Publication Information

{'id': 'https://openalex.org/W1993868761', 'doi': 'https://doi.org/10.1074/jbc.m511763200', 'title': 'Hypoxic Regulation of Vascular Endothelial Growth Factor through the Induction of Phosphatidylinositol 3-Kinase/Rho/ROCK and c-Myc', 'display_name': 'Hypoxic Regulation of Vascular Endothelial Growth Factor through the Induction of Phosphatidylinositol 3-Kinase/Rho/ROCK and c-Myc', 'publication_year': 2006, 'publication_date': '2006-03-17', 'ids': {'openalex': 'https://openalex.org/W1993868761', 'doi': 'https://doi.org/10.1074/jbc.m511763200', 'mag': '1993868761', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/16543245'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m511763200', 'pdf_url': 'http://www.jbc.org/article/S0021925820780373/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S0021925820780373/pdf', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5025471308', 'display_name': 'Yusuke Mizukami', 'orcid': 'https://orcid.org/0000-0002-1068-7024'}, 'institutions': [{'id': 'https://openalex.org/I136199984', 'display_name': 'Harvard University', 'ror': 'https://ror.org/03vek6s52', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I136199984']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Yusuke Mizukami', 'raw_affiliation_strings': ['Gastrointestinal Unit, Department of Medicine, Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts 02114, USA.'], 'affiliations': [{'raw_affiliation_string': 'Gastrointestinal Unit, Department of Medicine, Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts 02114, USA.', 'institution_ids': ['https://openalex.org/I136199984']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5111426856', 'display_name': 'Kotoyo Fujiki', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I4210087915', 'display_name': 'Massachusetts General Hospital', 'ror': 'https://ror.org/002pd6e78', 'country_code': 'US', 'type': 'healthcare', 'lineage': ['https://openalex.org/I4210087915', 'https://openalex.org/I48633490']}, {'id': 'https://openalex.org/I136199984', 'display_name': 'Harvard University', 'ror': 'https://ror.org/03vek6s52', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I136199984']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Kotoyo Fujiki', 'raw_affiliation_strings': ['Gastrointestinal Unit, Department of Medicine, Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts 02114'], 'affiliations': [{'raw_affiliation_string': 'Gastrointestinal Unit, Department of Medicine, Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts 02114', 'institution_ids': ['https://openalex.org/I4210087915', 'https://openalex.org/I136199984']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5108521296', 'display_name': 'Eva–Maria Duerr', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I136199984', 'display_name': 'Harvard University', 'ror': 'https://ror.org/03vek6s52', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I136199984']}, {'id': 'https://openalex.org/I4210087915', 'display_name': 'Massachusetts General Hospital', 'ror': 'https://ror.org/002pd6e78', 'country_code': 'US', 'type': 'healthcare', 'lineage': ['https://openalex.org/I4210087915', 'https://openalex.org/I48633490']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Eva-Maria Duerr', 'raw_affiliation_strings': ['Gastrointestinal Unit, Department of Medicine, Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts 02114'], 'affiliations': [{'raw_affiliation_string': 'Gastrointestinal Unit, Department of Medicine, Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts 02114', 'institution_ids': ['https://openalex.org/I136199984', 'https://openalex.org/I4210087915']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5083672487', 'display_name': 'Manish Gala', 'orcid': 'https://orcid.org/0000-0002-3126-0783'}, 'institutions': [{'id': 'https://openalex.org/I4210087915', 'display_name': 'Massachusetts General Hospital', 'ror': 'https://ror.org/002pd6e78', 'country_code': 'US', 'type': 'healthcare', 'lineage': ['https://openalex.org/I4210087915', 'https://openalex.org/I48633490']}, {'id': 'https://openalex.org/I136199984', 'display_name': 'Harvard University', 'ror': 'https://ror.org/03vek6s52', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I136199984']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Manish Gala', 'raw_affiliation_strings': ['Gastrointestinal Unit, Department of Medicine, Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts 02114'], 'affiliations': [{'raw_affiliation_string': 'Gastrointestinal Unit, Department of Medicine, Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts 02114', 'institution_ids': ['https://openalex.org/I4210087915', 'https://openalex.org/I136199984']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5004583854', 'display_name': 'Won-Seok Jo', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I4210087915', 'display_name': 'Massachusetts General Hospital', 'ror': 'https://ror.org/002pd6e78', 'country_code': 'US', 'type': 'healthcare', 'lineage': ['https://openalex.org/I4210087915', 'https://openalex.org/I48633490']}, {'id': 'https://openalex.org/I136199984', 'display_name': 'Harvard University', 'ror': 'https://ror.org/03vek6s52', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I136199984']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Won-Seok Jo', 'raw_affiliation_strings': ['Gastrointestinal Unit, Department of Medicine, Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts 02114'], 'affiliations': [{'raw_affiliation_string': 'Gastrointestinal Unit, Department of Medicine, Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts 02114', 'institution_ids': ['https://openalex.org/I4210087915', 'https://openalex.org/I136199984']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5100462484', 'display_name': 'Xiaobo Zhang', 'orcid': 'https://orcid.org/0000-0003-0222-2515'}, 'institutions': [{'id': 'https://openalex.org/I4210087915', 'display_name': 'Massachusetts General Hospital', 'ror': 'https://ror.org/002pd6e78', 'country_code': 'US', 'type': 'healthcare', 'lineage': ['https://openalex.org/I4210087915', 'https://openalex.org/I48633490']}, {'id': 'https://openalex.org/I136199984', 'display_name': 'Harvard University', 'ror': 'https://ror.org/03vek6s52', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I136199984']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Xiaobo Zhang', 'raw_affiliation_strings': ['Gastrointestinal Unit, Department of Medicine, Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts 02114'], 'affiliations': [{'raw_affiliation_string': 'Gastrointestinal Unit, Department of Medicine, Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts 02114', 'institution_ids': ['https://openalex.org/I4210087915', 'https://openalex.org/I136199984']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5086897381', 'display_name': 'Daniel C. Chung', 'orcid': 'https://orcid.org/0000-0001-8226-7005'}, 'institutions': [{'id': 'https://openalex.org/I4210087915', 'display_name': 'Massachusetts General Hospital', 'ror': 'https://ror.org/002pd6e78', 'country_code': 'US', 'type': 'healthcare', 'lineage': ['https://openalex.org/I4210087915', 'https://openalex.org/I48633490']}, {'id': 'https://openalex.org/I136199984', 'display_name': 'Harvard University', 'ror': 'https://ror.org/03vek6s52', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I136199984']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Daniel C. Chung', 'raw_affiliation_strings': ['Gastrointestinal Unit, Department of Medicine, Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts 02114'], 'affiliations': [{'raw_affiliation_string': 'Gastrointestinal Unit, Department of Medicine, Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts 02114', 'institution_ids': ['https://openalex.org/I4210087915', 'https://openalex.org/I136199984']}]}], 'institution_assertions': [], 'countries_distinct_count': 1, 'institutions_distinct_count': 2, 'corresponding_author_ids': [], 'corresponding_institution_ids': [], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 5.922, 'has_fulltext': True, 'fulltext_origin': 'pdf', 'cited_by_count': 99, 'citation_normalized_percentile': {'value': 0.946739, 'is_in_top_1_percent': False, 'is_in_top_10_percent': True}, 'cited_by_percentile_year': {'min': 96, 'max': 97}, 'biblio': {'volume': '281', 'issue': '20', 'first_page': '13957', 'last_page': '13963'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T10631', 'display_name': 'Cancer, Hypoxia, and Metabolism', 'score': 1.0, 'subfield': {'id': 'https://openalex.org/subfields/1306', 'display_name': 'Cancer Research'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, 'topics': [{'id': 'https://openalex.org/T10631', 'display_name': 'Cancer, Hypoxia, and Metabolism', 'score': 1.0, 'subfield': {'id': 'https://openalex.org/subfields/1306', 'display_name': 'Cancer Research'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T10422', 'display_name': 'Angiogenesis and VEGF in Cancer', 'score': 0.9996, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T11041', 'display_name': 'Ubiquitin and proteasome pathways', 'score': 0.9948, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/hypoxia', 'display_name': 'Hypoxia', 'score': 0.51057327}, {'id': 'https://openalex.org/keywords/hypoxia-inducible-factors', 'display_name': 'Hypoxia-Inducible Factors', 'score': 0.50272083}], 'concepts': [{'id': 'https://openalex.org/C2777025900', 'wikidata': 'https://www.wikidata.org/wiki/Q29725', 'display_name': 'Vascular endothelial growth factor', 'level': 3, 'score': 0.74896836}, {'id': 'https://openalex.org/C2780394083', 'wikidata': 'https://www.wikidata.org/wiki/Q539568', 'display_name': 'Angiogenesis', 'level': 2, 'score': 0.70468575}, {'id': 'https://openalex.org/C86554907', 'wikidata': 'https://www.wikidata.org/wiki/Q285613', 'display_name': 'PI3K/AKT/mTOR pathway', 'level': 3, 'score': 0.63086504}, {'id': 'https://openalex.org/C2780610907', 'wikidata': 'https://www.wikidata.org/wiki/Q2273248', 'display_name': 'Phosphatidylinositol', 'level': 3, 'score': 0.5607091}, {'id': 'https://openalex.org/C119056186', 'wikidata': 'https://www.wikidata.org/wiki/Q1431332', 'display_name': 'Gene silencing', 'level': 3, 'score': 0.54705197}, {'id': 'https://openalex.org/C7836513', 'wikidata': 'https://www.wikidata.org/wiki/Q1641506', 'display_name': 'Hypoxia (environmental)', 'level': 3, 'score': 0.51057327}, {'id': 'https://openalex.org/C160450060', 'wikidata': 'https://www.wikidata.org/wiki/Q104598479', 'display_name': 'Hypoxia-inducible factors', 'level': 3, 'score': 0.50272083}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.48645994}, {'id': 'https://openalex.org/C146285616', 'wikidata': 'https://www.wikidata.org/wiki/Q7916455', 'display_name': 'Vascular endothelial growth factor A', 'level': 4, 'score': 0.47399867}, {'id': 'https://openalex.org/C184235292', 'wikidata': 'https://www.wikidata.org/wiki/Q421851', 'display_name': 'Kinase', 'level': 2, 'score': 0.47268468}, {'id': 'https://openalex.org/C502942594', 'wikidata': 'https://www.wikidata.org/wiki/Q3421914', 'display_name': 'Cancer research', 'level': 1, 'score': 0.46881178}, {'id': 'https://openalex.org/C51785407', 'wikidata': 'https://www.wikidata.org/wiki/Q2627568', 'display_name': 'Effector', 'level': 2, 'score': 0.41419476}, {'id': 'https://openalex.org/C95444343', 'wikidata': 'https://www.wikidata.org/wiki/Q7141', 'display_name': 'Cell biology', 'level': 1, 'score': 0.39424175}, {'id': 'https://openalex.org/C185592680', 'wikidata': 'https://www.wikidata.org/wiki/Q2329', 'display_name': 'Chemistry', 'level': 0, 'score': 0.39136505}, {'id': 'https://openalex.org/C153911025', 'wikidata': 'https://www.wikidata.org/wiki/Q7202', 'display_name': 'Molecular biology', 'level': 1, 'score': 0.3691061}, {'id': 'https://openalex.org/C62478195', 'wikidata': 'https://www.wikidata.org/wiki/Q828130', 'display_name': 'Signal transduction', 'level': 2, 'score': 0.31405815}, {'id': 'https://openalex.org/C167734588', 'wikidata': 'https://www.wikidata.org/wiki/Q4356503', 'display_name': 'VEGF receptors', 'level': 2, 'score': 0.18512115}, {'id': 'https://openalex.org/C55493867', 'wikidata': 'https://www.wikidata.org/wiki/Q7094', 'display_name': 'Biochemistry', 'level': 1, 'score': 0.11978972}, {'id': 'https://openalex.org/C104317684', 'wikidata': 'https://www.wikidata.org/wiki/Q7187', 'display_name': 'Gene', 'level': 2, 'score': 0.09972069}, {'id': 'https://openalex.org/C178790620', 'wikidata': 'https://www.wikidata.org/wiki/Q11351', 'display_name': 'Organic chemistry', 'level': 1, 'score': 0.0}, {'id': 'https://openalex.org/C540031477', 'wikidata': 'https://www.wikidata.org/wiki/Q629', 'display_name': 'Oxygen', 'level': 2, 'score': 0.0}], 'mesh': [{'descriptor_ui': 'D015972', 'descriptor_name': 'Gene Expression Regulation, Neoplastic', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': True}, {'descriptor_ui': 'D000860', 'descriptor_name': 'Hypoxia', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': True}, {'descriptor_ui': 'D019869', 'descriptor_name': 'Phosphatidylinositol 3-Kinases', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D017346', 'descriptor_name': 'Protein-Serine-Threonine Kinases', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D016271', 'descriptor_name': 'Proto-Oncogene Proteins c-myc', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D042461', 'descriptor_name': 'Vascular Endothelial Growth Factor A', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D001483', 'descriptor_name': 'Base Sequence', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D003110', 'descriptor_name': 'Colonic Neoplasms', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D003110', 'descriptor_name': 'Colonic Neoplasms', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D006801', 'descriptor_name': 'Humans', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D047908', 'descriptor_name': 'Intracellular Signaling Peptides and Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008954', 'descriptor_name': 'Models, Biological', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008969', 'descriptor_name': 'Molecular Sequence Data', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D019869', 'descriptor_name': 'Phosphatidylinositol 3-Kinases', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011401', 'descriptor_name': 'Promoter Regions, Genetic', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D017346', 'descriptor_name': 'Protein-Serine-Threonine Kinases', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D016271', 'descriptor_name': 'Proto-Oncogene Proteins c-myc', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D042461', 'descriptor_name': 'Vascular Endothelial Growth Factor A', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D042461', 'descriptor_name': 'Vascular Endothelial Growth Factor A', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D054460', 'descriptor_name': 'rho-Associated Kinases', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}], 'locations_count': 2, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m511763200', 'pdf_url': 'http://www.jbc.org/article/S0021925820780373/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/16543245', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m511763200', 'pdf_url': 'http://www.jbc.org/article/S0021925820780373/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [{'id': 'https://metadata.un.org/sdg/3', 'score': 0.6, 'display_name': 'Good health and well-being'}], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 43, 'referenced_works': ['https://openalex.org/W1495209425', 'https://openalex.org/W1508695192', 'https://openalex.org/W1532900970', 'https://openalex.org/W1566540765', 'https://openalex.org/W1571432275', 'https://openalex.org/W1677979836', 'https://openalex.org/W1949907309', 'https://openalex.org/W1965853505', 'https://openalex.org/W1973092951', 'https://openalex.org/W1974188350', 'https://openalex.org/W1976686277', 'https://openalex.org/W1984107615', 'https://openalex.org/W1985804036', 'https://openalex.org/W1991738330', 'https://openalex.org/W2030816211', 'https://openalex.org/W2042216712', 'https://openalex.org/W2050931229', 'https://openalex.org/W2059072734', 'https://openalex.org/W2079753883', 'https://openalex.org/W2080032926', 'https://openalex.org/W2085609942', 'https://openalex.org/W2086302495', 'https://openalex.org/W2097382995', 'https://openalex.org/W2098972920', 'https://openalex.org/W2109492293', 'https://openalex.org/W2112009693', 'https://openalex.org/W2120121168', 'https://openalex.org/W2130177771', 'https://openalex.org/W2134128698', 'https://openalex.org/W2136496098', 'https://openalex.org/W2150048971', 'https://openalex.org/W2153067410', 'https://openalex.org/W2157313762', 'https://openalex.org/W2157769714', 'https://openalex.org/W2160746910', 'https://openalex.org/W2161723375', 'https://openalex.org/W2163069245', 'https://openalex.org/W2163930739', 'https://openalex.org/W2165639753', 'https://openalex.org/W2168649383', 'https://openalex.org/W2279275424', 'https://openalex.org/W2804842145', 'https://openalex.org/W4235333461'], 'related_works': ['https://openalex.org/W3031917702', 'https://openalex.org/W3029904244', 'https://openalex.org/W2381595950', 'https://openalex.org/W2160758535', 'https://openalex.org/W2151772280', 'https://openalex.org/W2147372674', 'https://openalex.org/W2034393061', 'https://openalex.org/W2029619231', 'https://openalex.org/W2011095792', 'https://openalex.org/W139225676'], 'abstract_inverted_index': {'The': [0, 204, 615, 799, 1250, 1311, 1647, 1851, 1974, 2002, 2070, 2263, 2315, 2367, 2497, 2748, 3389, 3635, 3689, 3875, 4210, 4638, 4890], 'induction': [1, 41, 153, 183, 205, 245, 357, 387, 421, 696, 864, 919, 1200, 2766, 2780, 2796, 2906, 3004, 3196, 3215, 3244, 3298, 3363, 3376, 3477, 3572, 4005, 4027, 4090, 4138, 4196, 4215, 4311, 4331, 4543, 4569, 4664, 4730, 4742, 4778, 4858, 5076], 'of': [2, 12, 20, 42, 60, 122, 129, 139, 154, 161, 167, 184, 200, 206, 216, 224, 246, 264, 326, 333, 343, 358, 365, 371, 388, 404, 415, 422, 627, 639, 674, 693, 741, 811, 815, 861, 865, 920, 978, 1112, 1134, 1141, 1187, 1201, 1207, 1389, 1528, 1592, 1626, 1706, 1766, 1786, 1794, 1800, 1804, 1829, 1849, 1880, 1889, 1942, 1951, 1983, 2049, 2222, 2360, 2364, 2369, 2389, 2405, 2416, 2432, 2443, 2476, 2499, 2533, 2541, 2598, 2607, 2643, 2673, 2750, 2767, 2781, 2797, 2828, 2869, 2874, 2907, 2943, 2950, 3005, 3014, 3020, 3089, 3102, 3127, 3197, 3208, 3216, 3223, 3228, 3237, 3277, 3478, 3483, 3492, 3505, 3513, 3528, 3561, 3586, 3602, 3735, 3835, 3839, 3847, 3871, 3877, 3897, 3905, 3910, 3934, 3940, 3959, 4006, 4028, 4051, 4056, 4091, 4115, 4162, 4232, 4238, 4244, 4269, 4279, 4312, 4317, 4326, 4332, 4377, 4527, 4544, 4557, 4570, 4640, 4665, 4731, 4736, 4743, 4772, 4779, 4787, 4792, 4796, 4803, 4837, 4849, 4859, 4865, 4871, 4879, 4893, 5013, 5033, 5077, 5081, 5236, 5278, 5354, 5393, 5436, 5441, 5494, 5516, 5554], 'vascular': [3, 207, 497], 'endothelial': [4, 208, 488, 498], 'growth': [5, 209, 489, 499, 1521, 1628], 'factor': [6, 210, 490, 658, 739, 4017, 4039, 4962], '(VEGF)': [7, 211, 491], 'is': [8, 16, 27, 212, 220, 231, 426, 532, 667, 689, 697, 733, 748, 755, 843, 856, 1204, 1308, 2946, 2953, 3010, 3017, 3210, 3435, 3581, 3595, 3628, 3731, 3770, 3867, 4315, 4342, 4369, 4799, 5098, 5113, 5396, 5453], 'an': [9, 177, 213, 381, 680, 970, 2373, 2947, 3806, 4015, 4563, 4834, 4846, 5433, 5536], 'essential': [10, 214, 3211], 'feature': [11, 215], 'tumor': [13, 217, 5366, 5458, 5551], 'angiogenesis.': [14, 218], 'Hypoxia': [15, 219, 1175, 2674, 2884, 3536, 3609, 4180, 4605, 4861], 'a': [17, 82, 97, 105, 114, 137, 221, 286, 301, 309, 318, 341, 533, 690, 734, 803, 812, 844, 915, 1205, 1220, 1538, 1582, 1590, 1712, 1740, 1893, 1897, 1908, 1967, 1981, 2055, 2065, 2075, 2361, 2365, 2379, 2396, 2427, 2589, 2594, 2611, 2639, 2652, 2877, 3087, 3118, 3124, 3155, 3224, 3292, 3361, 3401, 3431, 3489, 3547, 3583, 3603, 3732, 3771, 3868, 3977, 4022, 4081, 4168, 4250, 4374, 4522, 4552, 4575, 4723, 4749, 4800, 4887, 4924, 5020, 5117, 5184, 5270, 5333, 5487], 'potent': [18, 222, 691, 3584], 'stimulator': [19, 223, 692], 'VEGF': [21, 43, 77, 155, 163, 185, 225, 247, 281, 359, 367, 389, 542, 640, 662, 842, 866, 921, 979, 1006, 1142, 1217, 1228, 1259, 1717, 1743, 1787, 2212, 2225, 2274, 2478, 2691, 2768, 2810, 2818, 2850, 2878, 2908, 2981, 3006, 3199, 3218, 3230, 3239, 3390, 3469, 3479, 3540, 3620, 4007, 4093, 4116, 4183, 4239, 4254, 4284, 4291, 4300, 4313, 4333, 4545, 4571, 4583, 4629, 4633, 4666, 4756, 4763, 4793, 4809, 4838, 5078, 5146, 5187, 5239, 5338, 5429, 5495], 'expression,': [22, 226], 'and': [23, 88, 109, 165, 202, 227, 292, 313, 369, 406, 417, 419, 537, 617, 630, 685, 687, 745, 763, 841, 850, 1155, 1184, 1190, 1212, 1255, 1273, 1307, 1467, 1511, 1533, 1597, 1652, 1732, 1780, 1783, 1813, 1868, 1947, 2062, 2084, 2088, 2092, 2097, 2138, 2199, 2228, 2248, 2275, 2304, 2340, 2376, 2482, 2490, 2508, 2556, 2560, 2582, 2593, 2664, 2683, 2732, 2737, 2774, 2820, 2854, 2952, 3105, 3131, 3307, 3356, 3395, 3427, 3441, 3451, 3510, 3592, 3624, 3717, 3823, 3849, 3856, 3892, 3957, 3968, 3996, 4303, 4338, 4490, 4580, 4612, 4868, 4873, 4966, 5017, 5027, 5038, 5066, 5122, 5124, 5329, 5391, 5508, 5520, 5587, 5591], 'hypoxia-inducible': [24, 228, 505, 704], 'factor-1': [25, 229, 705], '(HIF-1)': [26, 230, 706], 'considered': [28, 232, 698, 2669, 4371], 'to': [29, 54, 94, 233, 258, 298, 428, 456, 699, 924, 1128, 1150, 1265, 1270, 1276, 1280, 1636, 1645, 1660, 1662, 1689, 1763, 1791, 1824, 1842, 1855, 1865, 1871, 1917, 1994, 2177, 2218, 2372, 2378, 2439, 2513, 2526, 2617, 2717, 2743, 2792, 2804, 2831, 2938, 2979, 3081, 3233, 3287, 3378, 3384, 3608, 3630, 3829, 3929, 4061, 4074, 4372, 4416, 4532, 4591, 4619, 4660, 4721, 4747, 4828, 4897, 4922, 5085, 5129, 5182, 5365, 5510], 'be': [30, 234, 454, 700, 1009, 2724, 3086, 4036, 4373, 4417, 4644, 4748, 4768, 4898, 5432, 5445, 5511], 'critical': [31, 235, 427, 1160, 4375], 'for': [32, 135, 148, 180, 236, 339, 352, 384, 549, 1161, 1500, 1685, 1759, 1875, 1998, 2273, 2311, 2436, 2446, 2466, 2623, 2647, 3212, 3340, 3648, 3713, 4554, 4567, 4646, 4725, 4909, 4915, 5272, 5491, 5566, 5596], 'this': [33, 61, 130, 237, 265, 334, 2856, 3106, 3341, 3475, 3532, 3567, 3587, 3720, 3802, 3850, 3911, 3941, 3960, 3971, 5069, 5108, 5457, 5529], 'induction.': [34, 238], 'However,': [35, 239, 848, 2972, 3373, 3970, 4713, 5227], 'we': [36, 240, 631, 849, 1126, 1148, 3247, 4011, 4322, 4588, 4843, 5330, 5485, 5592], 'have': [37, 241, 546, 852, 4424, 4919, 4954, 5183, 5241, 5268, 5331], 'previously': [38, 242, 632, 1235, 1312, 2679, 2977, 3248], 'demonstrated': [39, 113, 157, 243, 317, 361, 633, 914, 2680, 4223, 4339, 4844, 5009, 5092, 5181, 5269], 'that': [40, 91, 112, 189, 244, 295, 316, 393, 460, 467, 540, 659, 854, 1116, 1136, 1158, 1172, 1541, 1751, 2173, 2637, 2681, 2844, 2855, 3016, 3112, 3136, 3241, 3434, 3460, 3474, 3627, 3643, 3801, 3865, 4018, 4033, 4040, 4274, 4296, 4314, 4340, 4426, 4538, 4595, 4770, 4784, 4805, 4845, 4928, 4956, 5093, 5097, 5323, 5340, 5428, 5534, 5549], 'by': [44, 158, 169, 248, 362, 373, 679, 1011, 1577, 1957, 2205, 2292, 2355, 2423, 2602, 2660, 2741, 2772, 2811, 2911, 2955, 3109, 3129, 3145, 3151, 3164, 3220, 3245, 3364, 3437, 3488, 3965, 4159, 4200, 4216, 4261, 4276, 4559, 4881, 4964, 4972, 5064, 5280, 5311, 5318, 5327], 'hypoxia': [45, 68, 95, 249, 272, 299, 688, 766, 805, 925, 981, 1012, 1015, 1584, 1665, 1874, 1997, 2682, 2755, 2771, 2816, 2837, 2853, 2956, 3098, 3113, 3130, 3280, 3365, 3843, 4302, 4579, 4872, 4957], 'was': [46, 50, 92, 141, 156, 250, 254, 296, 345, 360, 1288, 1301, 1542, 1634, 1698, 1709, 1737, 1774, 1789, 1901, 1945, 1954, 1964, 2127, 2183, 2203, 2242, 2253, 2326, 2381, 2393, 2409, 2421, 2518, 2564, 2586, 2600, 2615, 2756, 2882, 2976, 3079, 3107, 3122, 3149, 3162, 3201, 3299, 3310, 3485, 3515, 3546, 3553, 3573, 3638, 3670, 3691, 3827, 3851, 3886, 3951, 3962, 3973, 3980, 3987, 4059, 4080, 4105, 4121, 4136, 4145, 4157, 4167, 4189, 4197, 4221, 4241, 4271, 4832, 4876, 5040, 5060, 5325, 5349], 'preserved': [47, 251], 'when': [48, 252, 458, 1013, 1903, 2926, 3160, 3301, 3380, 3551, 3673, 3853, 3976, 4098, 4139, 4186, 5042], 'HIF-1α': [49, 194, 253, 398, 744, 747, 855, 910, 974, 1525, 2076, 2782, 3446, 3701, 4780, 5507], 'silenced.': [51, 255], 'We': [52, 256, 2714, 2935, 3523, 3723, 4530, 5303, 5561], 'sought': [53, 257, 1127, 1149, 2716, 2937, 4531], 'better': [55, 259], 'define': [56, 260, 1151, 2619, 3336, 4592], 'the': [57, 127, 151, 162, 181, 198, 261, 331, 355, 366, 385, 402, 420, 637, 749, 809, 858, 862, 1005, 1110, 1123, 1130, 1152, 1162, 1168, 1198, 1208, 1216, 1281, 1291, 1390, 1624, 1630, 1641, 1667, 1673, 1764, 1784, 1792, 1805, 1825, 1830, 1847, 1919, 1948, 1999, 2041, 2111, 2200, 2220, 2327, 2330, 2335, 2347, 2350, 2356, 2477, 2500, 2527, 2561, 2583, 2620, 2624, 2751, 2759, 2765, 2779, 2794, 2826, 2833, 2845, 2867, 2872, 2886, 2896, 2904, 2940, 3002, 3100, 3165, 3194, 3198, 3213, 3217, 3229, 3238, 3278, 3289, 3296, 3302, 3337, 3351, 3374, 3481, 3503, 3526, 3538, 3576, 3593, 3598, 3615, 3619, 3736, 3791, 3811, 3818, 3831, 3845, 3882, 3895, 3898, 3903, 3908, 3938, 3985, 4003, 4025, 4037, 4043, 4054, 4064, 4069, 4088, 4092, 4099, 4113, 4128, 4140, 4182, 4195, 4213, 4230, 4245, 4277, 4309, 4324, 4329, 4378, 4418, 4525, 4534, 4541, 4555, 4568, 4593, 4615, 4622, 4662, 4728, 4740, 4777, 4785, 4790, 4808, 4851, 4856, 4863, 4869, 5010, 5054, 5058, 5074, 5094, 5276, 5307, 5316, 5337, 5343, 5352, 5492, 5514, 5563, 5569], 'molecular': [58, 262, 1131, 5308], 'basis': [59, 263], 'HIF-1-independent': [62, 266, 4535, 4565], 'regulation.': [63, 267], 'In': [64, 268, 1122, 1146, 1670, 2728, 2785, 3497, 4319, 4733, 5029, 5083, 5176, 5483], 'colon': [65, 187, 269, 391, 628, 964, 1144, 1506, 3368, 4335, 4547, 5449], 'cancer': [66, 188, 270, 392, 965, 1024, 1507, 3369, 4336], 'cells,': [67, 271, 2730], 'stimulated': [69, 273, 455], 'multiple': [70, 274, 1177, 5546], 'K-ras': [71, 275, 618, 1178, 1909, 2687, 2720, 3138, 3580, 4581, 4875, 5095, 5523], 'effector': [72, 276, 1179, 2721, 3870, 4598, 4802], 'pathways': [73, 277, 620, 1171, 1180, 2722, 4537, 4599, 5548], 'including': [74, 278, 1181, 2547, 4429], 'phosphatidylinositol': [75, 279, 502, 4932], '3-kinase.': [76, 280], 'promoter': [78, 84, 164, 282, 288, 368, 810, 1007, 1218, 1229, 1260, 2213, 2226, 2479, 2879, 2909, 2982, 3200, 3219, 3240, 3303, 3352, 3391, 3534, 3541, 3588, 3621, 3721, 4094, 4184, 4634, 4757, 4810, 5339], 'deletion': [79, 283, 3276], 'studies': [80, 284, 4550, 4714, 4953, 5087, 5126, 5267], 'identified': [81, 104, 142, 285, 308, 346, 3914, 5332], 'novel': [83, 287, 3432, 3792, 3899, 5488], 'region': [85, 289, 3304, 3353, 3589, 3637], 'between': [86, 107, 290, 311, 2349, 2480, 3305, 3354, 3393, 3622, 3821, 4578, 5120], '–418': [87, 291, 1263, 2481, 3306, 3355, 3383, 3394, 3623], '–223': [89, 293, 1268, 2483, 3385, 3396, 3625], 'bp': [90, 111, 294, 315, 1264, 1269, 1275, 1278, 1300, 2484, 3285, 3309, 3386, 3397, 3626, 4047, 4104], 'responsive': [93, 297, 3629], 'in': [96, 118, 150, 186, 300, 322, 354, 390, 543, 624, 636, 664, 682, 758, 765, 808, 922, 980, 1022, 1143, 1519, 1581, 1691, 1810, 1834, 1857, 1978, 2006, 2140, 2329, 2460, 2544, 2630, 2651, 2754, 2770, 2836, 2852, 2871, 2984, 3091, 3095, 3117, 3295, 3366, 3445, 3470, 3480, 3501, 3517, 3618, 3660, 3679, 3700, 3719, 3766, 3784, 3795, 3809, 3842, 3907, 3954, 3990, 4002, 4024, 4048, 4053, 4068, 4087, 4095, 4112, 4123, 4212, 4224, 4249, 4253, 4257, 4283, 4290, 4328, 4334, 4524, 4546, 4572, 4602, 4636, 4727, 4781, 4811, 4839, 4886, 4974, 5047, 5079, 5102, 5186, 5275, 5336, 5345, 5439, 5448, 5456, 5496], 'PI3K/Rho/ROCK-dependent': [98, 302], 'manner.': [99, 303, 3120, 4889], 'Electrophoretic': [100, 304, 2449], 'mobility': [101, 305, 520, 2584], 'shift': [102, 116, 306, 320, 521, 2585, 3669, 3690, 3884, 3917], 'assays': [103, 307, 2231, 2801], 'fragment': [106, 310, 3392], '–300': [108, 312], '–251': [110, 314], 'unique': [115, 319, 3667, 3912], 'only': [117, 321, 859, 3672, 4419], 'hypoxic': [119, 152, 182, 323, 356, 386, 863, 1139, 1163, 1199, 1692, 1757, 2464, 2744, 2795, 2905, 3003, 3195, 3214, 3290, 3297, 3375, 3476, 3518, 3664, 3680, 3796, 3812, 3955, 4004, 4026, 4089, 4214, 4310, 4330, 4379, 4542, 4603, 4663, 4729, 4741, 4840, 4857, 5497], 'conditions.': [120, 324, 1693, 3665, 4604, 4841], 'Inhibition': [121, 325, 1186, 3560, 4878], 'PI3K': [123, 327, 1391, 2752, 2807, 2846, 2870, 2929, 2951, 3015, 3090, 3563, 3855, 4737, 4753, 4773, 4788, 4804, 4880], 'or': [124, 328, 465, 1020, 1195, 1664, 1756, 1873, 1996, 2095, 2463, 2930, 3154, 3159, 3564, 3663, 4286, 4632, 5137], 'ROCK': [125, 329, 3021, 3161, 3565, 3857, 5121, 5132], 'blocked': [126, 330, 2764, 2903, 3852, 3894, 3937, 3964], 'formation': [128, 332, 3896, 3909, 3939, 3958], 'complex.': [131, 335], 'A': [132, 146, 336, 350, 1295, 2170, 2300, 3075, 3666, 3946, 3995], 'binding': [133, 337, 1221, 2545, 3786], 'site': [134, 338, 1297, 3774, 4067, 4101], 'c-Myc,': [136, 340, 2123, 3728, 3824, 3848, 5123, 5437], 'target': [138, 342, 816, 1206, 2949, 3013, 3088, 3734, 4848, 5435], 'ROCK,': [140, 344, 1191, 5519], 'at': [143, 347, 1223, 1298, 1666, 1776, 2288, 3283, 3610, 3775, 4045, 4102, 4143, 4305, 5015, 5035], '–271': [144, 348, 1224, 1299, 3611, 3776, 4046, 4103], 'bp.': [145, 349, 1225], 'role': [147, 351, 635, 2749, 2868, 3808, 3904, 4001, 4023, 4111, 4325, 4523, 4553, 4724, 5185, 5271, 5348], 'c-Myc': [149, 168, 353, 372, 1203, 1468, 2126, 2130, 2223, 3718, 3730, 3836, 3866, 3906, 3922, 3935, 4034, 4052, 4120, 4126, 4156, 4173, 4201, 4220, 4234, 4246, 4297, 4558, 5014, 5034, 5136, 5142, 5178, 5237, 5279, 5324, 5361, 5452], 'site-directed': [159, 363], 'mutagenesis': [160, 364, 1287, 4058], 'silencing': [166, 370, 2201, 4170, 4233], 'small': [170, 374, 508], 'interfering': [171, 375, 509], 'RNA.': [172, 376], 'Collectively,': [173, 377], 'these': [174, 378, 3785, 3878, 4030, 4124], 'findings': [175, 379, 1108, 4294, 5426], 'suggest': [176, 380, 4032, 4551, 5427], 'alternative': [178, 382, 1113, 4847, 5489], 'mechanism': [179, 383, 4566, 4892, 5399, 5490], 'does': [190, 394, 2174, 3398, 5503], 'not': [191, 395, 857, 1118, 1193, 2175, 2735, 2839, 2862, 3000, 3399, 3453, 3486, 4343, 4415, 4627, 4643, 4761, 4775, 4833, 4978, 5305, 5504, 5557], 'depend': [192, 396, 1119, 5505, 5558], 'upon': [193, 397, 1120, 2281, 5051, 5506, 5559], 'but': [195, 399, 761, 1192, 2734, 2861, 3544, 4134, 4194, 4759, 4900, 5313], 'instead': [196, 400], 'requires': [197, 401], 'activation': [199, 403, 2398, 3077, 3126, 3207, 3550, 4556, 4885, 4895, 5515], 'PI3K/Rho/ROCK': [201, 405, 4560], 'c-Myc.': [203, 407, 5358, 5521], 'Rapidly': [408], 'growing': [409, 3659], 'tumors': [410, 666, 671], 'routinely': [411], 'outstrip': [412], 'their': [413, 634], 'supply': [414, 684], 'oxygen': [416, 676, 683], 'nutrients,': [418], 'new': [423, 2653], 'blood': [424, 451], 'vessels': [425, 452], 'sustain': [429], 'neoplastic': [430], 'proliferation': [431], '(1Hanahan': [432], 'D.': [433, 781, 933, 1083, 1085, 1368, 2157, 4450, 4694, 5375], 'Folkman': [434], 'J.': [435, 582, 586, 605, 870, 950, 954, 985, 1087, 1330, 1373, 1554, 1603, 2155, 2695, 3043, 3256, 3315, 3408, 4348, 4497, 4673, 4697, 5287], 'Cell.': [436, 722, 1042, 1098, 1485, 3180, 3750, 4994, 5411, 5473], '1996;': [437, 724, 1044, 3044], '86:': [438], '353-364Abstract': [439], 'Full': [440, 442, 1336, 1338, 1379, 3065, 3067, 3184, 3186, 3754, 3756, 4679, 4681, 4703, 4705, 4998, 5000, 5293, 5295, 5415, 5417], 'Text': [441, 443, 1337, 1339, 1380, 3066, 3068, 3185, 3187, 3755, 3757, 4680, 4682, 4704, 4706, 4999, 5001, 5294, 5296, 5416, 5418], 'PDF': [444, 1340, 1381, 3069, 3188, 3758, 4683, 4707, 5002, 5297, 5419], 'PubMed': [445, 482, 558, 570, 610, 727, 775, 794, 836, 884, 902, 958, 999, 1047, 1069, 1102, 1341, 1382, 1436, 1464, 1490, 1568, 1617, 1933, 2709, 3047, 3070, 3189, 3270, 3329, 3422, 3759, 4362, 4408, 4465, 4514, 4684, 4708, 4944, 5003, 5171, 5202, 5222, 5298, 5420, 5478], 'Scopus': [446, 483, 559, 611, 728, 776, 795, 837, 885, 903, 959, 1000, 1048, 1070, 1103, 1342, 1437, 1491, 1569, 1618, 1934, 2710, 3048, 3071, 3190, 3271, 3330, 3423, 3760, 4363, 4409, 4466, 4515, 4685, 4709, 4945, 5004, 5172, 5203, 5223, 5299, 5421, 5479], '(6117)': [447], 'Google': [448, 485, 561, 571, 613, 653, 730, 778, 797, 839, 887, 905, 945, 961, 1002, 1050, 1072, 1105, 1248, 1344, 1383, 1439, 1465, 1493, 1571, 1620, 1730, 1936, 2168, 2712, 2970, 2997, 3050, 3073, 3192, 3273, 3332, 3425, 3762, 4365, 4411, 4442, 4468, 4488, 4517, 4687, 4711, 4825, 4947, 5006, 5174, 5205, 5225, 5264, 5301, 5389, 5423, 5481], 'Scholar).': [449, 486, 614, 654, 731, 798, 906, 962, 1003, 1106, 1249, 1572, 1621, 1937, 2169, 2713, 2971, 3074, 3274, 3333, 3763, 4366, 4712, 4948, 5175, 5226, 5265, 5302, 5424, 5482], 'New': [450], 'can': [453, 660, 1008, 1214, 2688, 2848, 3114, 3139, 3466, 4298, 4304, 4539, 4806, 4854, 4929, 4958, 5071, 5133, 5143, 5341, 5524, 5544], 'grow': [457], 'factors': [459, 1157, 3462, 4428, 4908, 4914], 'promote': [461], 'angiogenesis': [462, 469, 5367], 'are': [463, 470, 621, 1018, 1159, 2279, 3707, 4794, 5127, 5229], 'up-regulated': [464, 2885, 3099, 3537, 4181, 4862], 'those': [466], 'inhibit': [468, 541, 2980, 4653], 'down-regulated': [471, 3203], '(2Bergers': [472], 'G.': [473, 596, 1060, 1089, 1923, 4448], 'Benjamin': [474], 'L.E.': [475, 890, 4384], 'Nat.': [476, 4509], 'Rev.': [477], 'Cancer.': [478], '2003;': [479, 2165, 3181, 3751, 4439, 4995, 5412], '3:': [480, 3182, 3752, 4996, 5413], '401-410Crossref': [481], '(2883)': [484], 'Vascular': [487], '4The': [492], 'abbreviations': [493], 'used': [494, 1499, 1738, 1902, 2310, 2435, 2646, 3981], 'are:': [495], 'VEGF,': [496, 4029], 'factor;': [500], 'PI3K,': [501, 1188, 4850, 5025, 5517], '3-kinase;': [503], 'HIF-1,': [504, 4621], 'factor-1;': [506], 'siRNA,': [507, 4193], 'RNA;': [510], 'ERK,': [511, 1182, 2931], 'extracellular': [512], 'signal-regulated': [513], 'kinase;': [514, 527], 'GST,': [515], 'glutathione': [516], 'S-transferase;': [517], 'EMSA,': [518], 'electrophoretic': [519], 'assay;': [522], 'MEK,': [523], 'mitogen-activated': [524], 'protein': [525, 2050, 2445], 'kinase/ERK': [526], 'JNK,': [528, 2738], 'c-Jun': [529], 'N-terminal': [530], 'kinase.': [531, 5141], 'key': [534, 750, 845], 'pro-angiogenic': [535], 'factor,': [536], 'therapeutic': [538], 'approaches': [539], 'human': [544, 1023, 1505, 1716, 2180, 5103], 'malignancies': [545], 'been': [547, 1915, 4586, 4658, 4920, 5180, 5243, 5363], 'approved': [548], 'clinical': [550], 'use': [551, 5353], '(3Kerbel': [552], 'R.S.': [553, 939, 952, 3170, 3740, 4984, 5401], 'Carcinogenesis.': [554], '2000;': [555, 942, 4511, 5261, 5386], '21:': [556], '505-515Crossref': [557], '(889)': [560], 'Scholar,': [562, 572, 779, 888, 946, 1051, 1073, 3051, 4688, 5206], '4Ferrara': [563], 'N.': [564, 594, 603, 1075, 4504, 5373], 'Semin.': [565], 'Oncol.': [566], '2002;': [567, 791, 1333, 4700, 5168], '29:': [568], '10-14Crossref': [569], '5Hurwitz': [573], 'H.': [574, 1364, 1399, 1409, 1448, 5153, 5256], 'Fehrenbacher': [575], 'L.': [576, 1411, 1452, 1473], 'Novotny': [577], 'W.': [578, 584, 931], 'Cartwright': [579], 'T.': [580, 1056, 1324, 1405, 2151, 3023, 3027, 3035, 3055, 4495, 4670], 'Hainsworth': [581], 'Heim': [583], 'Berlin': [585], 'Baron': [587], 'A.': [588, 832, 1095, 1316, 1401, 1432, 3039, 3174, 3744, 4454, 4696, 4988, 5197, 5381, 5405], 'Griffing': [589], 'S.': [590, 831, 1064, 1077, 1318, 1431, 1477, 2147, 3057, 4432, 4668, 5254], 'Holmgren': [591], 'E.': [592, 894, 1093, 1362, 2159, 3053, 4390, 4446, 4672], 'Ferrara': [593], 'Fyfe': [595], 'Rogers': [597], 'B.': [598, 1062, 1081, 1328, 4935], 'Ross': [599], 'R.': [600, 1320, 1417, 3059, 5212, 5379], 'Kabbinavar': [601], 'F.': [602, 714, 1034, 4386], 'Engl.': [604], 'Med.': [606, 4510], '2004;': [607, 881, 996, 1099, 1565, 1614, 2706, 3267, 3326, 3419, 4359, 5219], '350:': [608], '2335-2342Crossref': [609], '(9270)': [612], 'Wnt': [616], 'signaling': [619, 1170, 1210, 2684, 3143, 4536, 4561, 5021, 5052, 5106, 5274, 5282, 5527, 5547], 'frequently': [622, 5100, 5539], 'activated': [623, 764, 1176, 2725, 2740, 2954, 3436, 4606, 5326], 'early': [625], 'stages': [626], 'carcinogenesis,': [629], 'regulation': [638, 2873, 4114, 4526, 4791, 5317, 5392, 5493], 'expression': [641, 663, 1140, 1495, 1910, 1943, 2441, 2851, 4584, 4631, 4963, 5147, 5240, 5395], '(6Zhang': [642, 1237, 1719, 2986, 4814], 'X.': [643, 872, 987, 1238, 1556, 1605, 1720, 2697, 2987, 3258, 3317, 3410, 4350, 4815], 'Gaspard': [644, 1239, 1721, 2988, 4816], 'J.P.': [645, 1240, 1722, 2989, 4452, 4817], 'Chung': [646, 877, 992, 1241, 1561, 1610, 1723, 2702, 2990, 3263, 3322, 3415, 4355, 4818], 'D.C.': [647, 878, 993, 1242, 1562, 1611, 1724, 2703, 2991, 3264, 3323, 3416, 4356, 4819], 'Cancer': [648, 879, 940, 994, 1243, 1563, 1612, 1725, 2163, 2704, 2965, 2992, 3179, 3265, 3324, 3417, 3749, 4357, 4437, 4483, 4820, 4993, 5217, 5259, 5410], 'Res.': [649, 880, 941, 995, 1244, 1564, 1613, 1726, 2164, 2705, 2966, 2993, 3266, 3325, 3418, 4358, 4438, 4461, 4484, 4821, 4940, 5218, 5260], '2001;': [650, 772, 1066, 1245, 1727, 2967, 2994, 4462, 4822], '61:': [651, 1246, 1728, 2968, 2995, 4823], '6050-6054PubMed': [652, 1247, 1729, 2996, 4824], 'An': [655], 'additional': [656, 3343], 'environmental': [657, 5537], 'enhance': [661, 3141, 5526], 'advanced': [665], 'hypoxia.': [668, 1646, 2727, 3092, 3146, 3438, 3471, 3874, 4049, 4573, 4637, 5048, 5082, 5319, 5346, 5442], 'Most': [669], 'solid': [670, 5542], 'develop': [672], 'regions': [673, 3236], 'low': [675], 'tension': [677], 'caused': [678], 'imbalance': [681], 'consumption,': [686], 'VEGF.': [694, 1202, 2798, 4732, 4744, 4860], 'This': [695, 3863, 4267, 4745, 5049, 5443, 5501], 'primarily': [701, 2858], 'mediated': [702, 3487, 3596, 5512], 'through': [703, 1219, 2685, 2859, 3597, 5019, 5053, 5107, 5139, 5351, 5513, 5528], '(7Forsythe': [707, 1027], 'J.A.': [708, 1028, 2962, 5155], 'Jiang': [709, 820, 1029], 'B.H.': [710, 821, 1030], 'Iyer': [711, 891, 1031], 'N.V.': [712, 892, 1032, 4382], 'Agani': [713, 1033, 4385], 'Leung': [715, 1035, 4387], 'S.W.': [716, 1036, 4388], 'Koos': [717, 1037], 'R.D.': [718, 1038], 'Semenza': [719, 824, 895, 1039, 4401], 'G.L.': [720, 819, 825, 896, 1040, 4402], 'Mol.': [721, 1041, 1096, 1459, 1484, 5472], 'Biol.': [723, 898, 1043, 1097, 1332, 1374, 1486, 3061, 4674, 4698, 5288, 5474], '16:': [725, 1045, 5169], '4604-4613Crossref': [726, 1046], '(3234)': [729, 1049], 'HIF-1': [732, 800, 1135, 3465, 3484, 4327, 4341, 4368], 'heterodimeric': [735], 'basic': [736], 'helix-loop-helix': [737], 'transcription': [738, 1156, 1282, 2251, 3461, 3710, 4038, 4117, 4427], 'composed': [740], 'two': [742, 4607], 'subunits,': [743], 'HIF-1β.': [746], 'regulatory': [751, 3616], 'component,': [752], 'because': [753, 1912, 3729, 4648, 4752, 4911, 5057, 5233, 5451], 'it': [754, 1213, 3084, 4413, 4649], 'rapidly': [756], 'degraded': [757], 'normoxic': [759, 1755, 2462, 3662, 3991, 4812], 'conditions': [760, 1574, 1758, 2465, 2745, 3519, 3681, 3797, 3992, 4813, 5440, 5498], 'stabilized': [762, 2817], '(8Bruick': [767], 'R.K.': [768], 'McKnight': [769], 'S.L.': [770], 'Science.': [771, 790], '294:': [773], '1337-1340Crossref': [774], '(2130)': [777], '9Lando': [780], 'Peet': [782], 'D.J.': [783, 1360, 4506], 'Whelan': [784], 'D.A.': [785], 'Gorman': [786], 'J.J.': [787], 'Whitelaw': [788], 'M.L.': [789], '295:': [792], '858-861Crossref': [793], '(1280)': [796], 'complex': [801, 1392], 'recognizes': [802], 'consensus': [804, 3279, 3402, 3709], 'response': [806, 923, 1016, 1164, 3281, 3813, 4380], 'element': [807, 1222, 3282, 3338, 3404, 3433, 3617, 3803, 4044, 4142, 5335], 'broad': [813], 'range': [814], 'genes': [817], '(10Wang': [818], 'Rue': [822], 'E.A.': [823], 'Proc.': [826, 1426], 'Natl.': [827, 1427], 'Acad.': [828, 1428], 'Sci.': [829, 1429], 'U.': [830, 1430, 2149], '1995;': [833], '92:': [834], '5510-5514Crossref': [835], '(5105)': [838], 'Scholar),': [840, 1345, 1384, 1440, 1466, 1731, 2998, 3193, 4412, 4443, 4469, 4489, 4826, 5390], 'transcriptional': [846, 1114, 2860, 4750], 'target.': [847], 'others': [851, 4423], 'shown': [853, 1916, 2978, 3094, 3765, 4425, 4659, 4921], 'regulator': [860, 3585, 4836], '(11Mizukami': [867, 982, 1551, 1600, 2692, 3253, 3312, 3405, 4345], 'Y.': [868, 983, 1407, 1450, 1552, 1601, 2693, 3254, 3313, 3406, 4346, 4502], 'Li': [869, 984, 1080, 1449, 1553, 1602, 2694, 3255, 3314, 3407, 4347], 'Zhang': [871, 986, 1325, 1555, 1604, 2696, 3257, 3316, 3409, 4349], 'Zimmer': [873, 988, 1557, 1606, 2698, 3259, 3318, 3411, 4351], 'M.A.': [874, 989, 1454, 1558, 1607, 2699, 3260, 3319, 3412, 4352], 'Iliopoulos': [875, 990, 1559, 1608, 2700, 3261, 3320, 3413, 4353, 5595], 'O.': [876, 991, 1560, 1609, 2701, 3262, 3321, 3414, 4354, 5377], '64:': [882, 997, 1566, 1615, 2707, 3268, 3327, 3420, 4360, 5220], '1765-1772Crossref': [883, 998, 1567, 1616, 2708, 3269, 3328, 3421, 4361], '(142)': [886, 1001, 1570, 1619, 2711, 3272, 3331, 3424, 4364], '12Kotch': [889], 'Laughner': [893, 4389], 'Dev.': [897, 4404, 5167], '1999;': [899, 1929, 3062, 4676, 4941], '209:': [900], '254-267Crossref': [901], '(344)': [904], 'Cells': [907], 'derived': [908, 2333], 'from': [909, 1262, 1991, 2102, 2334, 2457, 3382, 3656, 3676, 3696], '“knock-out”': [911], 'embryos': [912], 'still': [913, 3974], 'significant,': [916], 'albeit': [917], 'reduced,': [918], '(13Ryan': [926], 'H.E.': [927, 948], 'Poloni': [928], 'M.': [929, 935, 1058, 1322, 1425, 1471, 3025, 3031, 3033, 4394, 4434, 4456, 5371], 'McNulty': [930], 'Elson': [932], 'Gassmann': [934, 4393], 'Arbeit': [936], 'J.M.': [937, 5469], 'Johnson': [938, 951], '60:': [943, 5262], '4010-4015PubMed': [944], '14Ryan': [947], 'Lo': [949], 'EMBO': [953, 3042], '1998;': [955, 4405], '17:': [956], '3005-3015Crossref': [957], '(1340)': [960], 'Also,': [963], 'cell': [966, 1025, 1508, 1530, 1540, 1579, 1631, 2407], 'lines': [967, 1026, 1509, 1580], 'stably': [968, 5600], 'expressing': [969, 5601], 'siRNA': [971, 2120, 2124, 2131, 2172, 2193, 3919, 4164, 4202, 4217, 4247], 'construct': [972, 2881, 2889, 3158, 3542, 4132], 'against': [973, 2125, 3921, 4219], 'exhibited': [975], 'significant': [976], 'levels': [977, 2442, 3101, 3504, 4237, 4256, 4864], 'Furthermore,': [1004, 3984], 'induced': [1010, 3144, 4127], 'canonical': [1014], 'elements': [1017, 1154, 2621], 'mutated': [1019, 1303, 4146, 5101], 'deleted': [1021, 3311], '15von': [1052], 'Marschall': [1053], 'Z.': [1054], 'Cramer': [1055], 'Hocker': [1057], 'Finkenzeller': [1059], 'Wiedenmann': [1061], 'Rosewicz': [1063], 'Gut.': [1065], '48:': [1067], '87-96Crossref': [1068], '(173)': [1071], '16Pore': [1074], 'Liu': [1076], 'Shu': [1078], 'H.K.': [1079], 'Haas-Kogan': [1082], 'Stokoe': [1084], 'Milanini-Mongiat': [1086], 'Pages': [1088], "O'Rourke": [1090], 'D.M.': [1091, 4508], 'Bernhard': [1092], 'Maity': [1094], '15:': [1100, 3045], '4841-4853Crossref': [1101], '(192)': [1104], 'These': [1107, 2841, 4293, 5531], 'imply': [1109, 2843], 'existence': [1111], 'mechanisms': [1115, 1132], 'do': [1117, 5556], 'HIF-1α.': [1121], 'present': [1124, 3989, 5486], 'study,': [1125], 'characterize': [1129, 3614, 4533], 'independent': [1133, 1524, 4016, 4316, 4795], 'may': [1137, 2723, 2808, 3085, 3428, 3804, 4019, 4035, 4519, 4600, 4642, 4650, 5430, 5444], 'regulate': [1138, 1173, 1215, 2809, 2849, 3468, 4299, 4540, 4620, 4807, 5145, 5550], 'cancer.': [1145, 4548], 'particular,': [1147], 'cis-regulatory': [1153], 'as': [1165, 1167, 1234, 1535, 1537, 1739, 1892, 2268, 2319, 2353, 2383, 2492, 2610, 2628, 3646, 4075, 4259, 4562], 'well': [1166, 1536], 'upstream': [1169, 3019], 'them.': [1174], 'PI3K/Akt,': [1183], 'Rho.': [1185], 'Rho,': [1189, 3104, 4867, 4910, 5026, 5518], 'ERK': [1194, 2731, 4611, 4616], 'Akt,': [1196, 2090, 2733], 'attenuated': [1197, 3566, 4198, 4739, 4883, 5063], 'PI3K/ROCK': [1209, 3599, 3822, 3872, 5055], 'pathway,': [1211, 4853, 5056], 'Plasmid': [1226], 'Constructions—Human': [1227], 'luciferase': [1230, 1969, 2230], 'constructs': [1231, 1883, 2215], 'were': [1232, 1497, 1517, 1548, 1575, 1643, 1655, 1675, 1747, 1752, 1808, 1817, 1832, 1853, 1884, 1905, 1976, 1989, 2004, 2052, 2072, 2108, 2188, 2216, 2232, 2309, 2317, 2434, 2455, 2485, 2502, 2511, 2536, 2574, 2658, 2668, 2739, 2802, 2923, 2933, 3345, 3387, 3447, 3457, 3495, 3507, 3633, 3644, 3654, 3682, 3724, 3788, 3798, 3858, 3923, 4589, 5045], 'prepared': [1233, 1699, 2456], 'described': [1236, 1313, 2137, 2629, 5244], 'reporter': [1251, 1882, 1970, 2214, 2880], 'constructs,': [1252], '0.75-,': [1253], '0.56-,': [1254], '0.43-kb': [1256], 'VEGF-luc,': [1257, 3348], 'contained': [1258], 'sequences': [1261, 2135, 2272, 3381], '+350': [1266, 1271, 1277, 3357], 'bp,': [1267, 1272, 3358, 3777], '–90': [1274, 3308], 'relative': [1279, 2377], 'initiation': [1283], 'site,': [1284], 'respectively.': [1285], 'Site-directed': [1286], 'performed': [1289, 1809, 1818, 1833, 1977, 2233, 2254, 2519, 2616, 2803, 3080, 3249, 3828, 4060], 'using': [1290, 1700, 1711, 1819, 2110, 2195, 2244, 2255, 2426, 2520, 2588, 4715], '0.75-kb': [1292, 3347, 3539, 4070, 4130, 4187], 'VEGF-luc': [1293, 2888, 3578, 4071, 4131, 4188], 'construct.': [1294, 3579], 'Myc-Max-binding': [1296, 2640, 3773, 4100], 'selectively': [1302, 4062], '(5′-GCGGGCGCGTGTCTC': [1304], '→': [1305], '5′-GCGGGCGAAAGTCTC)': [1306], 'designated': [1309], 'mut-271-luc.': [1310], 'K-rasV12': [1314, 3132, 3530, 3552], '(17Khokhlatchev': [1315], 'Rabizadeh': [1317], 'Xavier': [1319, 5573], 'Nedwidek': [1321], 'Chen': [1323, 1447, 1472, 4473], 'X.F.': [1326], 'Seed': [1327], 'Avruch': [1329], 'Curr.': [1331, 3060], '12:': [1334, 4406], '253-265Abstract': [1335], '(328)': [1343], 'dominant': [1346, 1385, 1441, 2927, 2973, 3156, 4716], 'negative': [1347, 1386, 1442, 2928, 3157, 4717], 'RhoA-T19N': [1348], '(dnRho;': [1349], 'Guthrie': [1350], 'Research': [1351], 'Institute,': [1352], 'Sayre,': [1353], 'PA),': [1354], 'kinase': [1355], 'mutant': [1356, 3978], 'ERK-1/2': [1357], '(dnERK)': [1358], '(18Robbins': [1359], 'Zhen': [1361], 'Owaki': [1363], 'Vanderbilt': [1365], 'C.A.': [1366], 'Ebert': [1367], 'Geppert': [1369], 'T.D.': [1370], 'Cobb': [1371], 'M.H.': [1372], 'Chem.': [1375, 4675, 4699, 5289], '1993;': [1376], '268:': [1377], '5097-5106Abstract': [1378], 'p85': [1387], 'component': [1388], '(dnPI3K)': [1393], '(19Hara': [1394], 'K.': [1395, 1397, 1403, 1479, 3029, 3037, 3041, 4499], 'Yonezawa': [1396], 'Sakaue': [1398], 'Ando': [1400], 'Kotani': [1402], 'Kitamura': [1404, 1406], 'Ueda': [1408], 'Stephens': [1410], 'Jackson': [1412], 'T.R.': [1413], 'Hawkins': [1414], 'P.T.': [1415], 'Dhand': [1416], 'Clark': [1418], 'A.E.': [1419], 'Holman': [1420], 'G.D.': [1421], 'Waterfield': [1422, 4936], 'M.D.': [1423, 4937, 5461], 'Kasuga': [1424, 5579], '1994;': [1433, 4485], '91:': [1434], '7415-7419Crossref': [1435], '(418)': [1438], 'Akt-K179A': [1443], '(dnAkt)': [1444], '(20Cong': [1445], 'L.N.': [1446], 'Zhou': [1451], 'McGibbon': [1453], 'Taylor': [1455], 'S.I.': [1456], 'Quon': [1457, 5582], 'M.J.': [1458, 1475, 1481], 'Endocrinol.': [1460], '1997;': [1461], '11:': [1462, 5387], '1881-1890Crossref': [1463], '(pCEP.c-Myc)': [1469], '(21Lynch': [1470], 'Ravitz': [1474], 'Mehtani': [1476], 'Korenblat': [1478], 'Pazin': [1480], 'Schmidt': [1482, 5589], 'E.V.': [1483], '2005;': [1487, 5199, 5290], '25:': [1488], '6436-6453Crossref': [1489], '(102)': [1492], 'Scholar)': [1494, 3426, 4518, 5007], 'plasmids': [1496], 'also': [1498, 1549, 2184, 2924, 3018, 3123, 3467, 3554, 3692, 3952, 3988, 4020, 4222, 4520, 4652, 4719, 5023, 5072, 5242, 5431], 'transient': [1501, 4160], 'transfections.': [1502], 'Cell': [1503, 2103, 2133, 4460, 4939, 5382], 'Culture—The': [1504], 'Caco2': [1510, 2186, 2729, 3367, 3440, 3498, 3657, 3697, 3840, 3926, 4096, 4226, 4975, 5043], 'DLD-1': [1512, 3442], '(American': [1513], 'Type': [1514], 'Culture': [1515], 'Collection)': [1516], 'maintained': [1518], 'recommended': [1520], 'medium.': [1522], 'Two': [1523], 'knock-down': [1526], 'clones': [1527], 'each': [1529, 2447], 'line': [1531], '(HIF-kd1470': [1532], 'HIF-kd2192)': [1534], 'control': [1539, 2171, 4192], 'transfected': [1543, 1952, 2189, 3924], 'with': [1544, 1589, 1677, 1839, 1886, 1907, 1966, 2040, 2074, 2190, 2295, 2411, 2504, 2538, 2789, 2895, 3360, 3575, 3684, 3781, 4042, 4191, 4273, 4931, 5088, 5608], 'empty': [1545, 1960], 'pSuper.retro': [1546], '(HIF-wt)': [1547], 'utilized': [1550, 2128, 2491, 3448, 3645, 3789], 'Hypoxic': [1573], 'achieved': [1576, 4275], 'culturing': [1578], 'sealed': [1583], 'chamber': [1585], '(Billups-Rothenberg)': [1586], 'after': [1587, 1798, 1862, 2210, 2236, 4176], 'flushing': [1588], 'mixture': [1591], '1%': [1593, 2024], 'O2,': [1594], '5%': [1595], 'CO2,': [1596], '94%': [1598], 'N2': [1599], 'To': [1622, 2865, 3334, 3472, 3816, 3901, 4107, 4151], 'minimize': [1623], 'effect': [1625, 2202, 2221, 3527, 3594, 3876, 4171, 4231, 4577, 4639, 4751], 'serum': [1627], 'factors,': [1629], 'culture': [1632, 1837, 1859], 'medium': [1633, 1860], 'switched': [1635, 1864], 'serum-free': [1637], 'UltraCulture': [1638, 1866], '(Chambrex)': [1639], 'before': [1640], 'cells': [1642, 1674, 1750, 1840, 1852, 1904, 1992, 2003, 2187, 2458, 3370, 3443, 3499, 3658, 3677, 3698, 3841, 3927, 4097, 4227, 4337, 4976, 5044, 5599], 'subjected': [1644, 1993], 'specific': [1648, 2336, 2612, 2625, 2760, 3166, 3782, 4163, 4596, 4645], 'inhibitors': [1649, 3880], 'PD98059,': [1650], 'LY294002,': [1651, 3110], 'Y27632': [1653, 3168, 3893, 4287], '(Calbiochem)': [1654, 1684], 'added': [1656], '1–2': [1657], 'h': [1658, 1687, 1761, 2209, 2235, 2468, 4175], 'prior': [1659, 1688, 1762, 3928], 'exposure': [1661, 2742], 'normoxia': [1663, 1872, 1995, 2985], 'concentrations': [1668], 'indicated.': [1669], 'selected': [1671], 'experiments,': [1672], 'treated': [1676], '2.5': [1678, 2026], 'μg/ml': [1679, 1768], 'Clostridium': [1680], 'botulinum': [1681], 'exoenzyme': [1682, 3153], 'C3': [1683, 3152], '12': [1686], 'incubation': [1690], 'Northern': [1694, 1801], 'Blot': [1695], 'Analysis—Total': [1696], 'RNA': [1697, 1708, 1736, 1773], 'TRIzol': [1701], 'reagent': [1702, 2473], '(Invitrogen).': [1703, 2262, 2571], 'Fifteen': [1704], 'μg': [1705, 1879, 1941, 2048, 2431, 2532], 'total': [1707, 1949, 2085, 2089, 2093, 2098], 'analyzed': [1710, 1748, 2659], 'random': [1713], 'prime-labeled': [1714], '400-bp': [1715], 'cDNA': [1718], '18': [1733, 1795, 2264, 2276, 2341, 2374], 'S': [1734, 1796, 2265, 2277, 2342, 2375], 'ribosomal': [1735], 'loading': [1741], 'control.': [1742, 1895, 2270], 'mRNA': [1744, 1788, 2769, 2799, 2813, 2819, 2900, 4240, 4255, 4630, 4764, 5188], 'decay': [1745, 2800, 2834], 'rates': [1746], 'utilizing': [1749, 2395, 2469, 2603, 2758, 3694], 'cultured': [1753, 2459], 'under': [1754], '10': [1760, 1767, 2467], 'addition': [1765, 2827, 4278], 'actinomycin': [1769], 'D': [1770], '(Sigma).': [1771], 'Total': [1772], 'isolated': [1775, 3655], '0,': [1777], '2,': [1778], '4,': [1779, 3994], '6': [1781], 'h,': [1782], 'level': [1785, 2388, 4268], 'normalized': [1790, 2371], 'amount': [1793, 1950, 2368], 'rRNA': [1797, 2266, 2278], 'densitometry': [1799], 'blots.': [1802], 'All': [1803, 1828], 'time': [1806, 2313, 4263], 'points': [1807], 'triplicate.': [1811], 'Transfections': [1812], 'Reporter': [1814], 'Assays—Transient': [1815], 'transfections': [1816], 'Lipofectamine': [1820, 2196], '2000': [1821, 2197], '(Invitrogen)': [1822, 2061], 'according': [1823, 2525], "manufacturer's": [1826, 2528], 'specifications.': [1827], 'experiments': [1831, 1975], '24-well': [1835], 'tissue': [1836], 'plates': [1838], 'plated': [1841], 'reach': [1843], '50–60%': [1844], 'confluence': [1845], 'on': [1846, 2054, 2224, 2675, 2898, 3531, 3881, 3915, 4172, 4235, 4582, 4789, 5238, 5315], 'day': [1848], 'transfection.': [1850, 2211, 2237], 'allowed': [1854], 'recover': [1856], 'regular': [1858], 'overnight': [1861], 'transfection,': [1863], 'medium,': [1867], 'then': [1869, 2936], 'exposed': [1870], '24': [1876], 'h.': [1877], '0.4–0.6': [1878], 'VEGF-luciferase': [1881], 'co-transfected': [1885, 1906, 2217, 4190], '2': [1887, 2286], 'ng': [1888], 'pRL-CMV': [1890, 1920], '(Promega)': [1891], 'transfection': [1894, 4161, 4177], 'pRL-null,': [1896], 'promoter-less': [1898], 'Renilla': [1899], 'construct,': [1900, 4072], 'vector,': [1911], 'Ras': [1913, 2676, 4597, 4609], 'has': [1914, 4585, 4656, 5179, 5362], 'induce': [1918], 'plasmid': [1921], '(22Behre': [1922], 'Smith': [1924], 'L.T.': [1925], 'Tenen': [1926, 5576], 'D.G.': [1927], 'BioTechniques.': [1928], '26': [1930], '(28):': [1931], '24-26Crossref': [1932], '(69)': [1935], 'As': [1938, 3093, 3764], 'indicated,': [1939], '0.2': [1940], 'vector': [1944], 'co-transfected,': [1946], 'DNA': [1953, 2568], 'kept': [1955], 'constant': [1956], 'adding': [1958], 'corresponding': [1959], 'plasmid.': [1961], 'Luciferase': [1962], 'activity': [1963, 2910, 2918, 2983, 4635, 4758], 'measured': [1965, 4260], 'dual': [1968, 2229], 'assay': [1971, 2399, 3078], 'system': [1972, 2308], '(Promega).': [1973], 'duplicate': [1979], 'wells': [1980], 'minimum': [1982], 'three': [1984], 'times.': [1985], 'Western': [1986, 2112, 2206, 2424, 2437, 3825], 'Blotting—Protein': [1987], 'lysates': [1988, 2433], 'harvested': [1990], 'indicated': [2000, 4955, 5322], 'periods.': [2001], 'lysed': [2005], 'chilled': [2007], 'lysis': [2008], 'buffer': [2009, 2546], '(20': [2010], 'mm': [2011, 2016, 2019, 2022, 2027, 2031, 2034, 2037, 2558], 'Tris-HCl,': [2012], 'pH': [2013], '7.6,': [2014], '150': [2015], 'NaCl,': [2017], '1': [2018, 2021, 2030, 2033, 2036, 2403], 'Na2EDTA,': [2020], 'EGTA,': [2023], 'Triton,': [2025], 'sodium': [2028], 'pyrophosphate,': [2029], 'β-glycerophosphate,': [2032], 'Na3VO4,': [2035], 'leupeptin)': [2038], 'supplemented': [2039], 'Pefabloc': [2042], 'SC': [2043], '(Roche': [2044, 2579], 'Applied': [2045, 2580], 'Science).': [2046], '20–30': [2047], 'extracts': [2051, 2454, 2535, 3653, 3675, 3695], 'resolved': [2053], '4–12%': [2056], 'NuPAGE': [2057], 'Bis-Tris': [2058], 'polyacrylamide': [2059], 'gel': [2060, 3883, 3916], 'transferred': [2063, 2575], 'onto': [2064, 2566, 2576], 'polyvinylidene': [2066], 'difluoride': [2067], 'membrane': [2068], '(Millipore).': [2069], 'blots': [2071], 'probed': [2073], '(Transduction': [2077], 'Laboratories;': [2078], '1:250),': [2079, 2082], 'HIF-2α': [2080, 3506, 3514], '(Novus;': [2081], 'phospho-': [2083, 2087, 2091, 2096], 'ERK1/2,': [2086, 4647], 'p38,': [2094], 'JNK': [2099], 'antibody': [2100], '(all': [2101], 'Signaling;': [2104, 2134], '1:1000).': [2105], 'Immunoreactive': [2106], 'proteins': [2107], 'visualized': [2109], 'Lighting': [2113], 'Chemiluminescence': [2114], 'Reagent': [2115], 'Plus': [2116], '(PerkinElmer': [2117], 'Life': [2118], 'Sciences).': [2119], 'Analysis—To': [2121], 'silence': [2122], '(SignalSilence': [2129], 'kit,': [2132], 'originally': [2136], 'validated': [2139], 'Ref.': [2141], '23Williams': [2142], 'N.S.': [2143], 'Gaynor': [2144], 'R.B.': [2145], 'Scoggin': [2146], 'Verma': [2148], 'Gokaslan': [2150], 'Simmang': [2152], 'C.': [2153, 2161, 4458, 5151], 'Fleming': [2154], 'Tavana': [2156], 'Frenkel': [2158], 'Becerra': [2160], 'Clin.': [2162], '9:': [2166, 3063], '931-946PubMed': [2167], 'correspond': [2176], 'any': [2178], 'known': [2179, 3733], 'gene': [2181, 2337, 2875, 5344], '(5′-CGUACGCGGAAUACUUCGA)': [2182], 'utilized.': [2185, 2883], '200': [2191], 'nm': [2192], 'duplexes': [2194, 3920], '(Invitrogen),': [2198], 'confirmed': [2204, 2601], 'blotting': [2207, 2425, 2438, 3826], '48': [2208, 2234, 4174], 'examine': [2219, 3817], 'activity,': [2227], 'Real': [2238], 'Time': [2239], 'PCR': [2240, 2252, 2283, 4264], 'Assay—RNA': [2241], 'extracted': [2243], 'RNeasy': [2245], 'kit': [2246, 2400, 2523], '(Qiagen)': [2247], 'quantitative': [2249], 'reverse': [2250], 'SuperScript': [2256], 'III': [2257], 'platinum': [2258], 'Two-Step': [2259], 'qRT-PCR': [2260], 'Kit': [2261], 'served': [2267], 'endogenous': [2269, 2899, 4236], 'Primer': [2271], 'available': [2280], 'request.': [2282], 'cycles': [2284, 2294], 'were:': [2285], 'min': [2287], '95': [2289], '°C,': [2290], 'followed': [2291], '40': [2293], 'annealing': [2296], 'temperature,': [2297], '55': [2298], '°C.': [2299], 'fluorogenic': [2301], 'SYBR': [2302], 'Green': [2303], 'MJ': [2305], 'research': [2306], 'detection': [2307], 'real': [2312, 4262], 'quantification.': [2314], 'results': [2316, 2842, 2922, 3456, 4031, 5091, 5321, 5532], 'presented': [2318], 'parameter': [2320], 'threshold': [2321], 'cycle': [2322], '(CT)': [2323], 'values.': [2324], 'ΔCT': [2325], 'difference': [2328, 2348], 'CT': [2331], 'values': [2332, 2666], 'being': [2338], 'assayed': [2339], 'rRNA,': [2343], 'whereas': [2344, 2913], 'ΔΔCT': [2345, 2358], 'represented': [2346], 'paired': [2351], 'samples,': [2352], 'calculated': [2354], 'formula': [2357], '=ΔCT': [2359], 'sample': [2362], '–ΔCT': [2363], 'reference.': [2366], 'target,': [2370], 'reference,': [2380], 'expressed': [2382, 3555], '2–ΔΔCT.': [2384], 'GST-Rhotekin': [2385], 'Pulldown': [2386], 'Assay—The': [2387], 'activated,': [2390, 3832], 'GTP-bound': [2391, 2419, 3103, 4866], 'Rho': [2392, 2397, 2420, 3009, 3076, 3116, 3128, 3148, 4884, 4894, 4916, 4968], 'assessed': [2394], '(Upstate).': [2401], 'Briefly,': [2402, 2530], 'mg': [2404], 'whole': [2406], 'lysate': [2408], 'incubated': [2410, 2537, 3683, 5046], 'GST-tagged': [2412], 'recombinant': [2413], 'Rho-binding': [2414], 'domain': [2415, 4927], 'Rhotekin.': [2417], 'Precipitated': [2418], 'detected': [2422, 2587], 'RhoA': [2428, 2444], 'antibody.': [2429], 'Twenty': [2430], 'determine': [2440, 2805, 3082, 4109], 'sample.': [2448], 'Mobility': [2450], 'Shift': [2451], 'Assay': [2452], '(EMSA)—Nuclear': [2453], 'either': [2461, 3562, 3661], 'NE-PER': [2470], 'nuclear': [2471, 2534, 3674, 3931], 'extraction': [2472], '(Pierce).': [2474], 'Sequences': [2475], 'divided': [2486, 3639], 'into': [2487, 3640, 3925], 'five': [2488, 3641], 'fragments': [2489, 3642], 'oligonucleotide': [2493, 2644, 3685], 'probes': [2494, 2645, 3647, 3780], '(Table': [2495, 3650], '1).': [2496, 3651], '3′-ends': [2498], 'oligonucleotides': [2501, 2510, 2543, 2609], 'labeled': [2503], 'biotin': [2505], 'during': [2506, 2726, 3590, 3873, 4118, 4301], 'synthesis,': [2507], 'complementary': [2509], 'annealed': [2512], 'generate': [2514], 'double-stranded': [2515], 'fragments.': [2516], 'EMSA': [2517, 3649], 'LightShift': [2521], 'chemiluminescent': [2522, 2595], '(Pierce)': [2524], 'protocol.': [2529], '5': [2531, 2557], '20': [2539], 'fmol': [2540], 'biotinylated': [2542], '50': [2548], 'ng/μl': [2549], 'poly(dI-dC),': [2550], '0.05%': [2551], 'Nonidet': [2552], 'P-40,': [2553], '2.5%': [2554], 'glycerol,': [2555], 'MgCl2,': [2559], 'reaction': [2562], 'mix': [2563], 'loaded': [2565], '6%': [2567], 'retardation': [2569], 'gels': [2570], 'DNA-protein': [2572], 'complexes': [2573], 'nylon': [2577], 'membranes': [2578], 'Science),': [2581], 'streptavidin-horseradish': [2590], 'peroxidase': [2591], 'conjugate': [2592], 'substrate.': [2596], 'Specificity': [2597], 'shifts': [2599, 2626], '200-fold': [2604], 'molar': [2605], 'excess': [2606], 'unbiotinylated': [2608], 'competitor.': [2613], 'Mutagenesis': [2614], 'further': [2618, 3140, 3335, 3613, 4152, 5125, 5525], 'responsible': [2622, 3339], 'obtained,': [2627, 3458], 'Table': [2631, 3767], '1.': [2632], 'Oligonucleotide': [2633], '4mut-271': [2634], 'includes': [2635], 'mutations': [2636, 3783], 'disrupt': [2638], 'site.TABLE': [2641], '1Sequences': [2642], 'EMSAOligonucleotidesSequences15′-CCAATAGATCTGTGTGTCCCTCTCCCCACCCGTCCCTGTCCGGCTCTCC25′-CTCTCCGCCTTCCCCTGCCCCCTTCAATATTCCTAGCAAAGAGGGA35′-AAGAGGGAACGGCTCTCAGGCCCTGTCCGCACGTAACCTCACTTTC45′-CTTTCCTGCTCCCTCCTCGCCAATGCCCCGCGGGCGCGTGTCTCTGGACA55′-GGACAGAGTTTCCGGGGGCGGATGGGTAATTTTCAGCT4mut-2715′-CTTTCCTGCTCCCTCCTCGCCAATGCCCCGCGGGCGAAAGTCTCTGGACA': [2648], 'Open': [2649], 'table': [2650], 'tab': [2654], 'Statistical': [2655], 'Analysis—Statistical': [2656], 'differences': [2657], "Student's": [2661], 't': [2662], 'test,': [2663], 'p': [2665, 4205], '<0.05': [2667], 'statistically': [2670], 'significant.': [2671], 'Effect': [2672], 'Effector': [2677], 'Pathways—We': [2678], 'oncogenic': [2686, 3137, 3529, 4874], 'synergistically': [2689], 'up-regulate': [2690, 4959, 5342], 'thus': [2715, 3429, 3582], 'identify': [2718, 2939, 3235], 'which': [2719, 2975, 3349, 4655, 5555], 'p38': [2736], '(Fig.': [2746, 2783, 2892, 2919, 3007, 3133, 3204, 3371, 3449, 3558, 3687, 3704, 3814, 3861, 3888, 3944, 3982, 3993, 4077, 4147, 4178, 4208, 4265, 5499], '1A).': [2747], 'pathway': [2753, 2847, 3738, 4617, 5070, 5502], 'examined': [2757], 'inhibitor': [2761, 3167, 4624, 4971], 'LY294002.': [2762], 'LY294002': [2763, 2829, 2902, 3891, 3967, 4280, 4882, 5065], '40%': [2773], 'did': [2775, 2999, 4626, 4760, 4774, 5304], 'so': [2776], 'without': [2777], 'blocking': [2778], '1B).': [2784], 'contrast,': [2786, 4734], 'MEK': [2787, 4623], 'inhibition': [2788, 4270, 4735, 4754, 4771], 'PD98059': [2790, 2914, 4625, 4641], 'failed': [2791, 2830, 3286, 4720], 'suppress': [2793, 4661, 4776], 'whether': [2806, 3083, 5131], 'increasing': [2812], 'stability.': [2814, 4765], 'Although': [2815, 3275, 4010, 4367, 4614], 'significantly': [2821], 'increased': [2822, 3844], 'its': [2823, 3243, 3999, 4110, 4154], 'half-life': [2824], '(3.7-fold),': [2825], 'alter': [2832, 4063, 4762], 'pattern': [2835], '(data': [2838, 4977], 'shown).': [2840, 4979], 'occurs': [2857], 'post-transcriptional': [2863], 'mechanisms.': [2864], 'confirm': [2866, 3902], 'transcription,': [2876], '2.3-kb': [2887], 'almost': [2890, 5061], '3-fold': [2891], '1C).': [2893, 2920, 3008], 'Consistent': [2894, 2921], 'effects': [2897, 4786, 5235], 'levels,': [2901], '89%,': [2912], 'had': [2915], 'no': [2916, 3511, 4137, 5114], 'inhibitory': [2917, 5234], 'obtained': [2925, 3671, 3794], 'respectively,': [2932], 'expressed.': [2934], 'downstream': [2941, 3012, 3869], 'effectors': [2942], 'PI3K.': [2944, 3221], 'Akt': [2945, 4798, 4831], 'important': [2948, 3807, 4835, 5434], '(24Chen': [2957], 'E.Y.': [2958, 4474], 'Mazure': [2959], 'N.M.': [2960], 'Cooper': [2961], 'Giaccia': [2963, 4481], 'A.J.': [2964, 4482], '2429-2433PubMed': [2969], 'negative-Akt,': [2974], 'block': [3001, 3288, 4628], 'another': [3011, 5140], '(25Matsui': [3022], 'Amano': [3024], 'Yamamoto': [3026], 'Chihara': [3028], 'Nakafuku': [3030], 'Ito': [3032], 'Nakano': [3034], 'Okawa': [3036], 'Iwamatsu': [3038], 'Kaibuchi': [3040], '2208-2216Crossref': [3046], '(943)': [3049], '26Sahai': [3052], 'Ishizaki': [3054], 'Narumiya': [3056], 'Treisman': [3058], '136-145Abstract': [3064], '(187)': [3072], 'Fig.': [3096, 3521], '2A,': [3097], 'inhibited': [3108, 3150, 3163, 3860], 'indicating': [3111, 4783], 'activate': [3115], 'PI3K-dependent': [3119], 'There': [3121, 3706, 4079, 4166], 'synergistic': [3125, 3549, 3568, 4576], '2B),': [3134], 'suggesting': [3135, 3800], 'PI3K-Rho': [3142], 'When': [3147, 3439, 3779], '(27Watnick': [3169, 3739, 4983, 5400], 'Cheng': [3171, 3741, 4985, 5402], 'Y.N.': [3172, 3742, 4986, 5403], 'Rangarajan': [3173, 3743, 4987, 5404], 'Ince': [3175, 3745, 4989, 5406], 'T.A.': [3176, 3746, 4990, 5149, 5407], 'Weinberg': [3177, 3747, 4991, 5408], 'R.A.': [3178, 3748, 4992, 5409], '219-231Abstract': [3183, 3753, 4997, 5414], '(284)': [3191, 3761, 5005, 5422], 'strongly': [3202, 4738], '2C).': [3205], 'Thus,': [3206, 5068], 'Rho/ROCK': [3209, 3737, 4852, 5273], 'Identification': [3222, 3601], 'Novel': [3225], 'Regulatory': [3226, 3605], 'Region': [3227], 'Promoter': [3231], 'Responsive': [3232, 3607], 'Hypoxia—To': [3234], 'mediate': [3242, 4855], 'hypoxia,': [3246, 3591, 3631, 4119, 4258, 4782, 5328, 5535], 'serial': [3250], '5′': [3251], 'deletions': [3252, 3344], '–975': [3284], 'induction,': [3291], 'dramatic': [3293], 'reduction': [3294, 4083, 4211, 4252, 4282, 4289], 'observed': [3300, 3516, 3574, 3693, 3953, 5041, 5540], 'regulation,': [3342], 'performed.': [3346, 3496, 3634], 'contains': [3350], 'responded': [3359], '2.2-fold': [3362], '3A).': [3372], 'fell': [3377], '1.3-fold': [3379], 'deleted.': [3388], 'contain': [3400, 3430, 4923], 'HIF-1-binding': [3403], 'deficient': [3444, 3500, 3699], '3B': [3450], 'data': [3452], 'shown),': [3454], 'similar': [3455], 'confirming': [3459], 'other': [3463], 'than': [3464], 'verify': [3473, 4153], 'absence': [3482], 'compensatory': [3490], 'up-regulation': [3491, 3512], 'HIF-2,': [3493], 'immunoblots': [3494], 'HIF-1α,': [3502], 'nearly': [3508], 'undetectable,': [3509], '(supplemental': [3520], 'S1).': [3522], 'next': [3524], 'determined': [3525], '195-bp': [3533, 3636], 'fragment.': [3535, 3722], '2.3-fold,': [3543], 'there': [3545, 3769, 4135, 5112, 5228], 'strong': [3548, 4169], '(7-fold': [3556], 'up-regulation)': [3557], '3C).': [3559], 'response.': [3569], 'No': [3570], 'such': [3571], '0.56-kb': [3577], 'pathway.': [3600, 5109, 5530], 'Critical': [3604], 'Element': [3606], 'bp—To': [3612], 'EMSAs': [3632], 'Nuclear': [3652], 'band': [3668, 3913, 3943, 3950, 3961, 3972, 3986], 'grown': [3678], '4': [3686], '4A).': [3688], '(Caco2-HIF-kd1470': [3702], 'cells)': [3703], '4B).': [3705], 'several': [3708], 'factor-binding': [3711], 'sites': [3712, 3787], 'AP2,': [3714], 'Egr-1,': [3715], 'Ets-1,': [3716], 'particularly': [3725, 5438, 5446], 'curious': [3726, 4590], 'about': [3727], '1,': [3768], 'putative': [3772, 4065], '5′-GCGGGCGCGTGTCTC.': [3778], '(5′-GCGGGCGAAAGTCTC),': [3790], 'bands': [3793], 'lost,': [3799], 'play': [3805, 4021, 4521, 4601], 'regulating': [3810], '4C).': [3815, 3983], 'functional': [3819], 'interaction': [3820, 5119], 'detect': [3830], 'phosphorylated': [3833], 'form': [3834], '(Thr58/Ser62).': [3837], 'Incubation': [3838], 'phosphorylation': [3846, 5012, 5032, 5059], 'both': [3854, 3966], 'specifically': [3859, 5356], '4D).': [3862], 'suggests': [3864], 'chemical': [3879], 'patterns': [3885], 'evaluated': [3887, 4323], '4E).': [3889], 'Both': [3890], 'band.': [3900], 'assays,': [3918], 'harvesting': [3930], 'extracts.': [3932], 'Silencing': [3933], 'completely': [3936, 5062], 'shifted': [3942], '4F).': [3945], 'second': [3947], 'faster': [3948], 'migrating': [3949], 'conditions,': [3956], 'similarly': [3963], 'Y27632.': [3969, 5067], 'identifiable': [3975], 'probe': [3979], 'B),': [3997], 'making': [3998], 'possible': [4000, 4902, 5398], 'less': [4008], 'clear.': [4009], 'cannot': [4012], 'rule': [4013], 'out': [4014], 'interacts': [4041], 'Role': [4050], 'Regulation': [4055], 'VEGF—Site-directed': [4057], 'c-Myc-binding': [4066], 'referred': [4073], 'mut-271-luc': [4076], '5A).': [4078], '62%': [4082], '(p': [4084], '<': [4085, 4206], '0.01)': [4086, 4207], 'mutated.': [4106], 'directly': [4108, 5134], 'overexpressed': [4122, 5455], 'cells.': [4125], 'wild-type': [4129], '1.6-fold,': [4133], 'Myc-Max': [4141], '–271bp': [4144], '5A,': [4148], 'right': [4149], 'panel).': [4150], 'role,': [4155], 'silenced': [4158], 'duplexes.': [4165], '5B).': [4179, 4209], '2.1-fold': [4185], '1.6-fold': [4199], '(56%': [4203], 'reduction,': [4204], 'directed': [4218], 'HIF-1α-deficient': [4225], '(HIF-kd1470).': [4228], 'Finally,': [4229], 'determined.': [4242], 'Transfection': [4243], 'resulted': [4248], '43%': [4251], '5C).': [4266], 'comparable': [4272], '(38%': [4281], 'mRNA)': [4285], '(29%': [4288], 'mRNA).': [4292], 'indicate': [4295], 'least': [4306], 'partially': [4307], 'explain': [4308, 5073], 'HIF-1.': [4318, 4797, 5560], 'previous': [4320, 5086], 'studies,': [4321, 5031], 'necessary': [4344], 'generally': [4370], 'mediator': [4376], '(28Iyer': [4381], 'Kotch': [4383], 'Wenger': [4391], 'R.H.': [4392], 'Gearhart': [4395], 'J.D.': [4396], 'Lawler': [4397], 'A.M.': [4398], 'Yu': [4399, 5374], 'A.Y.': [4400], 'Genes': [4403, 5166], '149-162Crossref': [4407], '(2068)': [4410], 'appears': [4414, 5509], 'mediator.': [4420], 'For': [4421], 'example,': [4422], 'Sp-1': [4430], '(29Kaluz': [4431], 'Kaluzova': [4433], 'Stanbridge': [4435], 'E.J.': [4436], '63:': [4440], '917-922PubMed': [4441], 'AP-1': [4444], '(30Minet': [4445], 'Michel': [4447], 'Mottet': [4449], 'Piret': [4451], 'Barbieux': [4453], 'Raes': [4455], 'Michiels': [4457], 'Exp.': [4459, 4938], '265:': [4463], '114-124Crossref': [4464], '(78)': [4467, 5224], 'NF-κB': [4470], '(31Koong': [4471], 'A.C.': [4472, 5161], 'Mivechi': [4475], 'N.F.': [4476], 'Denko': [4477], 'N.C.': [4478], 'Stambrook': [4479], 'P.': [4480, 5191], '54:': [4486], '5273-5279PubMed': [4487], 'Egr-1': [4491], '(32Yan': [4492], 'S.F.': [4493], 'Fujita': [4494], 'Lu': [4496], 'Okada': [4498], 'Shan': [4500], 'Zou': [4501], 'Mackman': [4503], 'Pinsky': [4505], 'Stern': [4507], '6:': [4512], '1355-1361Crossref': [4513], '(402)': [4516], 'hypoxia-responsive': [4528], 'genes.': [4529], 'Our': [4549, 5320, 5425], 'alternative,': [4564], 'Because': [4574], 'observed,': [4587], 'roles': [4594], 'major': [4608, 4801], 'effectors,': [4610], 'PI3K/Akt.': [4613], 'appeared': [4618, 4746], 'potentially': [4651], 'ERK5,': [4654], 'recently': [4657, 5008], '(33Kamakura': [4667], 'Moriguchi': [4669], 'Nishida': [4671], '274:': [4677], '26563-26571Abstract': [4678], '(458)': [4686], '34Sohn': [4689], 'S.J.': [4690], 'Sarvis': [4691], 'B.K.': [4692], 'Cado': [4693], 'Winoto': [4695], '277:': [4701], '43344-43351Abstract': [4702], '(156)': [4710], 'ERK1/2': [4718, 4726], 'demonstrate': [4722, 5533], 'suppressed': [4755], 'It': [4766], 'should': [4767], 'noted': [4769], 'but,': [4827], 'our': [4829, 5030, 5090], 'surprise,': [4830], 'Instead,': [4842], 'combination': [4870], 'synergistic.': [4877], 'dose-dependent': [4888], 'precise': [4891], 'remains': [4896], 'defined,': [4899], 'one': [4901, 5397], 'explanation': [4903], 'could': [4904], 'involve': [4905], 'guanine': [4906, 4912], 'exchange': [4907, 4913, 4961], 'family': [4917], 'GTPases': [4918], 'pleckstrin': [4925], 'homology': [4926], 'interact': [4930], '3,4,5-triphosphate': [4933], '(35Vanhaesebroeck': [4934], '253:': [4942], '239-254Crossref': [4943], '(764)': [4946], 'Of': [4949, 5359], 'note,': [4950, 5360], 'preliminary': [4951], 'microarray': [4952], 'Rho-guanine': [4960], '70.4%': [4965], 'down-regulate': [4967], 'GDP': [4969], 'dissociation': [4970], '64.8%': [4973], 'Watnick': [4980], 'et': [4981], 'al.': [4982], 'H-ras-mediated': [5011], 'Ser62': [5016, 5039], 'Ser71': [5018], 'cascade': [5022], 'involving': [5024], 'ROCK.': [5028], 'residues': [5036], 'Thr58': [5037], 'depended': [5050], 'PI3K-mediated': [5075], 'states': [5080], 'contrast': [5084], 'H-ras,': [5089], 'isoform': [5096], 'most': [5099], 'cancers': [5104], 'enhanced': [5105], 'Thus': [5110], 'far,': [5111], 'evidence': [5115], 'showing': [5116], 'direct': [5118], 'required': [5128], 'clarify': [5130], 'phosphorylate': [5135], 'indirectly': [5138], 'positively': [5144], '(36Baudino': [5148], 'McKay': [5150], 'Pendeville-Samain': [5152], 'Nilsson': [5154], 'Maclean': [5156], 'K.H.': [5157], 'White': [5158], 'E.L.': [5159], 'Davis': [5160], 'Ihle': [5162], 'J.N.': [5163], 'Cleveland': [5164], 'J.L.': [5165], '2530-2543Crossref': [5170], '(376)': [5173], 'addition,': [5177], 'translation': [5189], '(37Mezquita': [5190], 'Parghi': [5192], 'S.S.': [5193], 'Brandvold': [5194], 'K.A.': [5195], 'Ruddell': [5196], 'Oncogene.': [5198], '24:': [5200], '889-901Crossref': [5201], '(58)': [5204], '38Knies-Bamforth': [5207], 'U.E.': [5208], 'Fox': [5209], 'S.B.': [5210], 'Poulsom': [5211], 'Evan': [5213], 'G.I.': [5214], 'Harris': [5215], 'A.L.': [5216], '6563-6570Crossref': [5221], 'some': [5230, 5553], 'conflicting': [5231], 'results,': [5232], '(39Barr': [5245], 'L.F.': [5246], 'Campbell': [5247], 'S.E.': [5248], 'Diette': [5249], 'G.B.': [5250], 'Gabrielson': [5251], 'E.W.': [5252], 'Kim': [5253], 'Shim': [5255], 'Dang': [5257], 'C.V.': [5258, 5369], '143-149PubMed': [5263], 'Other': [5266], 'down-regulation': [5277], 'TGF-β': [5281, 5312], '(40Kamaraju': [5283], 'A.K.': [5284], 'Roberts': [5285], 'A.B.': [5286], '280:': [5291], '1024-1036Abstract': [5292], '(200)': [5300], 'address': [5306], 'events': [5309], 'triggered': [5310], 'focused': [5314], 'Myc/Max-binding': [5334], 'Its': [5347], 'verified': [5350], 'siRNAs': [5355], 'targeting': [5357], 'linked': [5364], '(41Ngo': [5368], 'Gee': [5370], 'Akhtar': [5372], 'Volpert': [5376], 'Auerbach': [5378], 'Thomas-Tikhonenko': [5380], 'Growth': [5383], '&': [5384], 'Differ.': [5385], '201-210PubMed': [5388], 'thrombospondin-1': [5394], 'relevant': [5447], 'cancer,': [5450], 'commonly': [5454], 'type': [5459], '(42Erisman': [5460], 'Rothberg': [5462], 'P.G.': [5463], 'Diehl': [5464], 'R.E.': [5465], 'Morse': [5466], 'C.C.': [5467], 'Spandorfer': [5468], 'Astrin': [5470], 'S.M.': [5471], '1985;': [5475], '5:': [5476], '1969-1976Crossref': [5477], '(202)': [5480], 'summary,': [5484], '6).': [5500], 'Oncogenic': [5522], 'stimulus': [5538], 'within': [5541], 'tumors,': [5543], 'stimulate': [5545], 'angiogenesis,': [5552], 'thank': [5562, 5593], 'following': [5564, 5570], 'individuals': [5565], 'generously': [5567], 'sharing': [5568, 5597], 'plasmids:': [5571], 'Ramnik': [5572], '(K-rasV12),': [5574], 'Daniel': [5575], '(pRL-null),': [5577], 'Masato': [5578], '(dnPI3K),': [5580], 'Michael': [5581], '(dnAkt),': [5583], 'Timothy': [5584], 'Wang': [5585], '(dnERK),': [5586], 'Emmett': [5588], '(pCEP.c-Myc),': [5590], 'Othon': [5594], '786-0': [5598], 'VHL.': [5602], 'Download': [5603], '.pdf': [5604], '(.18': [5605], 'MB)': [5606], 'Help': [5607], 'pdf': [5609], 'files': [5610]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W1993868761', 'counts_by_year': [{'year': 2024, 'cited_by_count': 2}, {'year': 2023, 'cited_by_count': 4}, {'year': 2021, 'cited_by_count': 3}, {'year': 2020, 'cited_by_count': 2}, {'year': 2019, 'cited_by_count': 3}, {'year': 2018, 'cited_by_count': 3}, {'year': 2017, 'cited_by_count': 3}, {'year': 2016, 'cited_by_count': 7}, {'year': 2015, 'cited_by_count': 3}, {'year': 2014, 'cited_by_count': 5}, {'year': 2013, 'cited_by_count': 7}, {'year': 2012, 'cited_by_count': 7}], 'updated_date': '2024-12-14T05:45:22.712211', 'created_date': '2016-06-24'}