{'raw_affiliation_string': 'Division of Bone and Mineral Diseases', 'institution_ids': []}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5017493679', 'display_name': 'Gianluca Toraldo', 'orcid': None}, 'institutions': [], 'countries': [], 'is_corresponding': False, 'raw_author_name': 'Gianluca Toraldo', 'raw_affiliation_strings': ['Division of Bone and Mineral Diseases'], 'affiliations': [{'raw_affiliation_string': 'Division of Bone and Mineral Diseases', 'institution_ids': []}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5070049123', 'display_name': 'M. Neale Weitzmann', 'orcid': 'https://orcid.org/0000-0003-3305-5748'}, 'institutions': [], 'countries': [], 'is_corresponding': False, 'raw_author_name': 'M. Neale Weitzmann', 'raw_affiliation_strings': ['Division of Bone and Mineral Diseases'], 'affiliations': [{'raw_affiliation_string': 'Division of Bone and Mineral Diseases', 'institution_ids': []}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5025395510', 'display_name': 'Simone Cenci', 'orcid': 'https://orcid.org/0000-0003-1215-7518'}, 'institutions': [], 'countries': [], 'is_corresponding': False, 'raw_author_name': 'Simone Cenci', 'raw_affiliation_strings': ['Division of Bone and Mineral Diseases'], 'affiliations': [{'raw_affiliation_string': 'Division of Bone and Mineral Diseases', 'institution_ids': []}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5058432635', 'display_name': 'F. Patrick Ross', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I4210102777', 'display_name': 'Jewish Hospital', 'ror': 'https://ror.org/018s10n18', 'country_code': 'US', 'type': 'healthcare', 'lineage': ['https://openalex.org/I4210102777']}, {'id': 'https://openalex.org/I1299725459', 'display_name': 'Barnes-Jewish Hospital', 'ror': 'https://ror.org/04wyvkr12', 'country_code': 'US', 'type': 'healthcare', 'lineage': ['https://openalex.org/I1299725459', 'https://openalex.org/I1328499231']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'F. Patrick Ross', 'raw_affiliation_strings': ['Department of Pathology, Washington University School of Medicine and Barnes/Jewish Hospital, St. Louis, Missouri 63110'], 'affiliations': [{'raw_affiliation_string': 'Department of Pathology, Washington University School of Medicine and Barnes/Jewish Hospital, St. Louis, Missouri 63110', 'institution_ids': ['https://openalex.org/I4210102777', 'https://openalex.org/I1299725459']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5077283095', 'display_name': 'Roberto Pacifici', 'orcid': 'https://orcid.org/0000-0001-6077-8250'}, 'institutions': [], 'countries': [], 'is_corresponding': False, 'raw_author_name': 'Roberto Pacifici', 'raw_affiliation_strings': ['Division of Bone and Mineral Diseases'], 'affiliations': [{'raw_affiliation_string': 'Division of Bone and Mineral Diseases', 'institution_ids': []}]}], 'institution_assertions': [], 'countries_distinct_count': 1, 'institutions_distinct_count': 2, 'corresponding_author_ids': [], 'corresponding_institution_ids': [], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 7.229, 'has_fulltext': True, 'fulltext_origin': 'pdf', 'cited_by_count': 348, 'citation_normalized_percentile': {'value': 0.999974, 'is_in_top_1_percent': True, 'is_in_top_10_percent': True}, 'cited_by_percentile_year': {'min': 98, 'max': 99}, 'biblio': {'volume': '276', 'issue': '12', 'first_page': '8836', 'last_page': '8840'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T11219', 'display_name': 'Bone Metabolism and Diseases', 'score': 1.0, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, 'topics': [{'id': 'https://openalex.org/T11219', 'display_name': 'Bone Metabolism and Diseases', 'score': 1.0, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T11221', 'display_name': 'Bone health and treatments', 'score': 0.9992, 'subfield': {'id': 'https://openalex.org/subfields/2730', 'display_name': 'Oncology'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, {'id': 'https://openalex.org/T11591', 'display_name': 'NF-κB Signaling Pathways', 'score': 0.9951, 'subfield': {'id': 'https://openalex.org/subfields/1306', 'display_name': 'Cancer Research'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/rank-ligand', 'display_name': 'RANK Ligand', 'score': 0.4723407}], 'concepts': [{'id': 'https://openalex.org/C2779428903', 'wikidata': 'https://www.wikidata.org/wiki/Q418934', 'display_name': 'RANKL', 'level': 4, 'score': 0.92140615}, {'id': 'https://openalex.org/C2776033226', 'wikidata': 'https://www.wikidata.org/wiki/Q828410', 'display_name': 'Osteoclast', 'level': 3, 'score': 0.74875814}, {'id': 'https://openalex.org/C88045685', 'wikidata': 'https://www.wikidata.org/wiki/Q174576', 'display_name': 'Activator (genetics)', 'level': 3, 'score': 0.53201413}, {'id': 'https://openalex.org/C126322002', 'wikidata': 'https://www.wikidata.org/wiki/Q11180', 'display_name': 'Internal medicine', 'level': 1, 'score': 0.49338785}, {'id': 'https://openalex.org/C185592680', 'wikidata': 'https://www.wikidata.org/wiki/Q2329', 'display_name': 'Chemistry', 'level': 0, 'score': 0.49095443}, {'id': 'https://openalex.org/C134018914', 'wikidata': 'https://www.wikidata.org/wiki/Q162606', 'display_name': 'Endocrinology', 'level': 1, 'score': 0.47408068}, {'id': 'https://openalex.org/C2909639871', 'wikidata': 'https://www.wikidata.org/wiki/Q418934', 'display_name': 'RANK Ligand', 'level': 5, 'score': 0.4723407}, {'id': 'https://openalex.org/C84606932', 'wikidata': 'https://www.wikidata.org/wiki/Q416496', 'display_name': 'Estrogen receptor', 'level': 4, 'score': 0.45410192}, {'id': 'https://openalex.org/C17991360', 'wikidata': 'https://www.wikidata.org/wiki/Q21173843', 'display_name': 'Tumor necrosis factor alpha', 'level': 2, 'score': 0.45070052}, {'id': 'https://openalex.org/C502942594', 'wikidata': 'https://www.wikidata.org/wiki/Q3421914', 'display_name': 'Cancer research', 'level': 1, 'score': 0.44114253}, {'id': 'https://openalex.org/C95444343', 'wikidata': 'https://www.wikidata.org/wiki/Q7141', 'display_name': 'Cell biology', 'level': 1, 'score': 0.4392782}, {'id': 'https://openalex.org/C86339819', 'wikidata': 'https://www.wikidata.org/wiki/Q407384', 'display_name': 'Transcription factor', 'level': 3, 'score': 0.4252444}, {'id': 'https://openalex.org/C2780426850', 'wikidata': 'https://www.wikidata.org/wiki/Q3357478', 'display_name': 'Osteoprotegerin', 'level': 4, 'score': 0.4109846}, {'id': 'https://openalex.org/C170493617', 'wikidata': 'https://www.wikidata.org/wiki/Q208467', 'display_name': 'Receptor', 'level': 2, 'score': 0.3654788}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.3109945}, {'id': 'https://openalex.org/C71924100', 'wikidata': 'https://www.wikidata.org/wiki/Q11190', 'display_name': 'Medicine', 'level': 0, 'score': 0.13319299}, {'id': 'https://openalex.org/C55493867', 'wikidata': 'https://www.wikidata.org/wiki/Q7094', 'display_name': 'Biochemistry', 'level': 1, 'score': 0.07628876}, {'id': 'https://openalex.org/C121608353', 'wikidata': 'https://www.wikidata.org/wiki/Q12078', 'display_name': 'Cancer', 'level': 2, 'score': 0.0}, {'id': 'https://openalex.org/C530470458', 'wikidata': 'https://www.wikidata.org/wiki/Q128581', 'display_name': 'Breast cancer', 'level': 3, 'score': 0.0}, {'id': 'https://openalex.org/C104317684', 'wikidata': 'https://www.wikidata.org/wiki/Q7187', 'display_name': 'Gene', 'level': 2, 'score': 0.0}], 'mesh': [{'descriptor_ui': 'D002352', 'descriptor_name': 'Carrier Proteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D002455', 'descriptor_name': 'Cell Division', 'qualifier_ui': 'Q000187', 'qualifier_name': 'drug effects', 'is_major_topic': True}, {'descriptor_ui': 'D015536', 'descriptor_name': 'Down-Regulation', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': True}, {'descriptor_ui': 'D004958', 'descriptor_name': 'Estradiol', 'qualifier_ui': 'Q000494', 'qualifier_name': 'pharmacology', 'is_major_topic': True}, {'descriptor_ui': 'D008562', 'descriptor_name': 'Membrane Glycoproteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D020928', 'descriptor_name': 'Mitogen-Activated Protein Kinases', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D010010', 'descriptor_name': 'Osteoclasts', 'qualifier_ui': 'Q000187', 'qualifier_name': 'drug effects', 'is_major_topic': True}, {'descriptor_ui': 'D000818', 'descriptor_name': 'Animals', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D001483', 'descriptor_name': 'Base Sequence', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002352', 'descriptor_name': 'Carrier Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002455', 'descriptor_name': 'Cell Division', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002460', 'descriptor_name': 'Cell Line', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002467', 'descriptor_name': 'Cell Nucleus', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002467', 'descriptor_name': 'Cell Nucleus', 'qualifier_ui': 'Q000187', 'qualifier_name': 'drug effects', 'is_major_topic': False}, {'descriptor_ui': 'D002467', 'descriptor_name': 'Cell Nucleus', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D015342', 'descriptor_name': 'DNA Probes', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D004789', 'descriptor_name': 'Enzyme Activation', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D004958', 'descriptor_name': 'Estradiol', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D048031', 'descriptor_name': 'JNK Mitogen-Activated Protein Kinases', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008562', 'descriptor_name': 'Membrane Glycoproteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D051379', 'descriptor_name': 'Mice', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D020928', 'descriptor_name': 'Mitogen-Activated Protein Kinases', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D010010', 'descriptor_name': 'Osteoclasts', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D010010', 'descriptor_name': 'Osteoclasts', 'qualifier_ui': 'Q000166', 'qualifier_name': 'cytology', 'is_major_topic': False}, {'descriptor_ui': 'D016760', 'descriptor_name': 'Proto-Oncogene Proteins c-fos', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D016760', 'descriptor_name': 'Proto-Oncogene Proteins c-fos', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D016755', 'descriptor_name': 'Proto-Oncogene Proteins c-jun', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D016755', 'descriptor_name': 'Proto-Oncogene Proteins c-jun', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D053245', 'descriptor_name': 'RANK Ligand', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D053246', 'descriptor_name': 'Receptor Activator of Nuclear Factor-kappa B', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}], 'locations_count': 2, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m010764200', 'pdf_url': 'http://www.jbc.org/article/S0021925819461759/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/11121427', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m010764200', 'pdf_url': 'http://www.jbc.org/article/S0021925819461759/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [{'score': 0.45, 'id': 'https://metadata.un.org/sdg/3', 'display_name': 'Good health and well-being'}], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 48, 'referenced_works': ['https://openalex.org/W1534645474', 'https://openalex.org/W1537488315', 'https://openalex.org/W1539871462', 'https://openalex.org/W1594700207', 'https://openalex.org/W1971915141', 'https://openalex.org/W1977830503', 'https://openalex.org/W1986392434', 'https://openalex.org/W1986559713', 'https://openalex.org/W1986714785', 'https://openalex.org/W1986879578', 'https://openalex.org/W1993064864', 'https://openalex.org/W1999032828', 'https://openalex.org/W1999350522', 'https://openalex.org/W1999894310', 'https://openalex.org/W2003733256', 'https://openalex.org/W2016674232', 'https://openalex.org/W2018602999', 'https://openalex.org/W2019172276', 'https://openalex.org/W2035936653', 'https://openalex.org/W2041138285', 'https://openalex.org/W2043144329', 'https://openalex.org/W2048299560', 'https://openalex.org/W2064797437', 'https://openalex.org/W2066318392', 'https://openalex.org/W2067754245', 'https://openalex.org/W2069652778', 'https://openalex.org/W2072050034', 'https://openalex.org/W2073614902', 'https://openalex.org/W2074776278', 'https://openalex.org/W2077880395', 'https://openalex.org/W2084535197', 'https://openalex.org/W2091285777', 'https://openalex.org/W2095092592', 'https://openalex.org/W2106766464', 'https://openalex.org/W2110993073', 'https://openalex.org/W2116594362', 'https://openalex.org/W2126446849', 'https://openalex.org/W2131609948', 'https://openalex.org/W2133281510', 'https://openalex.org/W2135806535', 'https://openalex.org/W2139996507', 'https://openalex.org/W2140473585', 'https://openalex.org/W2155280531', 'https://openalex.org/W2155921604', 'https://openalex.org/W2157009361', 'https://openalex.org/W2321505964', 'https://openalex.org/W2399461476', 'https://openalex.org/W2473173223'], 'related_works': ['https://openalex.org/W3007780079', 'https://openalex.org/W2789429347', 'https://openalex.org/W2512110868', 'https://openalex.org/W2127743278', 'https://openalex.org/W2076385712', 'https://openalex.org/W1987459855', 'https://openalex.org/W1884845882', 'https://openalex.org/W1485233265', 'https://openalex.org/W1482403786', 'https://openalex.org/W137190687'], 'abstract_inverted_index': {'The': [0, 146, 330, 600, 1129, 2116, 2144, 2153, 2232, 2333, 2352, 2379, 2574, 2694, 2709, 2742, 2860, 3197, 3488, 3897, 4116, 4243, 5367, 5649, 5720], 'differentiation': [1, 75, 147, 221, 331, 2873, 3025, 3068, 3187, 3213, 4731], 'of': [2, 4, 24, 36, 40, 78, 95, 109, 121, 141, 148, 150, 170, 182, 186, 224, 241, 255, 267, 287, 295, 300, 332, 336, 349, 437, 602, 611, 621, 629, 721, 779, 901, 1017, 1022, 1029, 1063, 1103, 1110, 1115, 1127, 1131, 1139, 1172, 1183, 1200, 1319, 1332, 1338, 1357, 1366, 1383, 1410, 1721, 1911, 1926, 1994, 2005, 2010, 2019, 2112, 2130, 2161, 2171, 2184, 2317, 2362, 2381, 2386, 2394, 2399, 2576, 2678, 2684, 2725, 2756, 2763, 2842, 2874, 2881, 3016, 3026, 3047, 3052, 3063, 3069, 3080, 3090, 3109, 3188, 3214, 3227, 3256, 3289, 3296, 3378, 3406, 3415, 3491, 3524, 3538, 3549, 3555, 3562, 3567, 3601, 3623, 3632, 3647, 3664, 3670, 3701, 3704, 3717, 3730, 3741, 3756, 3781, 3793, 3840, 3881, 3895, 3904, 3908, 3981, 3987, 3998, 4006, 4012, 4031, 4059, 4086, 4113, 4118, 4137, 4142, 4189, 4206, 4231, 4275, 4290, 4296, 4340, 4437, 4489, 4500, 4506, 4627, 4637, 4732, 4764, 4781, 4806, 4810, 4824, 4938, 4989, 5015, 5023, 5029, 5037, 5124, 5165, 5250, 5256, 5259, 5271, 5280, 5301, 5336, 5343, 5369, 5384, 5527, 5562, 5572, 5645, 5657, 5674, 5682, 5715, 5723, 5809, 5826, 5881, 5899, 5905, 5912, 5919, 5938], 'cells': [3, 149, 1216, 1427, 1434, 1462, 1501, 1649, 1914, 2016, 2026, 2040, 2417, 2486, 2623, 2883, 3045, 3191, 3220, 3270, 3364, 3467, 3545, 3584, 3587, 4159, 4175, 5816], 'the': [5, 16, 41, 59, 63, 74, 93, 110, 139, 151, 162, 187, 205, 209, 220, 239, 256, 285, 337, 609, 619, 627, 724, 768, 777, 897, 1014, 1020, 1027, 1061, 1101, 1111, 1125, 1137, 1151, 1181, 1194, 1198, 1252, 1302, 1317, 1330, 1339, 1355, 1364, 1377, 1407, 1431, 1480, 1909, 1930, 1995, 2124, 2295, 2366, 2395, 2642, 2679, 2691, 2726, 2753, 2764, 2770, 2780, 2853, 2872, 2879, 3014, 3024, 3061, 3067, 3078, 3088, 3107, 3186, 3224, 3232, 3253, 3277, 3287, 3294, 3403, 3407, 3500, 3534, 3560, 3599, 3617, 3620, 3630, 3645, 3662, 3668, 3702, 3713, 3728, 3739, 3754, 3774, 3778, 3790, 3800, 3811, 3838, 3843, 3909, 3979, 4004, 4009, 4032, 4057, 4084, 4105, 4110, 4135, 4140, 4168, 4187, 4198, 4204, 4227, 4232, 4271, 4288, 4294, 4498, 4504, 4507, 4635, 4730, 4762, 4779, 4808, 4827, 4924, 4936, 4986, 5027, 5030, 5035, 5038, 5125, 5163, 5254, 5257, 5260, 5276, 5299, 5313, 5318, 5341, 5344, 5370, 5377, 5560, 5570, 5631, 5642, 5655, 5672, 5680, 5712, 5823, 5878, 5897, 5903, 5936, 5942], 'monocytic': [6, 89, 152, 235, 338, 1215, 3096], 'lineage': [7, 153, 339], 'into': [8, 76, 154, 222, 340, 2876, 3030, 3071, 3100, 3192, 3221, 4735], 'mature': [9, 155, 341, 603, 3031, 4341, 4736], 'osteoclasts': [10, 156], '(OC)': [11, 157], 'is': [12, 38, 52, 136, 158, 184, 198, 282, 343, 605, 716, 723, 1134, 1247, 1314, 2868, 3261, 3293, 3673, 3828, 4124, 4309, 4820, 5161, 5167, 5266, 5295, 5374, 5381, 5488, 5630, 5666, 5805, 5875, 5933], 'specifically': [13, 159, 345], 'induced': [14, 160, 344, 3194, 3285, 3559, 3743, 4044], 'by': [15, 44, 91, 131, 137, 161, 190, 237, 277, 283, 346, 353, 357, 618, 727, 775, 1308, 1315, 1353, 1362, 1376, 1413, 1514, 1645, 2121, 2242, 2250, 2294, 2301, 2369, 2612, 2834, 2852, 3012, 3184, 3195, 3231, 3286, 3433, 3437, 3499, 3612, 3680, 3726, 3737, 3744, 3830, 3914, 4102, 4186, 4202, 4249, 4934, 4984, 5169, 5213, 5263, 5268, 5376, 5501, 5633, 5651, 5927, 5934], 'tumor': [17, 163, 309], 'necrosis': [18, 164, 310], 'factor-related': [19, 165], 'factor,': [20, 166, 1108], 'RANKL': [21, 167, 613, 902, 1034, 1104, 1152, 1173, 1507, 1520, 1651, 2066, 2423, 2492, 2626, 2865, 3019, 3105, 3290, 3389, 3445, 3470, 3558, 3641, 3665, 3724, 3786, 3804, 4039, 4080, 4200, 4269, 4291, 4982, 4990, 5016, 5563, 5635, 5804, 5900], '(receptor': [22, 168], 'activator': [23, 169, 294, 299, 436, 5808], 'NF-κB': [25, 171, 296, 301, 438, 5033, 5690, 5695, 5705, 5727, 5810, 5827, 5848, 5884], 'ligand;': [26, 172], 'also': [27, 173, 1361, 1643, 3592, 3747, 3835, 4247, 4282, 4724, 5296, 5659, 5840], 'known': [28, 174, 433, 442, 3676], 'as': [29, 175, 434, 443, 616, 1105, 1401, 1530, 1656, 1939, 1972, 2036, 2079, 2252, 2537, 2647, 2804, 2844, 3036, 3206, 3208, 3464, 4184, 5306], 'OPGL,': [30, 176, 444], 'ODF,': [31, 177], 'or': [32, 62, 178, 208, 446, 1454, 1999, 2029, 2054, 2057, 2420, 2455, 2489, 2799, 2839, 3055, 3370, 4800, 4837, 4983], 'TRANCE).': [33, 179], 'Because': [34, 180, 3073, 3990, 5333, 5684], 'inhibition': [35, 181, 720, 3478, 3907, 4488], 'osteoclastogenesis': [37, 135, 183, 281, 722, 5487], 'one': [39, 128, 185, 274], 'main': [42, 188, 725], 'mechanisms': [43, 189, 1009, 3279], 'which': [45, 132, 191, 278, 728, 1309, 1725, 4181, 4328, 5245, 5634, 5652, 5928], 'estrogen': [46, 192, 302, 729, 1471, 2049, 3199, 3209, 3228, 3233, 3501], '(E2)': [47, 193, 730], 'prevents': [48, 194, 731, 4314], 'bone': [49, 81, 195, 227, 313, 350, 358, 732, 1408, 4315, 4323, 4326, 4345], 'loss,': [50, 196], 'it': [51, 197, 2991, 5665, 5700, 5874], 'likely': [53, 199, 5667, 5876], 'that': [54, 71, 200, 217, 719, 770, 895, 1010, 1192, 1208, 1244, 1304, 1327, 2862, 3008, 3241, 3401, 3444, 3532, 3543, 3659, 3723, 3734, 3771, 3784, 3814, 3834, 3899, 3916, 3921, 4038, 4268, 4284, 4312, 4726, 4926, 5308, 5379, 5497, 5557, 5620, 5627, 5668, 5704, 5803, 5818, 5842, 5877, 5894], 'E2': [55, 72, 133, 201, 218, 279, 771, 1018, 1209, 1310, 1328, 1347, 1452, 2044, 2996, 3009, 3064, 3081, 3182, 3257, 3358, 3369, 3458, 3472, 3492, 3591, 3643, 3660, 3705, 3735, 3746, 3788, 3815, 3882, 3900, 3982, 4007, 4071, 4082, 4138, 4285, 4313, 4362, 4501, 4628, 4727, 5558, 5637, 5653, 5669, 5692, 5716, 5724, 5819, 5843, 5882, 5895, 5929], 'may': [56, 202, 5670, 5706], 'regulate': [57, 203, 1124, 5638, 5671, 5846], 'either': [58, 204, 630, 1451, 2418, 2450, 2487, 2792, 3053, 3368, 4834], 'production': [60, 206, 778, 900, 1028, 1062, 1126, 1199, 1337, 1356, 3561, 3894, 3997, 4505, 4636, 4937, 5571, 5644, 5673], 'of,': [61, 207], 'target': [64, 210, 4114], 'cell': [65, 211, 899, 2077, 2105, 2281, 2303, 2409, 2478, 3527], 'responsiveness': [66, 140, 212, 286, 1318, 5937], 'to': [67, 125, 144, 213, 271, 290, 1012, 1025, 1123, 1174, 1300, 1322, 1335, 1369, 1495, 1932, 2349, 2640, 2689, 2703, 2723, 2748, 2769, 2870, 2993, 3022, 3065, 3076, 3098, 3176, 3263, 3291, 3381, 3519, 3666, 3677, 3805, 3808, 3823, 3837, 3887, 3983, 4104, 4122, 4126, 4147, 4149, 4167, 4196, 4208, 4226, 4273, 4292, 4301, 4343, 4502, 4633, 4770, 4814, 4829, 4833, 5017, 5312, 5564, 5661, 5687, 5730, 5828, 5901, 5909, 5922, 5941], 'RANKL.': [68, 145, 214, 291, 1128, 1323, 1370, 3196, 3745, 5945], 'We': [69, 215, 1204], 'found': [70, 216, 3484, 5556, 5802, 5841], 'decreases': [73, 219, 1329, 3011, 3183, 3359, 3736, 5559], 'OC': [77, 142, 223, 288, 622, 773, 1245, 1312, 1321, 1349, 1368, 1511, 1641, 1728, 2877, 3003, 3032, 3101, 3193, 3250, 3265, 4332, 4335, 4364, 4367, 4490, 4733, 4737, 4795, 4816, 4932, 5718, 5931, 5939], 'both': [79, 225, 612, 1140, 3215, 3616, 3633, 3773, 4060, 4369], 'murine': [80, 226, 3028, 3095], 'marrow': [82, 228, 314, 351, 359, 1397, 1409, 4324], 'monocytes': [83, 229, 352, 1398], 'and': [84, 116, 118, 230, 262, 264, 429, 614, 782, 903, 1055, 1109, 1143, 1197, 1240, 1256, 1344, 1380, 1390, 1441, 1448, 1470, 1497, 1523, 1732, 1735, 1739, 1918, 1929, 1967, 2008, 2012, 2034, 2062, 2123, 2168, 2173, 2240, 2325, 2347, 2355, 2383, 2388, 2392, 2401, 2413, 2436, 2441, 2453, 2458, 2482, 2504, 2533, 2570, 2578, 2592, 2619, 2681, 2746, 2866, 3020, 3041, 3203, 3217, 3267, 3385, 3411, 3419, 3427, 3435, 3509, 3540, 3552, 3619, 3625, 3650, 3733, 3777, 3818, 3891, 4000, 4024, 4034, 4043, 4062, 4091, 4096, 4130, 4144, 4155, 4237, 4259, 4277, 4298, 4306, 4319, 4325, 4337, 4366, 4433, 4440, 4512, 4643, 4776, 4785, 4794, 4929, 4981, 5034, 5127, 5444, 5523, 5567, 5569, 5577, 5636, 5641, 5647, 5691, 5813, 5817, 5887, 5914, 5916], 'RAW': [85, 231, 1425, 1460, 1499, 1647, 2038, 2415, 2484, 2621, 3091, 3189, 3268, 3362, 3525, 4020, 4157, 5814], '264.7': [86, 232, 1426, 1461, 1500, 1648, 2039, 2416, 2485, 2622, 3092, 3190, 3219, 3269, 3363, 3526, 4021, 4158, 5815], 'cells,': [87, 233, 361, 1403, 1724, 3093, 4056, 4220, 4327, 4792, 5699], 'a': [88, 234, 430, 1032, 1056, 1188, 2284, 2343, 2370, 3094, 3239, 3246, 3376, 3516, 3594, 3674, 3749, 3832, 3878, 3919, 4163, 4177, 4221, 4822, 5021, 5247, 5382, 5494, 5806, 5925], 'line,': [90, 236, 3097], 'down-regulating': [92, 238], 'activation': [94, 240, 1182, 1213, 1331, 3295, 3669, 3740, 3924, 3993, 5028, 5278, 5348, 5629, 5656, 5681, 5696, 5728, 5849, 5904], 'Jun': [96, 242, 303, 1184, 2680, 3999, 4033, 4095, 4143], 'N-terminal': [97, 243, 304, 1185, 5277], 'kinase': [98, 244, 305, 318, 322, 323, 1186, 1191, 2162, 2318, 2701, 3675, 3719, 3833, 5040], '1': [99, 245, 1292, 1502, 2128, 2182, 2524, 2534, 2630, 2735, 3171, 5514, 5613], '(JNK1).': [100, 246], 'Diminished': [101, 247], 'JNK1': [102, 248, 2387, 2400, 2452, 2457, 3410, 3539, 3551, 3564, 3578, 3603, 3624, 3649, 3679, 5502, 5568], 'activity': [103, 249, 1196, 2073, 2277, 3448, 3476, 3496, 3514, 3890, 4368, 5640], 'results': [104, 250, 1179, 3994, 4329, 5019, 5349], 'in': [105, 251, 624, 1180, 1214, 1249, 1437, 1446, 1936, 2076, 2158, 2236, 2280, 2314, 2337, 2507, 2562, 2737, 2878, 3082, 3106, 3210, 3515, 3582, 3586, 3604, 3636, 3759, 3995, 4054, 4067, 4073, 4109, 4216, 4330, 4492, 4495, 4629, 4767, 4783, 4786, 4801, 5020, 5120, 5175, 5317, 5350, 5490, 5679, 5697, 5710, 5734, 5797, 5811, 5836], 'decreased': [106, 252, 1336, 3892, 4331, 4338, 5917], 'nuclear': [107, 253, 2614, 2685, 2715, 3902, 3985, 4010, 4022, 4120, 4128, 4151], 'levels': [108, 254, 2380, 2575, 3548, 3554, 3600, 3755, 3792, 3903, 3986, 4011, 4042, 4058, 4085, 5911], 'key': [111, 257, 3282], 'osteoclastogenic': [112, 258, 1107, 1340, 1358, 4987, 5573, 5943], 'transcription': [113, 259, 1148, 1202, 1341, 5031, 5123, 5164, 5342, 5574], 'factors,': [114, 260], 'c-Fos': [115, 261, 1255, 1343, 3905, 3988, 4045, 4063, 5319, 5578, 5646, 5913], 'c-Jun,': [117, 263, 2793], 'lower': [119, 265, 3581, 4066, 5910], 'binding': [120, 266, 1144, 2004, 2644, 3288, 4103, 4117, 4205, 4210, 4272, 4295, 5172, 5686, 5825], 'these': [122, 268, 3656, 4013, 4119, 4265, 4797, 5521, 5920], 'transcriptional': [123, 269, 4100], 'inducers': [124, 270], 'DNA.': [126, 272, 5923], 'Thus,': [127, 273, 1346, 3252, 3798, 3877, 5873, 5924], 'novel': [129, 275], 'mechanism': [130, 276, 726, 1307, 4645, 5632, 5650, 5926], 'down-regulates': [134, 280, 772, 1210, 1311, 1348], 'decreasing': [138, 284, 1316, 5935], 'precursors': [143, 289, 335, 4734, 5940], 'osteoclast': [292, 333], 'receptor': [293, 298, 435, 1035, 1177, 3200], 'ligand': [297, 439, 5685], 'macrophage': [306], 'colony-stimulating': [307], 'factor': [308, 311, 432, 631, 5032], 'interleukin': [312], 'monocyte': [315], 'extracellular': [316], 'signal-related': [317, 321], 'mitogen-activated': [319, 1189], 'kinase/extracellular': [320], 'tartrate-resistant': [324, 1921], 'acid': [325, 1922], 'phosphatase': [326, 1923], 'polyacrylamide': [327], 'gel': [328], 'electrophoresis': [329], '(OC)1': [334], 'OCs': [342, 604, 4342, 4782, 4811], 'simultaneous': [347], 'stimulation': [348, 1505, 2863, 5036], 'two': [354, 3404, 5170, 5272], 'cytokines': [355, 894, 1359, 4509, 4798], 'produced': [356], 'stromal': [360, 898, 2882, 4791, 5698], 'M-CSF': [362, 904, 1065, 1524, 1655, 2867, 3021, 3110, 4639, 4939], '(1Macdonald': [363], 'B.R.': [364], 'Mundy': [365, 4450], 'G.R.': [366, 4451], 'Clark': [367], 'S.': [368, 403, 467, 483, 523, 564, 590, 645, 678, 684, 848, 916, 958, 982, 1039, 1157, 1159, 1218, 1222, 1226, 1551, 1567, 1605, 1631, 1689, 1693, 1705, 1761, 1777, 1815, 1841, 1882, 1886, 1898, 2082, 2086, 2090, 2222, 2651, 2655, 2659, 2807, 2811, 2815, 2903, 2919, 2959, 3142, 3146, 3158, 3329, 3333, 3345, 3940, 4423, 4578, 4649, 4673, 4700, 4751, 4873, 4992, 5073, 5077, 5089, 5399, 5405, 5544, 5771, 5775, 5787, 5851, 5855, 5859], 'Wang': [369, 1260, 1678, 1871, 3131, 3318, 5062, 5581, 5760], 'E.A.': [370], 'Kuehl': [371], 'T.J.': [372, 394, 5110], 'Stanley': [373, 412], 'E.R.': [374, 413], 'Roodman': [375], 'G.D.': [376], 'J.': [377, 418, 471, 491, 493, 740, 752, 790, 802, 829, 855, 885, 965, 992, 997, 1074, 1229, 1285, 1555, 1575, 1577, 1765, 1785, 1787, 1952, 2093, 2264, 2662, 2818, 2907, 2927, 2929, 3960, 4352, 4397, 4413, 4476, 4520, 4532, 4559, 4585, 4615, 4656, 4683, 4688, 4709, 4854, 4880, 4910, 4948, 5003, 5151, 5197, 5234, 5507, 5606, 5862], 'Bone': [378, 753, 803, 1286, 1396, 4533, 5508, 5607], 'Miner.': [379, 754, 804, 1287, 4534, 5509, 5608], 'Res.': [380, 755, 805, 1288, 4535, 5510, 5609], '1986;': [381], '1:': [382], '227-232Crossref': [383], 'PubMed': [384, 424, 505, 548, 595, 670, 695, 710, 745, 759, 795, 809, 836, 861, 889, 921, 976, 1003, 1052, 1080, 1095, 1166, 1235, 1276, 1589, 1636, 1710, 1799, 1846, 1903, 1958, 2099, 2202, 2227, 2268, 2554, 2668, 2824, 2941, 2984, 3163, 3350, 3695, 3872, 3945, 3971, 4357, 4403, 4428, 4459, 4482, 4525, 4539, 4566, 4591, 4619, 4667, 4694, 4715, 4756, 4861, 4886, 4914, 4954, 4978, 5009, 5094, 5116, 5155, 5203, 5240, 5439, 5463, 5481, 5549, 5597, 5792, 5868], 'Scopus': [385, 425, 506, 549, 596, 671, 696, 711, 746, 760, 796, 810, 837, 862, 890, 922, 977, 1004, 1081, 1096, 1167, 1236, 1277, 1590, 1637, 1711, 1800, 1847, 1904, 1959, 2100, 2203, 2228, 2269, 2555, 2669, 2825, 2942, 2985, 3164, 3351, 3696, 3873, 3946, 3972, 4358, 4404, 4429, 4460, 4483, 4526, 4540, 4567, 4592, 4620, 4668, 4695, 4716, 4757, 4862, 4887, 4915, 4955, 5010, 5095, 5156, 5204, 5241, 5440, 5464, 5482, 5550, 5598, 5793, 5869], '(172)': [386], 'Google': [387, 400, 427, 508, 551, 598, 673, 698, 713, 748, 762, 798, 812, 839, 864, 892, 924, 953, 979, 1006, 1053, 1083, 1098, 1169, 1238, 1279, 1592, 1639, 1713, 1802, 1849, 1906, 1961, 2102, 2205, 2230, 2271, 2557, 2671, 2827, 2944, 2987, 3166, 3353, 3698, 3856, 3875, 3948, 3974, 4360, 4406, 4431, 4462, 4485, 4528, 4542, 4569, 4594, 4622, 4670, 4697, 4718, 4759, 4864, 4889, 4917, 4957, 4979, 5012, 5097, 5117, 5140, 5158, 5189, 5206, 5226, 5243, 5292, 5331, 5365, 5442, 5466, 5484, 5552, 5600, 5795, 5871], 'Scholar,': [388, 401, 509, 552, 674, 699, 749, 799, 813, 840, 865, 925, 954, 980, 1084, 1280, 1593, 1803, 1850, 2206, 2945, 3857, 3949, 4407, 4463, 4529, 4543, 4570, 4595, 4671, 4698, 4865, 4890, 4958, 5098, 5141, 5190, 5227, 5467, 5601], '2Suda': [389], 'T.': [390, 409, 411, 415, 417, 459, 576, 584, 680, 688, 931, 1543, 1617, 1625, 1687, 1753, 1827, 1835, 1880, 2192, 2544, 2895, 3140, 3327, 3861, 4372, 4376, 5071, 5100, 5417, 5769], 'Takahashi': [391, 404, 581, 1622, 1832, 5101], 'N.': [392, 405, 407, 473, 556, 558, 580, 582, 738, 788, 939, 1557, 1597, 1599, 1621, 1623, 1767, 1807, 1809, 1831, 1833, 2909, 4350, 4518, 4998, 5102, 5104], 'Martin': [393, 5109], 'Endocr.': [395, 5111], 'Rev.': [396, 5112], '1992;': [397, 5460, 5475], '13:': [398, 887, 4617, 4912, 5437], '66-80PubMed': [399], '3Tanaka': [402], 'Udagawa': [406, 579, 1620, 1830, 5103], 'Tamura': [408], 'Akatsu': [410], 'Kurokawa': [414], 'Suda': [416, 583, 1624, 1834], 'Clin.': [419, 856, 998, 1230, 1953, 2094, 2663, 2819, 4477, 4586, 4689, 4710, 4881, 4949, 5004, 5863], 'Invest.': [420, 857, 999, 1231, 1954, 2095, 2664, 2820, 4478, 4587, 4690, 4711, 4882, 4950, 5005, 5864], '1993;': [421, 2199, 2551], '91:': [422], '257-263Crossref': [423], '(486)': [426], 'Scholar)': [428, 2988, 4432, 4980], 'TNF-related': [431], '(RANKL)': [440], '(also': [441], 'TRANCE,': [445], 'ODF)': [447], '(4Lacey': [448, 1532, 1742, 2884], 'D.L.': [449, 537, 659, 908, 1043, 1533, 1661, 1743, 1854, 2885, 2973, 3114, 3301, 5045, 5425, 5743], 'Timms': [450, 518, 640, 1534, 1668, 1744, 1861, 2886, 2954, 3121, 3308, 5052, 5750], 'E.': [451, 475, 519, 574, 641, 871, 943, 1535, 1559, 1615, 1669, 1745, 1769, 1825, 1862, 1975, 2887, 2911, 2955, 3122, 3309, 4386, 4601, 4896, 5053, 5106, 5751], 'Tan': [452, 516, 638, 1536, 1670, 1746, 1863, 2888, 2952, 3123, 3310, 5054, 5752], 'H.L.': [453, 517, 639, 1537, 1671, 1747, 1864, 2889, 2953, 3124, 3311, 5055, 5753], 'Kelley': [454, 1538, 1674, 1748, 1867, 2890, 3127, 3314, 5058, 5756], 'M.J.': [455, 1539, 1675, 1749, 1868, 2891, 3128, 3315, 4409, 5059, 5757], 'Dunstan': [456, 534, 656, 909, 1040, 1540, 1662, 1750, 1855, 2892, 2970, 3115, 3302, 5046, 5426, 5744], 'C.R.': [457, 535, 657, 910, 1041, 1541, 1663, 1751, 1856, 2893, 2971, 3116, 3303, 5047, 5427, 5745], 'Burgess': [458, 1542, 1752, 2894], 'Elliott': [460, 464, 1544, 1548, 1672, 1682, 1754, 1758, 1865, 1875, 2896, 2900, 3125, 3135, 3312, 3322, 5056, 5066, 5754, 5764], 'R.': [461, 701, 751, 801, 844, 869, 964, 996, 1155, 1228, 1267, 1545, 1683, 1755, 1876, 1943, 1951, 2092, 2661, 2817, 2897, 3136, 3323, 4531, 4574, 4599, 4655, 4687, 4708, 4869, 4894, 4945, 4969, 5002, 5067, 5588, 5765, 5861], 'Colombero': [462, 1546, 1666, 1756, 1859, 2898, 3119, 3306, 5050, 5748], 'A.': [463, 479, 529, 533, 566, 572, 591, 651, 655, 817, 873, 962, 1547, 1563, 1607, 1613, 1632, 1667, 1706, 1757, 1773, 1817, 1823, 1842, 1860, 1899, 2190, 2194, 2223, 2542, 2546, 2899, 2915, 2965, 2969, 3120, 3159, 3307, 3346, 3847, 3941, 3953, 4390, 4424, 4445, 4547, 4603, 4653, 4752, 4842, 4898, 5051, 5090, 5131, 5180, 5217, 5283, 5322, 5356, 5397, 5409, 5411, 5413, 5545, 5749, 5788], 'G.': [465, 489, 527, 649, 827, 879, 1549, 1573, 1673, 1695, 1759, 1783, 1866, 1888, 2901, 2925, 2963, 3126, 3148, 3313, 3335, 4557, 4609, 4852, 4904, 5057, 5079, 5403, 5755, 5777], 'Scully': [466, 1550, 1688, 1760, 1881, 2902, 3141, 3328, 5072, 5770], 'Hsu': [468, 1552, 1762, 2904, 5737], 'H.': [469, 513, 554, 635, 686, 705, 877, 935, 1553, 1595, 1659, 1763, 1805, 1852, 2905, 2949, 3112, 3299, 4374, 4465, 4607, 4902, 5043, 5741], 'Sullivan': [470, 1554, 1764, 2906], 'Hawkins': [472, 1556, 1766, 2908], 'Davy': [474, 1558, 1768, 2910], 'Capparelli': [476, 520, 642, 1560, 1690, 1770, 1883, 2912, 2956, 3143, 3330, 5074, 5400, 5772], 'C.': [477, 521, 643, 821, 1561, 1691, 1771, 1884, 2256, 2913, 2957, 3144, 3331, 4551, 4846, 4996, 5075, 5395, 5401, 5450, 5773], 'Eli': [478, 1562, 1772, 2914], 'Qian': [480, 1564, 1774, 2916], 'Y.X.': [481, 1565, 1775, 2917], 'Kaufman': [482, 1566, 1776, 2918, 5404], 'Sarosi': [484, 514, 636, 1568, 1676, 1778, 1869, 2920, 2950, 3129, 3316, 5060, 5390, 5758], 'I.': [485, 515, 637, 854, 1569, 1665, 1677, 1779, 1858, 1870, 2921, 2951, 3118, 3130, 3305, 3317, 4584, 4879, 5049, 5061, 5391, 5747, 5759], 'Shalhoub': [486, 1570, 1780, 2922], 'V.': [487, 867, 1571, 1781, 2260, 2923, 4597, 4892, 5473], 'Senaldi': [488, 1572, 1782, 2924], 'Guo': [490, 1574, 1784, 2926], 'Delaney': [492, 1576, 1786, 2928], 'Boyle': [494, 540, 662, 1578, 1698, 1788, 1891, 2930, 2976, 3151, 3338, 5082, 5428, 5780], 'W.J.': [495, 541, 663, 1579, 1699, 1789, 1892, 2931, 2977, 3152, 3339, 5083, 5429, 5781], 'Cell.': [496, 1075, 1580, 1790, 2932, 5474], '1998;': [497, 592, 833, 950, 1000, 1077, 1581, 1633, 1791, 1843, 2933, 3692, 4563, 4691, 4858, 5200, 5237], '93:': [498, 1582, 1792, 2934], '165-176Abstract': [499, 1583, 1793, 2935], 'Full': [500, 502, 971, 973, 1584, 1586, 1794, 1796, 2936, 2938, 3867, 3869, 3966, 3968, 4662, 4664, 5478], 'Text': [501, 503, 972, 974, 1585, 1587, 1795, 1797, 2937, 2939, 3868, 3870, 3967, 3969, 4663, 4665, 5479], 'PDF': [504, 975, 1588, 1798, 2940, 3871, 3970, 4666, 5480], '(4596)': [507, 1591, 1801, 2943], '5Kong': [510, 2946], 'Y.Y.': [511, 633, 2947], 'Yoshida': [512, 634, 2948], 'Morony': [522, 644, 1692, 1885, 2958, 3145, 3332, 5076, 5398, 5774], 'Oliveira-dos-Santos': [524, 646, 2960], 'A.J.': [525, 647, 2961, 3932], 'Van': [526, 648, 2962, 5402], 'Itie': [528, 650, 2964, 5410], 'Khoo': [530, 652, 2966, 5414], 'W.': [531, 653, 1265, 2967, 5415, 5586], 'Wakeham': [532, 654, 2968, 5412], 'Lacey': [536, 658, 907, 1042, 1660, 1853, 2972, 3113, 3300, 5044, 5424, 5742], 'Mak': [538, 660, 2974, 5432], 'T.W.': [539, 661, 2975, 5433], 'Penninger': [542, 664, 2978, 5420], 'J.M.': [543, 665, 850, 2979, 4580, 4875, 5421], 'Nature.': [544, 666, 691, 2980, 5459], '1999;': [545, 667, 918, 1049, 1092, 1163, 1232, 1289, 1707, 1900, 2096, 2665, 2821, 2981, 3160, 3347, 5091, 5113, 5436, 5511, 5610, 5789, 5865], '397:': [546, 668, 2982], '315-323Crossref': [547, 669, 2983], '(2846)': [550, 672, 2986], '6Yasuda': [553, 1594, 1804], 'Shima': [555, 1596, 1806], 'Nakagawa': [557, 1598, 1808], 'Yamaguchi': [559, 1600, 1810], 'K.': [560, 568, 578, 1071, 1601, 1609, 1619, 1811, 1819, 1829, 2014, 4380, 4388], 'Kinosaki': [561, 1602, 1812], 'M.': [562, 570, 682, 823, 825, 875, 929, 988, 990, 1069, 1603, 1611, 1813, 1821, 2188, 2196, 2540, 2548, 3849, 3859, 4382, 4396, 4553, 4555, 4605, 4679, 4681, 4848, 4850, 4900, 5133, 5143, 5149, 5182, 5219, 5285, 5324, 5358], 'Mochizuki': [563, 1604, 1814], 'Tomoyasu': [565, 1606, 1816], 'Yano': [567, 1608, 1818], 'Goto': [569, 1610, 1820], 'Murakami': [571, 1612, 1822], 'Tsuda': [573, 1614, 1824], 'Morinaga': [575, 1616, 1826], 'Higashio': [577, 1618, 1828], 'Proc.': [585, 946, 1626, 1700, 1836, 1893, 2217, 3153, 3340, 3935, 4418, 4746, 5084, 5539, 5782], 'Natl.': [586, 1627, 1701, 1837, 1894, 2218, 3154, 3341, 3936, 4419, 4747, 5085, 5540, 5783], 'Acad.': [587, 1628, 1702, 1838, 1895, 2219, 3155, 3342, 3937, 4420, 4748, 5086, 5541, 5784], 'Sci.': [588, 1629, 1703, 1839, 1896, 2220, 3156, 3343, 3938, 4421, 4749, 5087, 5542, 5785], 'U.': [589, 1067, 1088, 1630, 1704, 1840, 1897, 2221, 3157, 3344, 3939, 4422, 4750, 5088, 5454, 5456, 5543, 5786], '95:': [593, 1634, 1844], '3597-3602Crossref': [594, 1635, 1845], '(3545)': [597, 1638, 1848], 'Scholar).': [599, 714, 763, 1007, 1099, 1170, 1295, 1640, 1714, 1907, 1962, 1990, 2103, 2231, 2272, 2558, 2672, 2828, 3167, 3354, 3699, 3876, 4361, 4486, 4623, 4719, 4918, 5013, 5159, 5207, 5293, 5332, 5366, 5485, 5517, 5616, 5872], 'formation': [601, 774, 1246, 1313, 1350, 4491, 4780, 4809, 4933, 5932], 'completely': [606, 4286], 'dependent': [607], 'on': [608, 1060, 1150, 2142, 2342, 2365, 2433, 2567, 2717, 2729, 2773, 3000, 3179, 3249, 3258, 3493, 3598, 3706, 3753, 3883, 4008, 4139, 4322, 5717, 5725, 5883], 'presence': [610, 3631], 'M-CSF,': [615], 'demonstrated': [617, 5375], 'lack': [620, 1130], 'development': [623], 'mice': [625, 1250, 1412, 4825, 5446, 5492], 'lacking': [626, 1251, 4826], 'expression': [628, 2009, 5354], '(5Kong': [632], '7Yoshida': [675], 'H.S.': [676], 'Hayashi': [677], 'Kunisada': [679], 'Ogawa': [681], 'Nishikawa': [683], 'Okamura': [685], 'Sudo': [687], 'Schultz': [689], 'L.D.': [690], '1990;': [692, 707, 4951], '345:': [693], '442-444Crossref': [694], '(1514)': [697], '8Felix': [700], 'Cecchini': [702, 1262, 5583], 'M.G.': [703, 1263, 5584], 'Fleish': [704], 'Endocrinology.': [706, 832, 1048, 1091, 4562, 4857], '127:': [708], '2592-2597Crossref': [709], '(400)': [712], 'It': [715, 4308], 'now': [717, 4310], 'recognized': [718, 4311], 'loss': [733, 4316], '(9Manolagas': [734, 784, 4346, 4514], 'S.C.': [735, 785, 933, 945, 4347, 4515], 'Jilka': [736, 786, 4348, 4516], 'R.L.': [737, 787, 4349, 4517], 'Eng.': [739, 789, 4351, 4519], 'Med.': [741, 791, 4353, 4399, 4455, 4521], '1995;': [742, 792, 3864, 3942, 3963, 4354, 4479, 4522, 5152], '332:': [743, 793, 4355, 4523], '305-311Crossref': [744, 794, 4356, 4524], '(1560)': [747, 797, 4359, 4527], '10Pacifici': [750, 800, 4530], '1996;': [756, 806, 968, 4456, 4536, 4659], '11:': [757, 807, 4537], '1043-1051Crossref': [758, 808, 4538], '(617)': [761, 811, 4541], 'Moreover,': [764, 3223, 4053, 4215, 4818, 5486, 5835], 'considerable': [765], 'evidence': [766], 'support': [767], 'hypothesis': [769, 1303, 3898], 'blunting': [776], 'IL-1,': [780, 4510, 4774, 4835, 4927], 'IL-6,': [781, 4511, 4775, 4836, 4928], 'TNF': [783, 4513, 4777, 4838, 4930], '11Lorenzo': [814, 4544], 'J.A.': [815, 4473, 4545, 4840], 'Naprta': [816, 4546, 4841], 'Rao': [818, 4548, 4843], 'Y.': [819, 927, 4378, 4384, 4394, 4549, 4844], 'Alander': [820, 4550, 4845], 'Glaccum': [822, 4552, 4847], 'Widmer': [824, 4554, 4849], 'Gronowicz': [826, 4556, 4851], 'Kalinowski': [828, 4558, 4853], 'Pilbeam': [830, 4466, 4560, 4855], 'C.C.': [831, 4467, 4561, 4856], '139:': [834, 4564, 4859], '3022-3025Crossref': [835, 4565, 4860], '(127)': [838, 4568, 4863], '12Ammann': [841, 4571, 4866], 'P.': [842, 852, 937, 3955, 4411, 4572, 4582, 4867, 4877], 'Rizzoli': [843, 4573, 4868], 'Bonjour': [845, 4575, 4870], 'J.P.': [846, 1282, 4576, 4871, 5504, 5603], 'Bourrin': [847, 4577, 4872], 'Meyer': [849, 4579, 4874], 'Vassalli': [851, 4581, 4876], 'Garcia': [853, 4583, 4878], '1997;': [858, 2224, 2265, 3853, 4400, 4588, 4883, 5137, 5186, 5223, 5289, 5328, 5362], '99:': [859, 4589, 4884], '1699-1703Crossref': [860, 4590, 4885], '(267)': [863, 4593, 4888], '13Poli': [866, 4596, 4891], 'Balena': [868, 4598, 4893], 'Fattori': [870, 4600, 4895], 'Markatos': [872, 4602, 4897], 'Yamamoto': [874, 928, 4604, 4899], 'Tanaka': [876, 4606, 4901], 'Ciliberto': [878, 4608, 4903], 'Rodan': [880, 4610, 4905], 'G.A.': [881, 4611, 4906], 'Costantini': [882, 4612, 4907], 'F.': [883, 4613, 4908, 5145], 'EMBO': [884, 2263, 4614, 4909, 5150], '1994;': [886, 1273, 1955, 4616, 4911, 5594], '1189-1196Crossref': [888, 4618, 4913], '(659)': [891, 4621, 4916], 'Scholar),': [893, 1054, 1239, 3975, 4760, 5118, 5244, 5553, 5796], 'enhance': [896, 4931], '(14Hofbauer': [905], 'L.C.': [906, 1037], 'Spelsberg': [911, 1044, 4416], 'T.C.': [912, 1045, 4417], 'Riggs': [913, 1046, 4414], 'B.L.': [914, 1047, 4415, 4943], 'Khosla': [915, 1038], 'Bone.': [917], '25:': [919], '255-259Crossref': [920], '(542)': [923], '15Taguchi': [926], 'Yamate': [930], 'Lin': [932, 2189, 2541], 'Mocharla': [934], 'DeTogni': [936], 'Nakayama': [938], 'Boyce': [940, 4452], 'B.F.': [941, 4453], 'Abe': [942], 'Manolagas': [944], 'Assoc.': [947], 'Am.': [948], 'Physicians.': [949], '110:': [951], '559-574PubMed': [952], '16Kimble': [955], 'R.B.': [956, 986, 1945, 4647, 4677], 'Srivastava': [957, 4648], 'Ross': [959, 993, 1223, 2087, 2656, 2812, 4650, 4684, 5856], 'F.P.': [960, 994, 1224, 2088, 2657, 2813, 4651, 4685, 5857], 'Matayoshi': [961, 4652], 'Pacifici': [963, 995, 1227, 1950, 2091, 2660, 2816, 4654, 4686, 4707, 5001, 5860], 'Biol.': [966, 3691, 3863, 3961, 4657, 5199, 5236], 'Chem.': [967, 3962, 4658], '271:': [969, 4660], '28890-28897Abstract': [970, 4661], '(241)': [978, 4669], '17Srivastava': [981, 4672], 'Weitzmann': [983, 1219, 2083, 2652, 2808, 4674, 4701, 4993, 5852], 'M.N.': [984, 1220, 2084, 2653, 2809, 4675, 4702, 4994, 5853], 'Kimble': [985, 1944, 4676], 'Rizzo': [987, 4678], 'Zahner': [989, 4680], 'Milbrandt': [991, 4682], '102:': [1001, 4692], '1850-1859Crossref': [1002, 4693], '(168)': [1005, 4696], 'Additional': [1008], 'serve': [1011], 'explain': [1013], 'antiosteoclastogenic': [1015, 1113], 'effects': [1016, 2999, 3226, 3703, 4005, 4101, 4136, 4321, 4988, 5714, 5722, 5880], 'include': [1019], 'ability': [1021, 1931, 3015, 3062, 3663, 3980, 4141, 4188, 4289, 4499, 5561, 5898], 'sex': [1023, 1117, 3243], 'steroids': [1024, 1118, 3244], 'stimulate': [1026], 'osteoprotegerin': [1030], '(OPG),': [1031], 'decoy': [1033], '(18Hofbauer': [1036], '140:': [1050, 1093], '4367-4370Crossref': [1051], 'direct': [1057, 2998], 'repressive': [1058, 5713, 5879], 'effect': [1059, 1114, 3178, 3248, 3255, 3490, 3597, 3752, 3880, 4626], 'membrane-bound': [1064], '(19Sarma': [1066], 'Edwards': [1068], 'Motoyoshi': [1070], 'Flanagan': [1072, 1089], 'A.M.': [1073, 1090], 'Physiol.': [1076], '175:': [1078], '99-108Crossref': [1079], '(52)': [1082], '20Lea': [1085], 'C.K.': [1086], 'Sarma': [1087], '273-279Crossref': [1094], '(34)': [1097], 'Despite': [1100], 'relevance': [1102, 4763, 5368], 'an': [1106, 1305, 2464, 2599, 3272, 3399, 3530, 3613, 3709, 3769, 4641], 'potent': [1112], 'E2,': [1116], 'have': [1119, 1205, 1242, 3245, 3546, 4723, 5555, 5801], 'not': [1120, 1351, 3566, 3977, 4804, 4821, 5624, 5821, 5845], 'been': [1121], 'reported': [1122, 1207], 'such': [1132], 'regulation': [1133, 4436], 'consistent': [1135, 4922], 'with': [1136, 1450, 1465, 1506, 1517, 1650, 1997, 2027, 2043, 2065, 2109, 2127, 2181, 2306, 2321, 2422, 2491, 2500, 2625, 2632, 2698, 2714, 2864, 3104, 3367, 3388, 3421, 3466, 3469, 3480, 3529, 3589, 4070, 4076, 4162, 4923, 5520, 5524, 5736], 'absence': [1138, 2880, 3108], 'estrogen-responsive': [1141], 'elements': [1142], 'sequences': [1145], 'for': [1146, 1508, 1527, 1737, 1920, 1965, 2059, 2069, 2139, 2175, 2327, 2360, 2424, 2449, 2493, 2589, 2629, 2719, 2734, 2752, 2775, 2791, 3060, 3275, 3373, 3390, 3712, 4028, 5298], 'E2-regulated': [1147], 'factors': [1149, 1254, 1342, 4439, 5304, 5339, 5575], 'promoter': [1153, 4111, 5177, 5320], '(21Kitazawa': [1154], 'Kitazawa': [1156], 'Maeda': [1158], 'Biochim.': [1160, 3850, 5134, 5183, 5220, 5286, 5325, 5359], 'Biophys.': [1161, 3851, 5135, 5184, 5221, 5287, 5326, 5360], 'Acta.': [1162, 3852, 5136, 5185, 5222, 5288, 5327, 5361], '1445:': [1164], '134-141Crossref': [1165], '(135)': [1168], 'Binding': [1171, 5014], 'its': [1175, 3177, 3682, 4209, 4631, 5176, 5829], 'signaling': [1176, 3283, 3801, 5372, 5676], 'RANK': [1178, 3292, 5018, 5688], '(JNK),': [1187], 'protein': [1190, 2113, 2150, 2247, 2309, 4121, 5039], 'increases': [1193, 3446, 3725, 4270, 5122], 'transactivation': [1195], 'AP-1': [1201, 1253, 2643, 4106, 4169, 4185, 4193, 4207, 4233, 4244, 5171], 'factors.': [1203], 'recently': [1206], 'TNF-induced': [1211, 5847], 'JNK': [1212, 1333, 2072, 2276, 2285, 2298, 3297, 3360, 3408, 3425, 3447, 3462, 3495, 3513, 3634, 3819, 3825, 3992, 5041, 5294, 5347, 5639], '(22Srivastava': [1217, 2081, 2650, 2806, 5850], 'Cenci': [1221, 2085, 2654, 2810, 5854], 'Adler': [1225, 2089, 2658, 2814, 5858], '104:': [1233, 2097, 2666, 2822, 5866], '503-513Crossref': [1234, 2098, 2667, 2823, 5867], '(223)': [1237, 2101, 2670, 2826, 5870], 'others': [1241], 'shown': [1243], 'impaired': [1248, 5489], 'c-Jun': [1257, 2186, 2307, 2364, 4041, 4061, 5166, 5281, 5495, 5576, 5915], '(23Grigoriadis': [1258, 5579], 'A.E.': [1259, 5452, 5580], 'Z.Q.': [1261, 5448, 5582], 'Hofstetter': [1264, 5585], 'Felix': [1266, 5587], 'Fleisch': [1268, 5589], 'H.A.': [1269, 5590], 'Wagner': [1270, 1283, 5457, 5505, 5591, 5604], 'E.F.': [1271, 1284, 5458, 5506, 5592, 5605], 'Science.': [1272, 5593], '266:': [1274, 5595], '443-448Crossref': [1275, 5596], '(1061)': [1278, 5599], '24David': [1281, 5602], '14': [1290, 5512, 5611], 'Suppl.': [1291, 5513, 5612], '(abstr.):': [1293, 5515, 5614], 'S149Google': [1294, 5516, 5615], 'These': [1296, 2015, 3439, 4280, 4919, 5208], 'data': [1297, 3812, 5522], 'prompted': [1298], 'us': [1299], 'investigate': [1301, 2994, 3356], 'additional': [1306], 'maturing': [1320, 1367, 3001], 'Here': [1324], 'we': [1325, 3074, 3086, 4002, 5554, 5618, 5800, 5839], 'show': [1326], 'leading': [1334, 3822, 5908], 'c-Jun.': [1345, 5648], 'only': [1352], 'modulating': [1354, 3083], 'but': [1360, 3565], 'affecting': [1363], 'sensitivity': [1365], 'All': [1371, 1433], 'animal': [1372], 'procedures': [1373], 'were': [1374, 1392, 1404, 1428, 1435, 1463, 1512, 1642, 1915, 2017, 2032, 2041, 2107, 2146, 2155, 2234, 2312, 2358, 2405, 2431, 2444, 2474, 2497, 2560, 2581, 2610, 2687, 2744, 2832, 2850, 3205, 3229, 3365, 3395, 3417, 4064, 4160], 'approved': [1375], 'Animal': [1378], 'Care': [1379], 'Use': [1381], 'Committee': [1382], 'Barnes-Jewish': [1384], 'Hospital.': [1385], 'Unless': [1386], 'otherwise': [1387], 'specified,': [1388], 'reagents': [1389], 'media': [1391, 1440], 'purchased': [1393], 'from': [1394, 1406, 1430, 2411, 2480, 2617, 4153, 4173, 4218, 4497], 'Sigma.': [1395], '(BMM),': [1399], 'defined': [1400, 2033, 3035], 'CD11b+': [1402], 'purified': [1405, 4815], '5-week-old': [1411], 'positive': [1414], 'immunoselection': [1415], 'using': [1416, 2149, 2283, 2374, 2407, 2446, 2463, 2476, 2583, 2598, 2788, 3398, 3708, 3768, 4019], 'MACS': [1417], 'CD11b': [1418], 'immunomagnetic': [1419], 'beads': [1420, 2154], '(Milteny': [1421], 'Biotec,': [1422], 'Auburn,': [1423], 'CA).': [1424], 'obtained': [1429], 'ATCC.': [1432], 'maintained': [1436], 'phenol': [1438], 'red-free': [1439], '10%': [1442, 2518], 'charcoal-stripped': [1443], 'serum': [1444, 5314], 'cultured': [1445], 'α-MEM': [1447], 'treated': [1449, 1464, 2042, 3103, 3366, 3468, 3588, 4069, 4075], '(10−8m)': [1453, 1472, 3010], 'control': [1455, 1496, 2412, 2481, 2618, 3371, 4077, 4154], 'vehicle.': [1456, 3473, 3590, 4078], 'For': [1457, 2273, 2758], 'some': [1458, 2274], 'experiments,': [1459], 'raloxifene': [1466, 2055, 3204], '(10−7m),': [1467, 1469, 2056], '4-hydroxytamoxifene': [1468], 'plus': [1473, 2595, 3471], 'ICI': [1474, 2046, 3235, 3503], '182780': [1475, 2047, 3236, 3504], '(10−6m).': [1476], 'In': [1477, 3607, 3762, 4720, 5518, 5889], 'other': [1478], 'experiments': [1479, 3006, 3169, 4281], 'MEK1/ERK': [1481, 3844, 3910], 'pathway': [1482, 3802, 3845, 3911, 5373], 'inhibitor': [1483], 'PD': [1484, 3917], '98059': [1485], '(New': [1486, 2585], 'England': [1487, 2586], 'Biolabs,': [1488], 'Beverly,': [1489, 2291], 'MA)': [1490], 'was': [1491, 1970, 2074, 2118, 2248, 2278, 2299, 2335, 2696, 2712, 2767, 2786, 3431, 3483, 3497, 3579, 3912, 4182, 4246], 'added': [1492, 2768, 4813], '(50': [1493, 2429, 2511], 'μm)': [1494], 'E2-treated': [1498, 2414, 2483, 2620, 3583, 4156], 'h': [1503, 2061, 2141, 2631, 2736], 'before': [1504, 2778], '30': [1509, 2179, 2328, 2331, 2425, 2494, 2720, 4049], 'min.': [1510, 2071, 2426, 2495, 3392, 3453, 3487, 4050], 'generated': [1513, 1644, 4176], 'culturing': [1515, 1646], 'BMM': [1516, 2875, 3029, 3070, 3216, 5812], 'recombinant': [1518, 2185, 3018, 3422], 'soluble': [1519, 3017, 4638], '(20': [1521, 1652, 2627], 'ng/ml)': [1522, 1526, 1653, 2068, 2628], '(10': [1525], '7': [1528], 'days': [1529], 'described': [1531, 1657, 1941, 1973, 2080, 2253, 2293, 2538, 2648, 2805], 'without': [1654], '(25Hsu': [1658, 3111, 3298, 5042, 5740], 'Solovyev': [1664, 1857, 3117, 3304, 5048, 5746], 'L.': [1679, 1685, 1872, 1878, 3132, 3138, 3319, 3325, 3928, 5063, 5069, 5761, 5767], 'Xia': [1680, 1873, 3133, 3320, 5064, 5762], 'X.Z.': [1681, 1874, 3134, 3321, 5065, 5763], 'Chiu': [1684, 1877, 3137, 3324, 5068, 5766], 'Black': [1686, 1879, 3139, 3326, 5070, 5768], 'Shimamoto': [1694, 1887, 3147, 3334, 5078, 5776], 'Bass': [1696, 1889, 3149, 3336, 5080, 5778], 'M.B.': [1697, 1890, 2212, 3150, 3337, 5081, 5779], '96:': [1708, 1901, 3161, 3348, 4480, 5092, 5790], '3540-3545Crossref': [1709, 1902, 3162, 3349, 5093, 5791], '(1414)': [1712, 1905, 3165, 3352, 5096, 5794], 'Both': [1715], 'culture': [1716, 4788], 'systems': [1717, 4789], 'generate': [1718, 5246], 'large': [1719], 'numbers': [1720], 'TRAP+': [1722, 2025], 'multinucleated': [1723, 3044], 'express': [1726], 'typical': [1727], 'markers': [1729], 'including': [1730, 5026], 'calcitonin': [1731, 1927, 2007, 3038], 'vitronectin': [1733], 'receptors': [1734, 1928], 'positivity': [1736], 'pp60c-src': [1738, 1966, 2011], 'cathepsin': [1740, 1968, 2013, 3042], 'K': [1741, 1969], '25Hsu': [1851], 'At': [1908, 3454], 'end': [1910], 'each': [1912], 'experiment,': [1913, 2275], 'then': [1916, 2063, 2119, 2147, 2505, 3386, 3396], 'fixed': [1917], 'stained': [1919], '(TRAP).': [1924], 'Expression': [1925], 'form': [1933, 3716], 'resorption': [1934, 2021], 'pits': [1935], 'vitrowere': [1937], 'assessed': [1938], 'previously': [1940, 2254, 2649], '(26Kitazawa': [1942], 'Vannice': [1946], 'J.L.': [1947], 'Kung': [1948], 'V.T.': [1949], '94:': [1956, 2225], '2397-2406Crossref': [1957], '(283)': [1960], 'Immunohistochemical': [1963], 'staining': [1964], 'conducted': [1971, 2475, 3767, 4018], '(27Harlow': [1974], 'Lane': [1976], 'D.': [1977, 5000], 'Antibodies:': [1978], 'A': [1979, 3281, 4305], 'Laboratory': [1980], 'Manual.': [1981], 'Cold': [1982, 1986], 'Spring': [1983, 1987], 'Harbor': [1984], 'Laboratories,': [1985], 'Harbor,': [1988], 'NY1988Google': [1989], 'More': [1991], 'than': [1992, 3585, 4072], '98%': [1993], 'TRAP+cells': [1996], 'three': [1998, 2028], 'more': [2000, 2030], 'nuclei': [2001, 2031], 'showed': [2002, 3542], 'specific': [2003, 2448, 2588, 2790, 3711, 4027, 4222, 5830], 'labeled': [2006, 4164], 'capable': [2018, 3046, 4805], 'forming': [2020], 'pitsin': [2022], 'vitro.': [2023, 3050], 'Therefore,': [2024], 'counted': [2035], 'OC.': [2037, 3072, 3222], '(10−8m),': [2045], '(10−6m),': [2048], '+': [2050], 'ICI,': [2051], '4-hydro-tamoxifen': [2052], '(10−7m)': [2053], 'vehicle': [2058, 3372], '24': [2060, 3374], 'stimulated': [2064, 2421, 2490, 2624, 3387], '(200': [2067], '5–30': [2070], 'determined': [2075, 2279], 'extracts': [2078, 2106, 2282, 2615, 3394, 3528, 4023, 4152], 'Briefly,': [2104, 2297], 'precleared': [2108], '10–15': [2110], 'μl': [2111, 2160, 2316], 'A-Sepharose': [2114, 2151], 'beads.': [2115, 2152, 2310], 'resin': [2117], 'removed': [2120], 'centrifugation': [2122], 'supernatant': [2125], 'incubated': [2126, 2174, 2326, 2713, 3420, 4161], 'μg': [2129, 2183], 'anti-JNK': [2131], 'antibody': [2132, 2766, 3400, 3531, 3614, 3710, 3770, 4224, 4251], '(Santa': [2133, 2460, 2801], 'Cruz': [2134, 2461, 2802], 'Biotechnology,': [2135], 'Santa': [2136], 'Cruz,': [2137], 'CA)': [2138], '4': [2140], 'ice.': [2143], 'immunocomplexes': [2145], 'precipitated': [2148, 2300], 'washed,': [2156], 'resuspended': [2157, 2313], '25': [2159, 2176], 'buffer': [2163, 2319, 2510], 'containing': [2164, 4790], '50': [2165, 2315], 'μm': [2166, 2323], 'ATP': [2167, 2324], '5': [2169], 'μCi': [2170], '[γ-32P]ATP,': [2172], 'min': [2177, 2329, 2721, 2777], 'at': [2178, 2330, 3451, 3485, 3573, 4048, 5708], '°C': [2180], '(28Hibi': [2187, 2539], 'Smeal': [2191, 2543], 'Minden': [2193, 2545], 'Karin': [2195, 2547, 3848, 5132, 5148, 5181, 5218, 5284, 5323, 5357], 'Genes': [2197, 2549, 5434], 'Dev.': [2198, 2550, 5435], '7:': [2200, 2552], '2135-2148Crossref': [2201, 2553], '(1708)': [2204, 2556], '29Chan': [2207], 'E.D.': [2208], 'Winston': [2209], 'B.W.': [2210], 'Jarpe': [2211], 'Wynes': [2213], 'M.W.': [2214], 'Riches': [2215], 'D.W.': [2216, 4947], '13169-13174Crossref': [2226], '(80)': [2229], 'reactions': [2233], 'boiled': [2235, 2336, 2561], 'Laemmli': [2237, 2563], 'loading': [2238, 2564], 'dye': [2239], 'resolved': [2241, 2341, 2432, 2566, 3432], '12%': [2243, 2434, 2568], 'SDS-PAGE.': [2244], 'Phosphorylated': [2245, 3429], 'c-Jun-GST': [2246], 'detected': [2249, 2445, 2582], 'autoradiography': [2251], '(30Reinhard': [2255], 'Shamoon': [2257], 'B.': [2258], 'Shyamala': [2259], 'Williams': [2261], 'L.T.': [2262], '16:': [2266], '1080-1092Crossref': [2267], '(252)': [2270], 'assay': [2286], 'kit': [2287], '(Cell': [2288, 2376], 'Signaling': [2289, 2377], 'Technology,': [2290], 'MA)as': [2292], 'manufacturer.': [2296], 'incubating': [2302, 2613], 'extract': [2304, 2716], 'overnight': [2305], 'fusion': [2308], 'Beads': [2311], 'supplemented': [2320], '100': [2322], '°C.': [2332], 'reaction': [2334, 2373, 2771], 'SDS': [2338], 'sample': [2339], 'buffer,': [2340], '4–20%': [2344], 'Tris-glycine': [2345], 'gel,': [2346], 'electrotransferred': [2348], 'nitrocellulose': [2350], 'membrane.': [2351], 'appropriate': [2353, 2754, 2765, 3273], 'primary': [2354, 3027, 3180], 'secondary': [2356], 'antibodies': [2357, 2447, 2584, 2674, 2789, 4026, 4239, 4255], 'used': [2359, 2688], 'detection': [2361, 2466, 2601], 'phosphorylated': [2363, 2384, 2442, 2456, 2579, 2590, 3535, 3577, 3602, 3621, 3714, 3731, 3757, 3779, 5500], 'membrane': [2367], 'followed': [2368], 'standard': [2371], 'chemiluminescence': [2372], 'LumiGLO': [2375], 'Technology).': [2378], 'dephosphorylated': [2382, 3618, 3775], 'species': [2385, 3622, 3635, 3780], 'JNK2': [2389, 2402, 2454, 2459, 3541, 3568, 3626, 3651], '(total': [2390, 3627], 'JNK1/2)': [2391, 2404, 3628], 'those': [2393, 4068, 4074], 'active': [2396, 3550, 3556, 3563], '(phosphorylated)': [2397], 'forms': [2398, 3537], '(active': [2403], 'measured': [2406], 'whole': [2408, 2477], 'lysates': [2410, 2428, 2479], 'unstimulated': [2419, 2488, 3544, 3605, 3637, 3760], 'Cell': [2427, 3690], 'μg)': [2430], 'SDS-PAGE': [2435], 'transblotted': [2437, 2571], 'onto': [2438, 2572], 'nitrocellulose.': [2439, 2573], 'Total': [2440], 'JNK1/2': [2443], 'total': [2451, 2577, 2593, 3648, 3791], 'Biotechnology)': [2462, 2803], 'ECL': [2465, 2600], 'system': [2467, 2602], '(Amersham': [2468, 2603], 'Pharmacia': [2469, 2604], 'Biotech).': [2470, 2605], 'Western': [2471, 2783, 3521, 3609, 3764, 4015], 'blot': [2472, 2784, 3522, 3610, 3765, 4016], 'studies': [2473, 3440, 3766, 4017, 4722, 5799, 5838], 'Cells': [2496], 'washed': [2498], 'twice': [2499], 'ice-cold': [2501, 2508], 'phosphate-buffered': [2502], 'saline': [2503], 'lysed': [2506], 'lysis': [2509], 'mm': [2512, 2516, 2525, 2531], 'Tris-HCl,': [2513], 'pH.8,': [2514], '137': [2515], 'NaCl,': [2517], 'glycerol,': [2519], '1%': [2520], 'Nonidet': [2521], 'P-40': [2522], '(v/v),': [2523], 'NaF,': [2526], '10': [2527], 'μg/ml': [2528], 'leupeptin,': [2529], '2': [2530, 3506, 3570, 3653], 'Na3VO4,': [2532], 'mmphenylmethylsulfonyl': [2535], 'fluoride)': [2536], 'Proteins': [2559], 'dye,': [2565], 'SDS-PAGE,': [2569], 'MKK4': [2580, 2597, 3672, 3707, 3732, 3742, 3758, 3782, 3794, 3806, 3817, 3827, 5566, 5628, 5658], 'Biolabs)': [2587], '(active)': [2591, 3536, 3715], '(dephosphorylated': [2594], 'phosphorylated)': [2596], 'Electrophoretic': [2606], 'mobility': [2607], 'shift': [2608], 'assays': [2609], 'performed': [2611, 2787, 2851], 'prepared': [2616], 'a32P-labeled': [2633], 'double-stranded': [2634], 'probe': [2635, 2695, 2711], '(5′': [2636], 'AAAGCAGCAGCCTGAGCTCATGATCA': [2637], '3′)': [2638], 'synthesized': [2639], 'represent': [2641, 3271], 'sequence': [2645, 5832], '(underlined)': [2646], 'Monoclonal': [2673], 'directed': [2675], 'against': [2676, 4256], 'members': [2677, 3405], 'Fos': [2682, 4035, 4097, 4145], 'families': [2683, 4036], 'proteins': [2686, 3416, 4146, 5921], 'supershift': [2690], 'relevant': [2692, 4625], 'proteins.': [2693, 4014], 'end-labeled': [2697], 'T4': [2699], 'polynucleotide': [2700], 'according': [2702], "manufacturer's": [2704], 'instructions': [2705], '(Promega,': [2706], 'Madison,': [2707], 'WI).': [2708], 'annealed': [2710], 'ice': [2718, 2774], 'prior': [2722], 'separation': [2724], 'DNA-protein': [2727, 4179], 'complexes': [2728], '4%': [2730], 'nondenaturing': [2731], 'PAGE,': [2732], 'pre-run': [2733], '0.25×': [2738], 'TBE': [2739], 'running': [2740], 'buffer.': [2741], 'gels': [2743], 'dried': [2745], 'exposed': [2747], 'Kodak': [2749], 'XAR-5': [2750], 'film': [2751], 'length': [2755, 3377], 'time.': [2757], 'band': [2759], 'supershifting,': [2760], '200': [2761], 'ng': [2762], 'mixture': [2772], '40': [2776], 'adding': [2779], 'oligonucleotide': [2781, 4165, 4195], 'probe.': [2782], 'analysis': [2785, 2841, 3523, 3611], 'JunD,': [2794, 4088], 'JunB,': [2795, 4087], 'c-Fos,': [2796], 'FosB,': [2797, 4089], 'Fra-1,': [2798, 4090, 4258], 'Fra-2': [2800, 4092, 4260], 'Group': [2829], 'mean': [2830, 2847], 'values': [2831], 'compared': [2833, 3465, 3479], 'two-tailed': [2835], "Student's": [2836], 't': [2837], 'test': [2838], 'one-way': [2840], 'variance': [2843], 'appropriate.': [2845], 'Subsequent': [2846], 'comparison': [2848], 'tests': [2849], 'Fisher': [2854], 'protected': [2855], 'least': [2856, 5709], 'significant': [2857], 'difference': [2858], 'test.': [2859], 'discovery': [2861], 'sufficient': [2869, 3262, 3380], 'induce': [2871, 3023, 3382, 3667, 4778, 5902], 'has': [2989, 2997], 'made': [2990], 'possible': [2992], 'whether': [2995, 3357], 'hematopoietic': [3002], 'precursors.': [3004, 3251, 4817], 'Triplicate': [3005], 'revealed': [3007, 3173, 3441, 3629, 3720, 3783, 4037, 4283, 4725], '∼40%': [3013, 3185], '(Fig.1': [3033], 'A),': [3034], 'TRAP,': [3037], 'receptor,': [3039], 'pp60c-src,': [3040], 'K+': [3043], 'resorbing': [3048], 'bonein': [3049], 'Inhibition': [3051], 'M-CSF-': [3054], 'RANKL-induced': [3056, 3084, 3212, 3259, 3461, 3512, 3991, 5726, 5824], 'signals': [3057, 3260], 'could': [3058, 3885, 5701], 'account': [3059], 'blunt': [3066], 'wished': [3075], 'examine': [3077], 'role': [3079], 'signals,': [3085], 'utilized': [3087], 'property': [3089], 'differentiate': [3099], 'when': [3102, 4812], 'Quadruple': [3168], '(Fig.': [3170, 3505, 3569, 3652, 3795, 4051, 4212, 4303], 'B)': [3172], 'that,': [3174], 'similar': [3175, 3518], 'BMM,': [3181], 'selective': [3198], 'modulators': [3201], '4-hydroxytamoxifen': [3202], 'effective': [3207], 'suppressing': [3211], 'Raw': [3218], 'inhibitory': [3225, 3254, 3475, 3489, 3596, 3751], 'reversed': [3230, 3498], 'antagonist': [3234, 3502], '(3': [3237], '1),': [3238], 'finding': [3240], 'suggests': [3242], 'genomic': [3247, 3383], 'block': [3264, 4503, 4634, 4729], 'formation,': [3266, 4333], 'model': [3274], 'dissecting': [3276], 'molecular': [3278], 'involved.': [3280], 'event': [3284], 'To': [3355, 4133], 'activity,': [3361, 3463], 'h,': [3375], 'time': [3379, 3456, 3575], 'effects,': [3384], '0–30': [3391], 'Nuclear': [3393], 'immunoprecipitated': [3397], 'recognizes': [3402, 3533, 3772], 'family,': [3409], 'JNK2.': [3412, 3557], 'Equal': [3413], 'amounts': [3414], 'recovered': [3418], 'GST-c-Jun': [3423], '(a': [3424], 'substrate)': [3426], '[γ-32P]ATP.': [3428], 'material': [3430], 'SDS-gel': [3434], 'visualized': [3436], 'autoradiography.': [3438], '(Fig.2': [3442], 'A)': [3443, 3722], '10-fold,': [3449], 'peaking': [3450, 4047], '15': [3452, 3486], 'all': [3455, 3574, 4174], 'points': [3457, 3576], 'treatment': [3459], 'blunted': [3460, 3888], 'Peak': [3474], '(5-fold': [3477], 'vehicle-treated': [3481], 'controls)': [3482], 'peak': [3494], 'B).': [3507, 3797, 4307], 'Raloxifene': [3508], 'tamoxifen': [3510], 'blocked': [3511], 'manner': [3517], 'E2.': [3520], 'low': [3547], 'undetectable': [3553], 'C).': [3571], 'However,': [3572, 3639, 5253, 5617, 5733], '∼50%': [3580, 3738], 'had': [3593, 3748, 4240, 4261], 'small': [3595, 3750], 'cells.': [3606, 3638, 3761], 'contrast,': [3608, 3763], 'recognizing': [3615], 'neither': [3640, 3785], 'nor': [3642, 3787, 4081], 'altered': [3644], 'level': [3646, 3729], 'D).': [3654], 'Together,': [3655, 4264], 'findings': [3657, 4266, 5622, 5892], 'demonstrate': [3658, 3813, 4267, 5626, 5893], 'represses': [3661, 5693, 5896], 'JNK1.': [3671], 'activate': [3678, 5565], 'inducing': [3681, 4807], 'phosphorylation': [3683, 3839, 4131, 5270, 5300, 5335], '(32Ip': [3684], 'Y.T.': [3685], 'Davis': [3686], 'R.J.': [3687], 'Curr.': [3688, 3862], 'Opin.': [3689], '10:': [3693], '205-219Crossref': [3694], '(1377)': [3697], 'Analysis': [3700], 'this': [3718, 4765], '(Fig.3': [3721], '∼3-fold': [3727, 4065, 4203], '(inactive)': [3776], 'modulates': [3789, 4363], '3': [3796], 'although': [3799, 4761, 5664], 'linking': [3803], 'remains': [3807, 4769, 5660], 'be': [3809, 4771, 5499, 5662, 5702, 5731], 'determined,': [3810, 5663], 'blunts': [3816, 3901], 'activation,': [3820], 'thus': [3821, 5907], 'diminished': [3824], 'activity.': [3826], 'activated': [3829], 'MEKK1,': [3831], 'leads': [3836], 'ELK-1': [3841], 'through': [3842], '(33Minden': [3846, 5130, 5179, 5216, 5282, 5321, 5355], '1333:': [3854, 5138, 5187, 5224, 5290, 5329, 5363], 'F85-F104PubMed': [3855, 5139, 5188, 5225, 5291, 5330, 5364], '34Karin': [3858], 'Hunter': [3860], '5:': [3865], '747-757Abstract': [3866], '(662)': [3874], 'regulatory': [3879, 5721], 'MEKK1': [3884], 'lead': [3886], 'ERK': [3889], 'ERK-induced': [3893], 'c-Fos.': [3896], 'via': [3906, 4317, 4435, 4640], 'excluded': [3913], 'demonstrating': [3915], '98059,': [3918], 'compound': [3920], 'blocks': [3922, 4287, 5930], 'MEK1': [3923], '(35Dudley': [3925], 'D.T.': [3926, 3957], 'Pang': [3927], 'Decker': [3929], 'S.J.': [3930, 4469], 'Bridges': [3931], 'Saltiel': [3933, 3958], 'A.R.': [3934, 3959], '92:': [3943], '7686-7689Crossref': [3944], '(2586)': [3947], '36Alessi': [3950], 'D.R.': [3951, 5196, 5233], 'Cuenda': [3952], 'Cohen': [3954, 5195, 5232], 'Dudley': [3956], '270:': [3964], '27489-27494Abstract': [3965], '(3249)': [3973], 'does': [3976, 5820, 5844], 'abolish': [3978], 'decrease': [3984, 5822], '(Fig.4).': [3989], 'enhanced': [3996, 5267], 'Fos,': [4001], 'examined': [4003], 'monoclonal': [4025], 'individual': [4029], 'member': [4030], 'increased': [4040, 4201, 4334, 5351], 'production,': [4046], '5).': [4052], 'RANKL-stimulated': [4055], 'Neither': [4079], 'affected': [4083], '(not': [4093, 5833], 'shown).': [4094, 5834], 'exert': [4098], 'their': [4099, 4127], 'consensus': [4107, 4170, 4194, 5831], 'sequence(s)': [4108], 'region': [4112], 'genes.': [4115], 'DNA': [4123, 4274, 4302], 'proportional': [4125], 'concentration': [4129], 'status.': [4132], 'determine': [4134], 'bind': [4148], 'DNA,': [4150], 'corresponding': [4166], 'sequence.': [4171], 'Samples': [4172], 'single': [4178], 'complex,': [4180], 'confirmed': [4183], '50-fold': [4190], 'molar': [4191], 'excess': [4192], 'displace': [4197], 'complex.': [4199], 'motif': [4211], '6': [4213], 'A).': [4214], 'samples': [4217], 'RANKL-treated': [4219], 'anti-c-Jun': [4223], 'led': [4225], 'almost': [4228], 'complete': [4229], 'disappearance': [4230], 'band,': [4234], 'whereas': [4235, 4254], 'anti-JunD': [4236], 'anti-JunB': [4238], 'no': [4241, 4262], 'effects.': [4242], 'complex': [4245, 4320, 4787, 5303, 5338], 'supershifted': [4248], 'anti-c-Fos': [4250], '(Fig.5': [4252], 'B),': [4253], 'Fos-B,': [4257], 'effect.': [4263], 'c-Jun/c-Fos': [4276, 4297], 'JunD/c-Fos': [4278, 4299], 'heterodimers.': [4279], 'increase': [4293], 'heterodimers': [4300, 5215, 5265], '6,': [4304], 'multiple': [4318], 'apoptosis,': [4336], 'capacity': [4339, 4632, 4828], 'resorb': [4344], 'apoptosis': [4365], 'directly': [4370, 4728], '(37Kameda': [4371], 'Mano': [4373], 'Yuasa': [4375], 'Mori': [4377], 'Miyazawa': [4379], 'Shiokawa': [4381], 'Nakamaru': [4383], 'Hiroi': [4385], 'Hiura': [4387], 'Kameda': [4389], 'Yang': [4391], 'N.N.': [4392], 'Hakeda': [4393], 'Kumegawa': [4395], 'Exp.': [4398], '186:': [4401], '489-495Crossref': [4402], '(375)': [4405], '38Oursler': [4408], 'Osdoby': [4410], 'Pyfferoen': [4412], '1991;': [4425, 4975], '88:': [4426], '6613-6617Crossref': [4427], '(321)': [4430], 'indirectly': [4434], 'growth': [4438], 'prostaglandins': [4441], '(39Hughes': [4442], 'D.E.': [4443], 'Dai': [4444], 'Tiffee': [4446], 'J.C.': [4447], 'Li': [4448], 'H.H.': [4449], 'Nat.': [4454], '2:': [4457], '1132-1136Crossref': [4458], '(696)': [4461], '40Kawaguchi': [4464], 'Vargas': [4468], 'Morse': [4470], 'E.E.': [4471], 'Lorenzo': [4472], 'Raisz': [4474], 'L.G.': [4475], '539-548Crossref': [4481], '(115)': [4484], 'Conversely,': [4487], 'vivo': [4493, 4768, 4784], 'results,': [4494], 'part,': [4496, 5711], 'pro-osteoclastogenic': [4508], 'Another': [4624], 'vivois': [4630], 'IL-1-': [4642], 'TNF-dependent': [4644], '(16Kimble': [4646], '41Cenci': [4699], 'Gentile': [4703], 'M.A.': [4704, 4962, 5387], 'Aisa': [4705], 'M.C.': [4706], '2000;': [4712, 4753, 5006, 5546], '105:': [4713], '1279-1287Crossref': [4714], '(84)': [4717], 'vitro': [4721], '(42Shevde': [4738, 5531], 'N.K.': [4739, 5532], 'Bendixen': [4740, 5533], 'A.C.': [4741, 5534], 'Dienger': [4742, 5535], 'K.M.': [4743, 5536], 'Pike': [4744, 5537], 'J.W.': [4745, 5538], '97:': [4754, 5547], '7829-7834Crossref': [4755, 5548], '(405)': [4758, 5551], 'phenomenon': [4766], 'determined.': [4772], 'Although': [4773], 'osteoblasts,': [4793], 'precursors,': [4796], '(alone': [4799], 'combination)': [4802], 'are': [4803, 4921, 5210, 5309, 5885], 'osteopetrosis': [4819, 5380], 'feature': [4823, 5383], 'produce': [4830], 'and/or': [4831], 'respond': [4832], '(11Lorenzo': [4839], 'observations': [4920, 5526], 'notions': [4925], 'increasing': [4935], '(43Sherman': [4940], 'M.L.': [4941], 'Weber': [4942], 'Datta': [4944], 'Kufe': [4946], '85:': [4952], '442-447Crossref': [4953], '(68)': [4956], '44Falkenburg': [4959], 'J.H.': [4960], 'Harrington': [4961], 'de': [4963], 'Paus': [4964], 'R.A.': [4965], 'Walsh': [4966], 'W.K.': [4967], 'Daub': [4968], 'Landegent': [4970], 'J.E.': [4971], 'Broxmeyer': [4972], 'H.E.': [4973], 'Blood.': [4974], '78:': [4976], '658-665Crossref': [4977], 'potentiating': [4985], '(45Cenci': [4991], 'Roggia': [4995], 'Namba': [4997], 'Novack': [4999], '106:': [5007], '1229-1237Crossref': [5008], '(546)': [5011], 'cascade': [5022], 'intracellular': [5024], 'events,': [5025], '46Suda': [5099], 'Jimi': [5105], 'Gillespie': [5107], 'M.T.': [5108], '20:': [5114], '345-357Crossref': [5115], 'which,': [5119], 'turn,': [5121], 'c-jun': [5126, 5261], 'c-fos': [5128, 5345, 5352], 'genes': [5129], '47Cavigelli': [5142], 'Dolfi': [5144], 'Claret': [5146], 'F.X.': [5147], '14:': [5153], '5957-5964Crossref': [5154], '(487)': [5157], 'This': [5160], 'because': [5162], 'regulated': [5168], 'sites': [5173, 5209], 'present': [5174], 'regions': [5178], '48Foletta': [5191, 5228], 'V.C.': [5192, 5229], 'Segal': [5193, 5230], 'D.H.': [5194, 5231], 'Leukocyte': [5198, 5235], '63:': [5201, 5238], '139-152Crossref': [5202, 5239], '(309)': [5205, 5242], 'constitutively': [5211, 5310], 'occupied': [5212], 'Jun/ATF2': [5214, 5264], 'basal': [5248], 'rate': [5249], 'gene': [5251, 5262, 5353], 'autostimulation.': [5252], 'magnitude': [5255], 'autoinduction': [5258], 'JNK-dependent': [5269, 5334], 'serine': [5273], 'residues': [5274], 'within': [5275], 'domain': [5279], 'responsible': [5297], 'ternary': [5302, 5337], '(such': [5305], 'Elk-1)': [5307], 'bound': [5311], 'response': [5315], 'element': [5316], 'stimulates': [5340], 'gene,': [5346], 'RANK/TRAF6/JNK/AP-1': [5371], 'fact': [5378], 'TRAF6': [5385], '(49Lomaga': [5386], 'Yeh': [5388], 'W.C.': [5389], 'Duncan': [5392], 'G.S.': [5393], 'Furlonger': [5394], 'Ho': [5396], 'van': [5406], 'der': [5407], 'Heiden': [5408], 'Sasaki': [5416], 'Cao': [5418], 'Z.': [5419], 'Paige': [5422], 'C.J.': [5423], 'Goeddel': [5430], 'D.V.': [5431], '1015-1024Crossref': [5438], '(1074)': [5441], 'Scholar)-': [5443], 'c-fos-deficient': [5445], '(50Wang': [5447], 'Ovitt': [5449], 'Grigoriadis': [5451], 'Mohle-Steinlein': [5453], 'Ruther': [5455], '360:': [5461], '741-745Crossref': [5462], '(801)': [5465], '51Johnson': [5468], 'R.S.': [5469], 'Spiegelman': [5470], 'B.M.': [5471], 'Papaioannou': [5472], '71:': [5476], '577-586Abstract': [5477], '(578)': [5483], 'transgenic': [5491], 'overexpressing': [5493], 'mutant': [5496], 'cannot': [5498], '(24David': [5503], 'agreement': [5519, 5735], 'recent': [5525], 'Shevde': [5528], 'et': [5529, 5738], 'al.': [5530, 5739], 'recognize': [5619], 'our': [5621, 5891], 'do': [5623], 'conclusively': [5625], 'resulting': [5643], 'regulates': [5654], 'upstream': [5675], 'molecule(s)': [5677], 'involved': [5678], 'MKK4.': [5683], 'activates': [5689], 'IL-6-induced': [5694], 'argued': [5703], 'mediate,': [5707], 'development.': [5719], 'remain': [5729], 'investigated.': [5732], 'preliminary': [5798], 'weak': [5807], 'previous': [5837], 'cell-': [5886], 'promoter-specific.': [5888], 'summary,': [5890], 'JNK1,': [5906], 'bindings': [5918], 'cytokine': [5944]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W1997323954', 'counts_by_year': [{'year': 2024, 'cited_by_count': 4}, {'year': 2023, 'cited_by_count': 10}, {'year': 2022, 'cited_by_count': 8}, {'year': 2021, 'cited_by_count': 10}, {'year': 2020, 'cited_by_count': 11}, {'year': 2019, 'cited_by_count': 12}, {'year': 2018, 'cited_by_count': 17}, {'year': 2017, 'cited_by_count': 10}, {'year': 2016, 'cited_by_count': 8}, {'year': 2015, 'cited_by_count': 13}, {'year': 2014, 'cited_by_count': 9}, {'year': 2013, 'cited_by_count': 16}, {'year': 2012, 'cited_by_count': 24}], 'updated_date': '2024-12-26T00:44:07.332127', 'created_date': '2016-06-24'}