Human Ikaros Function in Activated T Cells Is Regulated by Coordinated Expression of Its Largest Isoforms

Name: Human Ikaros Function in Activated T Cells Is Regulated by Coordinated Expression of Its Largest Isoforms
Uploaded: 2006-11-30

Tapani Ronni; Kimberly J. Payne; Sam Ho; Michelle N. Bradley; Glenn Dorsam; Sinisa Dovat

Basic Information

ID: W1989718163
Title: Human Ikaros Function in Activated T Cells Is Regulated by Coordinated Expression of Its Largest Isoforms
Abstract: The Ikaros gene is alternately spliced to generate multiple zinc finger proteins involved in gene regulation and chromatin remodeling. Whereas murine studies have provided important information regarding the role of Ikaros in the mouse, little is known of Ikaros function in human. We report functional analyses of the two largest human Ikaros (hIK) isoforms, hIK-VI and hIK-H, in T cells. Abundant expression of hIK-H, the largest described isoform, is restricted to human hematopoietic cells. We find that the DNA binding affinity of hIK-H differs from that of hIK-VI. Co-expression of hIk-H with hIk-VI alters the ability of Ikaros complexes to bind DNA motifs found in pericentromeric heterochromatin (PC-HC). In the nucleus, hIK-VI is localized solely in PC-HC, whereas the hIK-H protein exhibits dual centromeric and non-centromeric localization. Mutational analysis defined the amino acids responsible for the distinct DNA binding ability of hIK-H, as well as the sequence required for the specific subcellular localization of this isoform. In proliferating cells, the binding of hIK-H to the upstream regulatory region of known Ikaros target genes correlates with their positive regulation by Ikaros. Results suggest that expression of hIK-H protein restricts affinity of Ikaros protein complexes toward specific PC-HC repeats. We propose a model, whereby the binding of hIK-H-deficient Ikaros complexes to the regulatory sequence of target genes would recruit these genes to the restrictive pericentromeric compartment, resulting in their repression. The presence of hIK-H in the Ikaros complex would alter its affinity for PC-HC, leading to chromatin remodeling and activation of target genes. The Ikaros gene is alternately spliced to generate multiple zinc finger proteins involved in gene regulation and chromatin remodeling. Whereas murine studies have provided important information regarding the role of Ikaros in the mouse, little is known of Ikaros function in human. We report functional analyses of the two largest human Ikaros (hIK) isoforms, hIK-VI and hIK-H, in T cells. Abundant expression of hIK-H, the largest described isoform, is restricted to human hematopoietic cells. We find that the DNA binding affinity of hIK-H differs from that of hIK-VI. Co-expression of hIk-H with hIk-VI alters the ability of Ikaros complexes to bind DNA motifs found in pericentromeric heterochromatin (PC-HC). In the nucleus, hIK-VI is localized solely in PC-HC, whereas the hIK-H protein exhibits dual centromeric and non-centromeric localization. Mutational analysis defined the amino acids responsible for the distinct DNA binding ability of hIK-H, as well as the sequence required for the specific subcellular localization of this isoform. In proliferating cells, the binding of hIK-H to the upstream regulatory region of known Ikaros target genes correlates with their positive regulation by Ikaros. Results suggest that expression of hIK-H protein restricts affinity of Ikaros protein complexes toward specific PC-HC repeats. We propose a model, whereby the binding of hIK-H-deficient Ikaros complexes to the regulatory sequence of target genes would recruit these genes to the restrictive pericentromeric compartment, resulting in their repression. The presence of hIK-H in the Ikaros complex would alter its affinity for PC-HC, leading to chromatin remodeling and activation of target genes. Ikaros expression is essential for proper stem cell function (1Nichogiannopoulou A. Trevisan M. Neben S. Friedrich C. Georgopoulos K. J. Exp. Med. 1999; 190: 1201-1214Crossref PubMed Scopus (184) Google Scholar) and for normal hematopoiesis in the lymphoid, myeloid, and erythroid lineages (2Wang J.H. Nichogiannopoulou A. Wu L. Sun L. Sharpe A.H. Bigby M. Georgopoulos K. Immunity. 1996; 5: 537-549Abstract Full Text PDF PubMed Scopus (505) Google Scholar, 3Lopez R.A. Schoetz S. DeAngelis K. O'Neill D. Bank A. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 602-607Crossref PubMed Scopus (85) Google Scholar, 4Papathanasiou P. Perkins A.C. Cobb B.S. Ferrini R. Sridharan R. Hoyne G.F. Nelms K.A. Smale S.T. Goodnow C.C. Immunity. 2003; 19: 131-144Abstract Full Text Full Text PDF PubMed Scopus (123) Google Scholar, 5Dumortier A. Kirstetter P. Kastner P. Chan S. Blood. 2003; 101: 2219-2226Crossref PubMed Scopus (68) Google Scholar). Loss of Ikaros function has been associated with development of human malignancies, (6Sun L. Heerema N. Crotty L. Wu X. Navara C. Vassilev A. Sensel M. Reaman G.H. Uckun F.M. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 680-685Crossref PubMed Scopus (170) Google Scholar, 7Nakayama H. Ishimaru F. Avitahl N. Sezaki N. Fujii N. Nakase K. Ninomiya Y. Harashima A. Minowada J. Tsuchiyama J. Imajoh K. Tsubota T. Fukuda S. Sezaki T. Kojima K. Hara M. Takimoto H. Yorimitsu S. Takahashi I. Miyata A. Taniguchi S. Tokunaga Y. Gondo H. Niho Y. Nakao S. Kyo T. Dohy H. Kamada N. Harada M. Cancer Res. 1999; 59: 3931-3934PubMed Google Scholar, 8Olivero S. Maroc C. Beillard E. Gabert J. Nietfeld W. Chabannon C. Tonnelle C. Br. J. Haematol. 2000; 110: 826-830Crossref PubMed Scopus (37) Google Scholar, 9Tonnelle C. Calmels B. Maroc C. Gabert J. Chabannon C. Leuk. Lymphoma. 2002; 43: 29-35Crossref PubMed Scopus (10) Google Scholar, 10Karlsson A. Soderkvist P. Zhuang S.M. Cancer Res. 2002; 62: 2650-2653PubMed Google Scholar) and Ikaros has been suggested to function as a tumor suppressor gene (2Wang J.H. Nichogiannopoulou A. Wu L. Sun L. Sharpe A.H. Bigby M. Georgopoulos K. Immunity. 1996; 5: 537-549Abstract Full Text PDF PubMed Scopus (505) Google Scholar, 11Winandy S. Wu P. Georgopoulos K. Cell. 1995; 83: 289-299Abstract Full Text PDF PubMed Scopus (362) Google Scholar, 12Okano H. Saito Y. Miyazawa T. Shinbo T. Chou D. Kosugi S. Takahashi Y. Odani S. Niwa O. Kominami R. Oncogene. 1999; 18: 6677-6683Crossref PubMed Scopus (52) Google Scholar, 13Rebollo A. Schmitt C. Immunol. Cell Biol. 2003; 81: 171-175Crossref PubMed Scopus (108) Google Scholar). The Ikaros gene is alternatively spliced to generate multiple isoforms. In murine lymphoid cells the most commonly expressed isoforms are IK-VI, which was initially thought to encode the full-length protein, and IK-V, which lacks the first N-terminal zinc finger (14Hahm K. Ernst P. Lo K. Kim G.S. Turck C. Smale S.T. Mol. Cell Biol. 1994; 14: 7111-7123Crossref PubMed Scopus (198) Google Scholar, 15Molnar A. Georgopoulos K. Mol. Cell Biol. 1994; 14: 8292-8303Crossref PubMed Scopus (373) Google Scholar); designated Ik-1 and Ik-2, respectively, in the nomenclature of Georgopoulous et al. (15Molnar A. Georgopoulos K. Mol. Cell Biol. 1994; 14: 8292-8303Crossref PubMed Scopus (373) Google Scholar). Ikaros is hypothesized to bind to DNA control elements of target genes and to aid in their recruitment to centromeric foci. This results in activation or repression of the target genes (16Brown K.E. Guest S.S. Smale S.T. Hahm K. Merkenschlager M. Fisher A.G. Cell. 1997; 91: 845-854Abstract Full Text Full Text PDF PubMed Scopus (658) Google Scholar, 17Liberg D. Smale S.T. Merkenschlager M. Trends Immunol. 2003; 24: 567-570Abstract Full Text Full Text PDF PubMed Scopus (16) Google Scholar). Larger Ikaros isoforms like IK-V and IK-VI are thought to act synergistically and to be responsible for Ikaros function in chromatin remodeling and regulation of gene expression. Smaller Ikaros isoforms lacking N-terminal zinc fingers do not bind DNA. Heterodimers between large and small isoforms bind DNA poorly, suggesting that small isoforms can act as dominant negative inhibitors of Ikaros (18Sun L. Crotty M.L. Sensel M. Sather H. Navara C. Nachman J. Steinherz P.G. Gaynon P.S. Seibel N. Mao C. Vassilev A. Reaman G.H. Uckun F.M. Clin. Cancer Res. 1999; 5: 2112-2120PubMed Google Scholar, 19Sun L. Liu A. Georgopoulos K. EMBO J. 1996; 15: 5358-5369Crossref PubMed Scopus (307) Google Scholar). Malignant transformation is hypothesized to be a direct consequence of altered (or diminished) function of the larger Ikaros isoforms because of overexpression of the smaller, dominant negative ones (18Sun L. Crotty M.L. Sensel M. Sather H. Navara C. Nachman J. Steinherz P.G. Gaynon P.S. Seibel N. Mao C. Vassilev A. Reaman G.H. Uckun F.M. Clin. Cancer Res. 1999; 5: 2112-2120PubMed Google Scholar, 19Sun L. Liu A. Georgopoulos K. EMBO J. 1996; 15: 5358-5369Crossref PubMed Scopus (307) Google Scholar). Previous studies of Ikaros function have been performed using murine T cell systems. Human studies identified a number of additional splice forms (6Sun L. Heerema N. Crotty L. Wu X. Navara C. Vassilev A. Sensel M. Reaman G.H. Uckun F.M. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 680-685Crossref PubMed Scopus (170) Google Scholar, 18Sun L. Crotty M.L. Sensel M. Sather H. Navara C. Nachman J. Steinherz P.G. Gaynon P.S. Seibel N. Mao C. Vassilev A. Reaman G.H. Uckun F.M. Clin. Cancer Res. 1999; 5: 2112-2120PubMed Google Scholar, 20Sun L. Goodman P.A. Wood C.M. Crotty M.L. Sensel M. Sather H. Navara C. Nachman J. Steinherz P.G. Gaynon P.S. Seibel N. Vassilev A. Juran B.D. Reaman G.H. Uckun F.M. J. Clin. Oncol. 1999; 17: 3753-3766Crossref PubMed Scopus (99) Google Scholar, 21Payne K.J. Nicolas J.H. Zhu J.Y. Barsky L.W. Crooks G.M. J. Immunol. 2001; 167: 1867-1870Crossref PubMed Scopus (30) Google Scholar). Among these was IK-H, a splice variant of IK-VI that includes an additional 60 bases between exons 2 and 3 (Fig. 1A), thus making it the longest identified Ikaros isoform. (IK-H is designated Ik1+ in the nomenclature of Payne et al. (21Payne K.J. Nicolas J.H. Zhu J.Y. Barsky L.W. Crooks G.M. J. Immunol. 2001; 167: 1867-1870Crossref PubMed Scopus (30) Google Scholar, 22Payne K.J. Huang G. Sahakian E. Zhu J.Y. Barteneva N.S. Barsky L.W. Payne M.A. Crooks G.M. J. Immunol. 2003; 170: 3091-3098Crossref PubMed Scopus (41) Google Scholar)). Whereas IK-H protein is abundantly expressed in primary human B, NK, myeloid, and erythroid cells, it is barely detectable in primary murine hematopoietic cells (21Payne K.J. Nicolas J.H. Zhu J.Y. Barsky L.W. Crooks G.M. J. Immunol. 2001; 167: 1867-1870Crossref PubMed Scopus (30) Google Scholar, 22Payne K.J. Huang G. Sahakian E. Zhu J.Y. Barteneva N.S. Barsky L.W. Payne M.A. Crooks G.M. J. Immunol. 2003; 170: 3091-3098Crossref PubMed Scopus (41) Google Scholar). Here we report the first functional studies of human Ikaros (hIK) 2The abbreviations used are: hIK, human Ikaros; HA, hemagglutinin; FITC, fluorescein isothiocyanate; ChIP, chromatin immunoprecipitation assay; EMSA, electrophoretic mobility shift assay; PC-HC, pericentromeric heterochromatin. proteins. For our analyses we used T cells, thus allowing for more valid comparisons between our human data and that obtained in murine studies. We report that the largest human Ikaros isoforms, hIK-VI and hIK-H, exhibit distinct DNA binding abilities and subcellular localization patterns. Increased expression of the largest Ikaros isoform (hIK-H) during T cell activation determines the DNA binding specificity of Ikaros complexes toward repetitive sequences located within PC-HC. We propose a model whereby coordinated expression of the largest Ikaros isoforms regulates Ikaros function in chromatin remodeling. Our results expose unique properties of human Ikaros proteins and suggest that Ikaros function in human hematopoietic cells may occur through more complicated mechanisms than in the mouse. Cells—Human CCRF-CEM (CEM) and MOLT-4 human leukemia T-cell lines, the Ramos B cell line, the human 293T endothelial kidney cell line, and the murine the NIH/3T3 (3T3) fibroblast cell line were obtained from American Type Culture Collection (ATCC). The murine 7OZ3 pre-B cell line, BAL17 B-cell line, and VL3-3M2 thymocyte cell line are a generous gift from the laboratory of Stephen Smale, HHMI, UCLA, Los Angeles, CA. Peripheral primary T cells were isolated from human donor peripheral blood (American Red Cross), or spleen of C57BL/6 mice using the nylon wool column method (23Matikainen S. Sareneva T. Ronni T. Lehtonen A. Koskinen P.J. Julkunen I. Blood. 1999; 93: 1980-1991Crossref PubMed Google Scholar). T-cell activation with PMA and anti-CD3 has been described previously (23Matikainen S. Sareneva T. Ronni T. Lehtonen A. Koskinen P.J. Julkunen I. Blood. 1999; 93: 1980-1991Crossref PubMed Google Scholar). Antibodies—Specific antibody against hIK-H protein was generated by immunizing rabbits with KLH-conjugated peptide TYGADDFRDFHAIIIPKSF. The resulting rabbit anti-serum was used at 1:1000 dilution. Antibodies used to detect the C terminus (IK-CTS) and the N terminus (IK-NTS) of murine and human Ikaros have been described previously (24Hahm K. Cobb B.S. McCarty A.S. Brown K.E. Klug C.A. Lee R. Akashi K. Weissman I.L. Fisher A.G. Smale S.T. Genes Dev. 1998; 12: 782-796Crossref PubMed Scopus (209) Google Scholar). Anti-Ikaros antibodies were visualized using FITC-goat anti-rabbit IgG antibodies (Jackson ImmunoResearch, West Grove, PA). The HA-specific mouse monoclonal antibody HA.11 (Covance Research Products, Harrisburg, PA), visualized with Texas Red goat anti-mouse IgG (Jackson Immuno Research), was used to detect HA-tagged Ikaros isoforms. Anti-Helios antibodies were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). Plasmids, Transfection, and Retroviral Transduction— cDNAs for hIK-VI and hIK-H, were amplified by RT-PCR from human peripheral T-cell total RNA and cloned into the mammalian expression vector pcDNA3 (Invitrogen). Alanine substitution mutants for the hIK-H region N were generated using the QuikChange method (Stratagene, La Jolla, CA). For retrovirus generation, hIK-H or HA-tagged hIK-VI or hIK-H (HA tag in N terminus) were amplified by PCR and cloned between BglII and EcoRI sites of the MSCV IRES GFP (MIG) vector (a generous gift from the laboratory of David Baltimore, California Institute of Technology, Pasadena, CA). 293T cells were transfected via the calcium phosphate method. CEM, VL3-3M2 or 3T3 cells were infected with amphotropic retrovirus. Confocal Microscopy—CEM, VL3-3M2, or 3T3 cells were infected with amphotropic retrovirus and analyzed by confocal microscopy as described previously (25Cobb B.S. Morales-Alcelay S. Kleiger G. Brown K.E. Fisher A.G. Smale S.T. Genes Dev. 2000; 14: 2146-2160Crossref PubMed Scopus (210) Google Scholar). Images were acquired at room temperature by a Leica TCS-SP MP Confocal and Multiphoton Microscope with a Leica DM-LFS body (upright fixed-stage microscope) using a ×100 Leica HX PLAPO (Planapo) oil immersion lens with numerical aperture of 1.4 (Heidelberg, Germany). Biochemical Experiments—Nuclear extractions, Western blots, and gel shift experiments were performed as described previously (25Cobb B.S. Morales-Alcelay S. Kleiger G. Brown K.E. Fisher A.G. Smale S.T. Genes Dev. 2000; 14: 2146-2160Crossref PubMed Scopus (210) Google Scholar). Differences in DNA binding ability were quantified by measuring the strength of shifted bands by phosphorimaging using ImageQuant 5.1 program. Results represent a mean value from three different experiments. The gel shift probe IkBS4 has been described previously (25Cobb B.S. Morales-Alcelay S. Kleiger G. Brown K.E. Fisher A.G. Smale S.T. Genes Dev. 2000; 14: 2146-2160Crossref PubMed Scopus (210) Google Scholar). Probes derived from the regulatory upstream sequences of Granzyme B, IKCa1, VPAC-1, STAT4, and FAAH have been described previously (26Wargnier A. Lafaurie C. Legros-Maida S. Bourge J.F. Sigaux F. Sasportes M. Paul P. J. Biol. Chem. 1998; 273: 35326-35331Abstract Full Text Full Text PDF PubMed Scopus (53) Google Scholar, 27Ghanshani S. Wulff H. Miller M.J. Rohm H. Neben A. Gutman G.A. Cahalan M.D. Chandy K.G. J. Biol. Chem. 2000; 275: 37137-37149Abstract Full Text Full Text PDF PubMed Scopus (363) Google Scholar, 28Dorsam G. Goetzl E.J. J. Biol. Chem. 2002; 277: 13488-13493Abstract Full Text Full Text PDF PubMed Scopus (21) Google Scholar, 29Yap W.H. Yeoh E. Tay A. Brenner S. Venkatesh B. FEBS Lett. 2005; 579: 4470-4478Crossref PubMed Scopus (34) Google Scholar, 30Maccarrone M. Bari M. Di Rienzo M. Finazzi-Agro A. Rossi A. J. Biol. Chem. 2003; 278: 32726-32732Abstract Full Text Full Text PDF PubMed Scopus (101) Google Scholar) Probes used in this article are as follows (Ikaros binding sites are underlined): single site probe: GAGTTACAGGAAAAGTATTTGGTTGTGAGAATTGCCCAAAGGTGTCAA; IKBS40: GAGTTACAGGAAAAGTATTTGGTTGTGAGAATTGCCCAAAGGTGTCAAGGTTATGGAAAAGAGTTACA. Sequences for human probes: γ satellite from human chromosome 8 (γ Sat 8): GCGAGACCGCAGGGAATGCTGGGAGCCTCCC; γ satellite from human chromosome 8-2 (single site) (γ Sat 8-2): GAGACTGCAGGAAATGCTAGGAT; Beta D: GGGTGGAGGAAAGGCATGAGAGCTCTGCCCAGGCTGCTCCCACAGCCC; Human α satellite consensus sequence (α sat): GGCCTATGGTGGAAAAGGAAATATCTTC; CENP-B box: GAGGCCTTCGTTGGAAACGGGATTAT; Satellite 3: ATTCCATTCCATTCCATTCCATTCCATTCC. ChIP (Chromatin Immunoprecipitation) Assay—In vivo DNA binding of Ikaros isoforms was tested using ChIP assays in 293T cells and in activated T cells as previously described (31Kwan M. Powell D.R. Nachman T.Y. Brown M.A. Eur. J. Immunol. 2005; 35: 1267-1274Crossref PubMed Scopus (17) Google Scholar) using 10 μg of IK-CTS or Ik-H antibodies. Immunoprecipitations with IgG and no antibody were used as negative controls. Chromatin immunoprecipitates were resuspended in 50 μlof sterile H2O, and 2 μl was used in each PCR. Total input samples were resuspended in 100 μl of sterile H2O and then diluted 1:100 before PCR. Sequences of primers used in PCR reactions were as follows: γ sat 8 forward, 5′-GTTGATGGTGGCTTGGGTG-3′; γ sat 8 reverse, 5′-CCATTTACGAGAAACACAGGC-3′; γ sat 8-2 forward, 5′-CGCCACAACCAAAAACGTTG-3′; γ sat 8-2 reverse, 5′-CAAGGCCTGGGGATTTACAG-3′; α sat forward, 5′-CATTCTCAGAAACTTCTTTG-3′; α sat reverse, 5′-CTTCTGTCTAGTTTTTATGTG-3′; CENP-B forward, 5′-AATCTGCAAGTGGATATTTG-3′; CENP-B reverse, 5′-CTACAAAAAGAGTGTTTCAAA-3′; Granzyme B promoter forward, 5′-CTGATGGATTTAGCAGCATGG-3′; Granzyme B promoter reverse, 5′-AGAGGAAAGAGGTGGAGCAG-3′; IKCa1 promoter forward, 5′-TCTACACGTATTGGGTTTCG-3′; IKCa1 promoter reverse, 5′-GCACACAACACAACCTACAC-3′; VPAC-1 promoter forward, 5′-CAGCCTGGGAAGATAAGTGG-3′; VPAC-1 promoter reverse, 5′-CGTCGTGAGACATTTATAGGC-3′. PCR conditions were 95 °C for 5 min, followed by 30 cycles of 95 °C for 30 s, 58 °C for 30 s, and 72 °C for 45 s. Final PCR products were analyzed on agarose gels (2%) with ethidium bromide staining. All samples within a particular set (anti-Ikaros antibodies, IgG, and total chromatin control) were analyzed at the same time and electrophoresed on the same agarose gel. Results are representative of three independent experiments. IK-H Is Differentially Expressed in Mouse and Human Lymphoid Cells—Ikaros isoform H (IK-H) contains an additional 20 amino acids (region N) between exons 2 and 3 (Fig. 1A) that is not present in IK-VI (21Payne K.J. Nicolas J.H. Zhu J.Y. Barsky L.W. Crooks G.M. J. Immunol. 2001; 167: 1867-1870Crossref PubMed Scopus (30) Google Scholar, 32Nakayama H. Ishimaru F. Katayama Y. Nakase K. Sezaki N. Takenaka K. Shinagawa K. Ikeda K. Niiya K. Harada M. Exp. Hematol. 2000; 28: 1232-1238Abstract Full Text Full Text PDF PubMed Scopus (18) Google Scholar). Because abundant expression of IK-H has been detected in human, but not murine hematopoietic cells (22Payne K.J. Huang G. Sahakian E. Zhu J.Y. Barteneva N.S. Barsky L.W. Payne M.A. Crooks G.M. J. Immunol. 2003; 170: 3091-3098Crossref PubMed Scopus (41) Google Scholar), it was important to study human Ikaros function in a cell type that expressed this isoform. We examined expression of Ikaros isoforms in human and murine lymphoid cell lines using an Ikaros antibody (IK-CTS) that recognizes the C terminus of both mouse and human Ikaros. IK-H was expressed in human T and B cell lines at a level comparable to IK-VI (Fig. 1B, lanes 1–3, whereas its expression was 10-fold lower than expression of IK-VI and IK-V in murine cell lines (Fig. 1B, lanes 4–6). Identical results were obtained using another antibody (IK-NTS) that recognizes the N terminus of mouse and human Ikaros (data not shown). To determine if the differing patterns of Ikaros isoform expression that we observed in murine and human cell lines were characteristic of normal T cells, Ikaros expression was examined in both resting and activated mouse and human primary T cells. In resting, human T cells we found expression of hIK-VI and hIk-V, but not hIK-H; however, following activation, all three isoforms were expressed at comparable levels (Fig. 1C, lanes 1–4). Thus, the expression of Ikaros proteins in activated, primary, peripheral human T cells (Fig. 1C, lanes 3 and 4) is similar to that in human T-cell lines (Fig. 1B, lanes 1–3). Consistent with previous reports, in primary mouse T cells the expression of IK-H was 10-fold lower than expression of mIK-VI or mIK-V (Fig. 1C, lanes 5 and 6), in both resting and activated cells (22Payne K.J. Huang G. Sahakian E. Zhu J.Y. Barteneva N.S. Barsky L.W. Payne M.A. Crooks G.M. J. Immunol. 2003; 170: 3091-3098Crossref PubMed Scopus (41) Google Scholar, 33Sun P. Loh H.H. J. Biol. Chem. 2002; 277: 12854-12860Abstract Full Text Full Text PDF PubMed Scopus (20) Google Scholar). Thus, human, but not murine, activated T cells express abundant IK-H. To verify that the top two bands seen in human T cells were hIK-H and hIK-VI, each isoform was expressed in 293T cells (which do not express endogenous Ikaros), and used as size markers (Fig. 1D). Overexpressed isoforms co-migrated with endogenous proteins in the MOLT-4 human T-cell line, confirming that the two top bands were hIK-H and hIK-VI. A polyclonal antibody against IK-H was prepared using an N region peptide as the epitope. Using MOLT-4 nuclear extract, we show that the IK-H antibody detects only the hIK-H isoform, whereas the IK-CTS antibody detected all of the three large human Ikaros isoforms (Fig. 1E). In studies reported here we will use the IK-H antibody to detect expression and localization of the hIK-H isoform. Specific Amino Acids within Region N Determine the Reduced DNA Binding Ability of IK-H—The potential binding sites for Ikaros within human pericentromeric DNA have not been identified. In mice, the DNA sequence of PC-HC is uniform for all chromosomes. In humans, PC-HC contains different sequences, often unique for each chromosome (34Lee C. Li X. Jabs E.W. Court D. Lin C.C. Chromosoma. 1995; 104: 103-112Crossref PubMed Scopus (16) Google Scholar). We designed DNA probes derived from published DNA sequences of human PC-HC and used them to test the DNA binding ability of individual Ikaros isoforms in an electrophoretic mobility shift assay (EMSA) (34Lee C. Li X. Jabs E.W. Court D. Lin C.C. Chromosoma. 1995; 104: 103-112Crossref PubMed Scopus (16) Google Scholar, 35Waye J.S. Willard H.F. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 6250-6254Crossref PubMed Scopus (133) Google Scholar, 36Willard H.F. Waye J.S. J. Mol. Evol. 1987; 25: 207-214Crossref PubMed Scopus (158) Google Scholar, 37Lin C.C. Sasi R. Lee C. Fan Y.S. Court D. Chromosoma. 1993; 102: 333-339Crossref PubMed Scopus (28) Google Scholar, 38Romanova L.Y. Deriagin G.V. Mashkova T.D. Tumeneva I.G. Mushegian A.R. Kisselev L.L. Alexandrov I.A. J. Mol. Biol. 1996; 261: 334-340Crossref PubMed Scopus (65) Google Scholar, 39Choo K.H. Vissel B. Nagy A. Earle E. Kalitsis P. Nucleic Acids Res. 1991; 19: 1179-1182Crossref PubMed Scopus (213) Google Scholar, 40Prosser J. Frommer M. Paul C. Vincent P.C. J. Mol. Biol. 1986; 187: 145-155Crossref PubMed Scopus (134) Google Scholar). Human hematopoietic cells express multiple Ikaros isoforms. Thus, to study DNA binding ability of individual isoforms, we used nuclear extracts of 293T cells transduced to express hIK-VI or hIK-H. The 293T cell line does not express Ikaros and it has been shown that transduced Ikaros has identical phosphorylation status and DNA binding abilities in 293T cells as in hematopoietic cells (41Dovat S. Ronni T. Russell D. Ferrini R. Cobb B.S. Smale S.T. Genes Dev. 2002; 16: 2985-2990Crossref PubMed Scopus (108) Google Scholar, 42Gomez-del Arco P. Maki K. Georgopoulos K. Mol. Cell Biol. 2004; 24: 2797-2807Crossref PubMed Scopus (76) Google Scholar). Thus, 293T cells are an established model for studying DNA binding (25Cobb B.S. Morales-Alcelay S. Kleiger G. Brown K.E. Fisher A.G. Smale S.T. Genes Dev. 2000; 14: 2146-2160Crossref PubMed Scopus (210) Google Scholar), protein-protein interactions (43McCarty A.S. Kleiger G. Eisenberg D. Smale S.T. Mol. Cell. 2003; 11: 459-470Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar), or phosphomimetic mutants of individual Ikaros isoforms (41Dovat S. Ronni T. Russell D. Ferrini R. Cobb B.S. Smale S.T. Genes Dev. 2002; 16: 2985-2990Crossref PubMed Scopus (108) Google Scholar, 42Gomez-del Arco P. Maki K. Georgopoulos K. Mol. Cell Biol. 2004; 24: 2797-2807Crossref PubMed Scopus (76) Google Scholar). Both the hIK-VI and the hIK-H isoforms bound the IKBS4 probe that contains two optimal Ikaros binding sites (Fig. 2A, lanes 1–3). Both isoforms also exhibited similar DNA binding affinities on probes derived from the γ satellite region of chromosome 8 (γ sat 8) and the beta D repeat (Fig. 2A, lanes 4–9), both of which contained two Ikaros binding sites. However, the DNA binding ability of hIK-VI was stronger than that of hIK-H toward the probes derived from pericentromeric (PC-HC) that contains a single Ikaros consensus binding site: the γ satellite 8-2 region of human chromosome 8 (γ sat 8-2): 8-fold stronger; the consensus α satellite DNA sequence (α Sat): 10-fold stronger; and the CENP-B box: 6-fold stronger (Fig. 2B, lanes 1–9). A similar difference in DNA binding ability was observed when a probe derived from pJ alpha box was used (data not shown), while no binding was observed to the probe derived from γ satellite chromatin of human chromosome X (data not shown). These results reveal DNA binding specificities of human Ikaros within PC-HC and identified potential motifs that target Ikaros to the pericentromeric region of particular chromosomes. To establish whether actual binding of Ikaros isoforms to pericentromeric heterochromatin has occurred in vivo in 293T cells, we performed ChIP assays. Results showed that hIK-VI, expressed individually in 293T cells, binds in vivo to the pericentromeric repeats that contain two Ikaros binding sites (γ sat 8), as well as to the repeats that contain a single Ikaros binding site (γ sat 8-2, α sat and CENP-B) (Fig. 2C). ChIP assays show that the hIK-H isoform, expressed individually, binds in vivo a pericentromeric region that contains two Ikaros binding sites (γ sat 8), but not regions with a single Ikaros binding site (Fig. 2C). These data confirm that results observed by EMSA correlate to in vivo binding of Ikaros isoforms in 293T cells. We compared the DNA binding ability of murine and human Ikaros isoforms. The largest difference in binding ability was observed using a probe containing two Ikaros bindings motifs (from murine γ satellite A PC-HC) separated by 40 base pairs (Fig. 2D, probe IKBS40; lanes 1–4). Human IK-VI showed a DNA binding affinity over 10-fold that of murine IK-VI and 8 times that of hIK-H. Possible explanations for the observed data include an increased ability of hIK-VI to form multimers, which would enable it to bind to the probe containing two distant consensus sites, or increased affinity of hIK-VI toward a single Ikaros consensus site. To distinguish between these possibilities we tested the ability of Ikaros isoforms to bind a probe containing a single Ikaros binding site (supplemental Fig. S1A, lanes 1–4). The DNA binding ability of hIK-VI was 10-fold that of hIK-H, whereas mIK-VI was unable to bind the single site probe. These data suggest that the increased DNA binding ability of hIK-VI compared with mIK-VI and hIK-H is at least partly caused by increased affinity for the DNA contained in a single consensus Ikaros binding site. Human IK-H has identical amino acid sequence to hIK-VI except for the presence of region N, yet hIK-H has decreased DNA binding ability compared with hIK-VI. If the presence of specific amino acids within region N interferes with DNA binding, mutation of these should give hIK-H the ability to bind DNA with affinity similar to hIK-VI. Alanine-scanning mutations of region N were performed, and mutants were tested for DNA binding ability. Initially, two consecutive amino acids within region N were mutated to alanine. Results (Fig. 2D, lanes 5–14 and supplemental Fig. S1A, lanes 5–14) identified two pairs of amino acids whose mutation to alanine gave hIK-H the ability to bind DNA. Point mutations of glycine, phenylalanine, and to a lesser extent, histidine, were able to restore the DNA binding ability of mutated hIK-H when either IKBS40 (Fig. 2E) or the single site probe (supplemental Fig. S1B) was used in EMSA. Mutation of tyrosine did not seem to affect DNA binding ability. Thus, three specific amino acids within region N (Fig. 2F) are responsible for decreased DNA binding of hIK-H compared with hIK-VI. Human IK-H Exhibits Dual Centromeric and Noncentromeric Localization—In murine lymphocytes, Ikaros localizes to centromeric heterochromatin where it is hypothesized to recruit genes destined for inactivation (16Brown K.E. Guest S.S. Smale S.T. Hahm K. Merkenschlager M. Fisher A.G. Cell. 1997; 91: 845-854Abstract Full Text Full Text PDF PubMed Scopus (658) Google Scholar). We used confocal microscopy to examine subcellular localization of the largest human Ikaros isoforms (Fig. 3). To distinguish the localization pattern of hIK-VI from hIK-H, the CEM leukemia T-cell line was transduced to express HA-tagged hIK-VI. Subcellular localization of hIK-VI was detected using antibodies against the HA tag (red), whereas localization of endogenous hIK-H was detected with isoform-specific IK-H antibodies (green). In CEM T cells, the hIK-VI isoform displa
Publication Year: 2006
Publication Date: 2006-11-30
Language: en
Type: article
Indexed In: ['crossref', 'pubmed']

{'id': 'https://openalex.org/W1989718163', 'doi': 'https://doi.org/10.1074/jbc.m605627200', 'title': 'Human Ikaros Function in Activated T Cells Is Regulated by Coordinated Expression of Its Largest Isoforms', 'display_name': 'Human Ikaros Function in Activated T Cells Is Regulated by Coordinated Expression of Its Largest Isoforms', 'publication_year': 2006, 'publication_date': '2006-11-30', 'ids': {'openalex': 'https://openalex.org/W1989718163', 'doi': 'https://doi.org/10.1074/jbc.m605627200', 'mag': '1989718163', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/17135265'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m605627200', 'pdf_url': 'http://www.jbc.org/article/S0021925820721241/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S0021925820721241/pdf', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5075303062', 'display_name': 'Tapani Ronni', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I161318765', 'display_name': 'University of California, Los Angeles', 'ror': 'https://ror.org/046rm7j60', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I161318765']}, {'id': 'https://openalex.org/I4210134385', 'display_name': "Mattel Children's Hospital", 'ror': 'https://ror.org/04p5baq95', 'country_code': 'US', 'type': 'healthcare', 'lineage': ['https://openalex.org/I2799798094', 'https://openalex.org/I4210134385']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Tapani Ronni', 'raw_affiliation_strings': ["Mattel Children's Hospital, University of California, Los Angeles, California 90095"], 'affiliations': [{'raw_affiliation_string': "Mattel Children's Hospital, University of California, Los Angeles, California 90095", 'institution_ids': ['https://openalex.org/I161318765', 'https://openalex.org/I4210134385']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5087655461', 'display_name': 'Kimberly J. Payne', 'orcid': 'https://orcid.org/0000-0002-7025-5821'}, 'institutions': [{'id': 'https://openalex.org/I1336910626', 'display_name': "Children's Hospital of Los Angeles", 'ror': 'https://ror.org/00412ts95', 'country_code': 'US', 'type': 'healthcare', 'lineage': ['https://openalex.org/I1336910626']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Kimberly J. Payne', 'raw_affiliation_strings': ['Childrens Hospital Los Angeles, California 90027.'], 'affiliations': [{'raw_affiliation_string': 'Childrens Hospital Los Angeles, California 90027.', 'institution_ids': ['https://openalex.org/I1336910626']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5016618095', 'display_name': 'Sam Ho', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I135310074', 'display_name': 'University of Wisconsin–Madison', 'ror': 'https://ror.org/01y2jtd41', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I135310074']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Sam Ho', 'raw_affiliation_strings': ['Department of Pediatrics University of Wisconsin Madison, Wisconsin 53792'], 'affiliations': [{'raw_affiliation_string': 'Department of Pediatrics University of Wisconsin Madison, Wisconsin 53792', 'institution_ids': ['https://openalex.org/I135310074']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5087630433', 'display_name': 'Michelle N. Bradley', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I161318765', 'display_name': 'University of California, Los Angeles', 'ror': 'https://ror.org/046rm7j60', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I161318765']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Michelle N. Bradley', 'raw_affiliation_strings': ['‡‡Department of Pathology and Laboratory Medicine, University of California, Los Angeles, California 90095'], 'affiliations': [{'raw_affiliation_string': '‡‡Department of Pathology and Laboratory Medicine, University of California, Los Angeles, California 90095', 'institution_ids': ['https://openalex.org/I161318765']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5070008665', 'display_name': 'Glenn Dorsam', 'orcid': 'https://orcid.org/0000-0001-5902-4347'}, 'institutions': [{'id': 'https://openalex.org/I57328836', 'display_name': 'North Dakota State University', 'ror': 'https://ror.org/05h1bnb22', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I57328836']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Glenn Dorsam', 'raw_affiliation_strings': ['Department of Chemistry and Molecular Biology, North Dakota State University, Fargo, North Dakota, 58105'], 'affiliations': [{'raw_affiliation_string': 'Department of Chemistry and Molecular Biology, North Dakota State University, Fargo, North Dakota, 58105', 'institution_ids': ['https://openalex.org/I57328836']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5072518893', 'display_name': 'Sinisa Dovat', 'orcid': 'https://orcid.org/0000-0003-3906-6165'}, 'institutions': [{'id': 'https://openalex.org/I135310074', 'display_name': 'University of Wisconsin–Madison', 'ror': 'https://ror.org/01y2jtd41', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I135310074']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Sinisa Dovat', 'raw_affiliation_strings': ['Department of Pediatrics University of Wisconsin Madison, Wisconsin 53792'], 'affiliations': [{'raw_affiliation_string': 'Department of Pediatrics University of Wisconsin Madison, Wisconsin 53792', 'institution_ids': ['https://openalex.org/I135310074']}]}], 'institution_assertions': [], 'countries_distinct_count': 1, 'institutions_distinct_count': 5, 'corresponding_author_ids': [], 'corresponding_institution_ids': [], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 4.025, 'has_fulltext': True, 'fulltext_origin': 'pdf', 'cited_by_count': 52, 'citation_normalized_percentile': {'value': 0.921616, 'is_in_top_1_percent': False, 'is_in_top_10_percent': True}, 'cited_by_percentile_year': {'min': 93, 'max': 94}, 'biblio': {'volume': '282', 'issue': '4', 'first_page': '2538', 'last_page': '2547'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T10950', 'display_name': 'Epidemiology and Treatment of Childhood Leukemia', 'score': 0.9994, 'subfield': {'id': 'https://openalex.org/subfields/2739', 'display_name': 'Public Health, Environmental and Occupational Health'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, 'topics': [{'id': 'https://openalex.org/T10950', 'display_name': 'Epidemiology and Treatment of Childhood Leukemia', 'score': 0.9994, 'subfield': {'id': 'https://openalex.org/subfields/2739', 'display_name': 'Public Health, Environmental and Occupational Health'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, {'id': 'https://openalex.org/T11193', 'display_name': 'Molecular Physiology of Purinergic Signalling', 'score': 0.9927, 'subfield': {'id': 'https://openalex.org/subfields/1314', 'display_name': 'Physiology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T13415', 'display_name': 'Lysosomal Calcium Signaling in Physiology and Pathology', 'score': 0.9855, 'subfield': {'id': 'https://openalex.org/subfields/1314', 'display_name': 'Physiology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/memory-t-cells', 'display_name': 'Memory T Cells', 'score': 0.451884}], 'concepts': [{'id': 'https://openalex.org/C53345823', 'wikidata': 'https://www.wikidata.org/wiki/Q5531554', 'display_name': 'Gene isoform', 'level': 3, 'score': 0.6439398}, {'id': 'https://openalex.org/C24284526', 'wikidata': 'https://www.wikidata.org/wiki/Q204785', 'display_name': 'Zinc finger', 'level': 4, 'score': 0.61467004}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.54895264}, {'id': 'https://openalex.org/C104317684', 'wikidata': 'https://www.wikidata.org/wiki/Q7187', 'display_name': 'Gene', 'level': 2, 'score': 0.5389223}, {'id': 'https://openalex.org/C83640560', 'wikidata': 'https://www.wikidata.org/wiki/Q180951', 'display_name': 'Chromatin', 'level': 3, 'score': 0.48835012}, {'id': 'https://openalex.org/C153911025', 'wikidata': 'https://www.wikidata.org/wiki/Q7202', 'display_name': 'Molecular biology', 'level': 1, 'score': 0.48723736}, {'id': 'https://openalex.org/C54355233', 'wikidata': 'https://www.wikidata.org/wiki/Q7162', 'display_name': 'Genetics', 'level': 1, 'score': 0.44957128}, {'id': 'https://openalex.org/C86339819', 'wikidata': 'https://www.wikidata.org/wiki/Q407384', 'display_name': 'Transcription factor', 'level': 3, 'score': 0.41155308}, {'id': 'https://openalex.org/C95444343', 'wikidata': 'https://www.wikidata.org/wiki/Q7141', 'display_name': 'Cell biology', 'level': 1, 'score': 0.40218207}], 'mesh': [{'descriptor_ui': 'D051740', 'descriptor_name': 'Ikaros Transcription Factor', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': True}, {'descriptor_ui': 'D013601', 'descriptor_name': 'T-Lymphocytes', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D000818', 'descriptor_name': 'Animals', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D001665', 'descriptor_name': 'Binding Sites', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002460', 'descriptor_name': 'Cell Line', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D004268', 'descriptor_name': 'DNA-Binding Proteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D004268', 'descriptor_name': 'DNA-Binding Proteins', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D004268', 'descriptor_name': 'DNA-Binding Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D005786', 'descriptor_name': 'Gene Expression Regulation', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D006801', 'descriptor_name': 'Humans', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D051740', 'descriptor_name': 'Ikaros Transcription Factor', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D051740', 'descriptor_name': 'Ikaros Transcription Factor', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D008213', 'descriptor_name': 'Lymphocyte Activation', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D008213', 'descriptor_name': 'Lymphocyte Activation', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D051379', 'descriptor_name': 'Mice', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008958', 'descriptor_name': 'Models, Molecular', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011485', 'descriptor_name': 'Protein Binding', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D020033', 'descriptor_name': 'Protein Isoforms', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D020033', 'descriptor_name': 'Protein Isoforms', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D020033', 'descriptor_name': 'Protein Isoforms', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D013601', 'descriptor_name': 'T-Lymphocytes', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}], 'locations_count': 2, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m605627200', 'pdf_url': 'http://www.jbc.org/article/S0021925820721241/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/17135265', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m605627200', 'pdf_url': 'http://www.jbc.org/article/S0021925820721241/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 47, 'referenced_works': ['https://openalex.org/W1551136390', 'https://openalex.org/W1563008641', 'https://openalex.org/W1638290971', 'https://openalex.org/W1883290480', 'https://openalex.org/W1900438073', 'https://openalex.org/W1902213368', 'https://openalex.org/W1924865194', 'https://openalex.org/W1964947318', 'https://openalex.org/W1977795985', 'https://openalex.org/W1982295124', 'https://openalex.org/W1984654995', 'https://openalex.org/W1989645452', 'https://openalex.org/W1989695798', 'https://openalex.org/W1996240289', 'https://openalex.org/W2003338975', 'https://openalex.org/W2012519319', 'https://openalex.org/W2028401182', 'https://openalex.org/W2028805224', 'https://openalex.org/W2031351362', 'https://openalex.org/W2036627966', 'https://openalex.org/W2036733966', 'https://openalex.org/W2046709273', 'https://openalex.org/W2052453105', 'https://openalex.org/W2065065636', 'https://openalex.org/W2068949598', 'https://openalex.org/W2070994243', 'https://openalex.org/W2077982816', 'https://openalex.org/W2083864663', 'https://openalex.org/W2086373053', 'https://openalex.org/W2086780553', 'https://openalex.org/W2087992607', 'https://openalex.org/W2093023354', 'https://openalex.org/W2094401453', 'https://openalex.org/W2102195283', 'https://openalex.org/W2114894459', 'https://openalex.org/W2117013211', 'https://openalex.org/W2119870415', 'https://openalex.org/W2121590698', 'https://openalex.org/W2121646809', 'https://openalex.org/W2125378951', 'https://openalex.org/W2126665603', 'https://openalex.org/W2142559136', 'https://openalex.org/W2143041969', 'https://openalex.org/W2146547823', 'https://openalex.org/W2237420558', 'https://openalex.org/W2333843729', 'https://openalex.org/W81453212'], 'related_works': ['https://openalex.org/W4251411200', 'https://openalex.org/W4237503679', 'https://openalex.org/W4233265360', 'https://openalex.org/W2992466616', 'https://openalex.org/W2170686685', 'https://openalex.org/W2079625624', 'https://openalex.org/W2054338068', 'https://openalex.org/W2051736406', 'https://openalex.org/W2040804282', 'https://openalex.org/W1540936366'], 'abstract_inverted_index': {'The': [0, 228, 251, 479, 911, 1776, 1892, 1967, 2265, 3566, 4067, 4186], 'Ikaros': [1, 30, 38, 51, 97, 170, 190, 206, 234, 252, 281, 289, 302, 348, 421, 441, 457, 485, 502, 645, 812, 912, 1015, 1094, 1110, 1121, 1151, 1219, 1283, 1458, 1596, 1652, 1671, 1684, 1702, 1705, 1717, 1722, 1918, 1993, 2514, 2885, 2899, 2910, 2981, 2992, 3010, 3059, 3276, 3317, 3391, 3542, 3573, 3581, 3700, 3757, 3800, 3827, 3915, 3924, 3938, 3973, 3989, 4019, 4031, 4050, 4065, 4080, 4156, 4169, 4178, 4239, 4434, 4487], 'gene': [2, 14, 253, 265, 822, 913, 1118], 'is': [3, 35, 68, 112, 254, 286, 319, 363, 504, 914, 1016, 1204, 1461, 1520, 1533, 2778, 3074, 3333, 4223, 4441], 'alternately': [4, 255], 'spliced': [5, 256, 916], 'to': [6, 70, 99, 163, 208, 219, 243, 257, 321, 350, 414, 459, 470, 494, 816, 917, 936, 1018, 1020, 1028, 1033, 1102, 1106, 1206, 1903, 1990, 2882, 2938, 3076, 3290, 3383, 3545, 3561, 3892, 3925, 3940, 3966, 3982, 4045, 4131, 4138, 4140, 4171, 4201, 4249, 4290, 4296, 4323, 4344, 4350, 4359, 4366, 4398, 4436, 4443, 4479, 4507], 'generate': [7, 258, 918], 'multiple': [8, 259, 919, 3541], 'zinc': [9, 260, 948, 1125], 'finger': [10, 261, 949], 'proteins': [11, 262, 1718, 3060, 3218], 'involved': [12, 263], 'in': [13, 31, 40, 57, 104, 115, 225, 232, 264, 282, 291, 308, 355, 366, 476, 483, 536, 993, 1030, 1038, 1112, 1464, 1523, 1536, 1643, 1707, 1724, 1735, 2064, 2237, 2446, 2521, 2525, 2574, 2584, 2592, 2608, 2753, 2781, 2846, 2887, 2901, 2927, 2956, 2998, 3014, 3061, 3078, 3090, 3114, 3185, 3197, 3219, 3393, 3590, 3594, 3868, 3945, 3947, 3960, 3964, 4011, 4046, 4052, 4070, 4235, 4390], 'regulation': [15, 177, 266, 428, 1116], 'and': [16, 55, 124, 246, 267, 306, 375, 497, 532, 540, 811, 941, 990, 1027, 1098, 1105, 1115, 1134, 1448, 1529, 1640, 1655, 1662, 1719, 1741, 1759, 1785, 1853, 1909, 1916, 2008, 2014, 2026, 2071, 2075, 2130, 2172, 2205, 2309, 2524, 2562, 2579, 2598, 2697, 2725, 2735, 2755, 2773, 2903, 2921, 2930, 2954, 2979, 3000, 3017, 3020, 3035, 3072, 3112, 3117, 3191, 3206, 3233, 3293, 3380, 3574, 3586, 3745, 3786, 3855, 3918, 3997, 4063, 4113, 4221, 4305, 4330, 4358, 4429], 'chromatin': [17, 244, 268, 495, 1113, 1611, 1708, 2727, 3899], 'remodeling.': [18, 269, 1709], 'Whereas': [19, 270, 1517], 'murine': [20, 271, 922, 1289, 1538, 1644, 1761, 1777, 1915, 2850, 2904, 2957, 2999, 4062, 4084, 4111, 4432], 'studies': [21, 272, 1281, 1294, 1593, 3281], 'have': [22, 273, 1285, 1919, 2311, 3322], 'provided': [23, 274], 'important': [24, 275, 2881], 'information': [25, 276], 'regarding': [26, 277], 'the': [27, 32, 47, 64, 77, 94, 109, 118, 130, 135, 145, 149, 159, 164, 202, 209, 220, 233, 278, 283, 298, 315, 328, 345, 360, 369, 381, 386, 396, 400, 410, 415, 453, 460, 471, 484, 537, 925, 938, 945, 994, 1043, 1217, 1225, 1455, 1465, 1590, 1649, 1669, 1679, 1700, 1736, 1747, 1752, 1760, 1762, 1795, 1825, 1905, 1910, 2029, 2039, 2046, 2079, 2089, 2105, 2245, 2299, 2732, 2738, 2915, 2974, 2988, 3056, 3095, 3180, 3220, 3227, 3248, 3257, 3262, 3266, 3272, 3287, 3296, 3306, 3328, 3385, 3743, 3746, 3750, 3776, 3787, 3804, 3817, 3831, 3845, 3856, 3893, 3926, 3967, 3983, 4005, 4057, 4122, 4141, 4166, 4203, 4211, 4232, 4253, 4269, 4288, 4348, 4368, 4381, 4484, 4493, 4500, 4520, 4540], 'role': [28, 279], 'of': [29, 37, 46, 62, 81, 86, 89, 96, 140, 153, 161, 168, 184, 189, 204, 212, 230, 248, 280, 288, 297, 313, 332, 337, 340, 347, 391, 404, 412, 419, 435, 440, 455, 463, 481, 499, 644, 652, 996, 1024, 1042, 1117, 1150, 1211, 1216, 1222, 1224, 1282, 1298, 1437, 1467, 1594, 1668, 1683, 1699, 1715, 1797, 1821, 1914, 2078, 2091, 2096, 2196, 2247, 2303, 2513, 2554, 2595, 2605, 2686, 2745, 2841, 2898, 2918, 2952, 2977, 2991, 3006, 3033, 3058, 3097, 3104, 3271, 3295, 3311, 3331, 3377, 3389, 3550, 3557, 3698, 3780, 3796, 3808, 3814, 3836, 3900, 3913, 3929, 3937, 4049, 4061, 4110, 4117, 4129, 4151, 4168, 4190, 4195, 4216, 4255, 4271, 4283, 4300, 4339, 4355, 4372, 4393, 4419, 4483, 4496, 4513, 4526], 'mouse,': [33, 284], 'little': [34, 285], 'known': [36, 169, 287, 420], 'function': [39, 290, 510, 646, 817, 1111, 1215, 1284, 1706, 1723, 2886], 'human.': [41, 292], 'We': [42, 74, 197, 293, 325, 448, 1646, 1692, 2895, 3368, 4055, 4475], 'report': [43, 294, 1589, 1647], 'functional': [44, 295, 1592], 'analyses': [45, 296, 1625], 'two': [48, 299, 3182, 3228, 3755, 3799, 3972, 4018, 4079, 4144, 4314, 4337], 'largest': [49, 65, 300, 316, 1650, 1670, 1701, 4068, 4485], 'human': [50, 71, 301, 322, 653, 1525, 1595, 1603, 1638, 1651, 1716, 1725, 1743, 1753, 1812, 1917, 2021, 2465, 2470, 2480, 2884, 2902, 2922, 2928, 2980, 3001, 3021, 3027, 3065, 3079, 3186, 3222, 3275, 3319, 3378, 3837, 3901, 3914, 4064, 4486], '(hIK)': [52, 303, 1597], 'isoforms,': [53, 304, 1653, 3552], 'hIK-VI': [54, 111, 305, 362, 1654, 2013, 2059, 3034, 3563, 3744, 3809, 4130, 4152, 4191, 4217, 4250, 4497, 4514, 4541], 'hIK-H,': [56, 63, 141, 307, 314, 392, 1656, 2015, 4196, 4499], 'T': [58, 309, 1290, 1628, 1675, 1807, 2527, 2929, 3008, 3023, 3028, 3066, 3093, 3172, 3187, 4538], 'cells.': [59, 73, 310, 324, 3024, 4054], 'Abundant': [60, 311], 'expression': [61, 183, 312, 434, 503, 1667, 1698, 2031, 2840, 2897, 2946, 2951, 2994, 3011, 3032, 3057, 3096, 3103, 3292], 'described': [66, 317, 1857, 1921, 2136, 2212, 2272, 2313, 2531], 'isoform,': [67, 318, 3264, 4007], 'restricted': [69, 320], 'hematopoietic': [72, 323, 1539, 1726, 2851, 3538, 3595], 'find': [75, 326], 'that': [76, 85, 182, 327, 336, 433, 1141, 1439, 1641, 1648, 1721, 2777, 2891, 2913, 2972, 2995, 3077, 3179, 3226, 3256, 3579, 3753, 3813, 3823, 3922, 3956, 3970, 3985, 4004, 4016, 4039, 4109, 4116, 4194, 4210], 'DNA': [78, 101, 137, 329, 352, 388, 1021, 1138, 1659, 1680, 2238, 2511, 3308, 3321, 3329, 3370, 3375, 3386, 3547, 3587, 3646, 3769, 3805, 3849, 3869, 3910, 4058, 4104, 4187, 4213, 4233, 4262, 4280, 4292, 4310, 4369, 4400, 4417], 'binding': [79, 138, 160, 203, 330, 389, 411, 454, 1660, 1681, 2239, 2453, 2512, 3314, 3387, 3548, 3588, 3647, 3758, 3770, 3801, 3806, 3829, 3870, 3889, 3911, 3936, 3974, 3990, 4020, 4032, 4048, 4059, 4071, 4105, 4179, 4188, 4214, 4240, 4263, 4311, 4370, 4401, 4418], 'affinity': [80, 188, 239, 331, 439, 490, 4106, 4150, 4230, 4294], 'hIK-H': [82, 119, 162, 185, 231, 333, 370, 413, 436, 482, 1881, 2040, 2056, 2061, 3190, 3232, 3263, 3297, 3747, 3815, 4006, 4222, 4259, 4287, 4347, 4374, 4420, 4528], 'differs': [83, 334], 'from': [84, 335, 1770, 1794, 1811, 1999, 2020, 2088, 2261, 2298, 2469, 2479, 3373, 3775, 3820, 3878, 3896, 4498], 'hIK-VI.': [87, 338, 3234, 4267, 4297, 4423, 4510], 'Co-expression': [88, 339], 'hIk-H': [90, 341], 'with': [91, 174, 342, 425, 650, 1851, 1888, 1979, 2116, 2127, 2175, 2193, 2560, 2712, 3087, 3216, 4028, 4219, 4266, 4279, 4293, 4422, 4531], 'hIk-VI': [92, 343], 'alters': [93, 344], 'ability': [95, 139, 346, 390, 2240, 3388, 3549, 3807, 3871, 4060, 4072, 4128, 4167, 4189, 4215, 4264, 4289, 4349, 4371], 'complexes': [98, 192, 207, 349, 443, 458, 1685], 'bind': [100, 351, 1019, 1129, 1137, 4139, 4172, 4202, 4291, 4351], 'motifs': [102, 353, 3921, 4082], 'found': [103, 354, 3031], 'pericentromeric': [105, 222, 356, 473, 1620, 3320, 3821, 3927, 3941, 3968, 4014], 'heterochromatin': [106, 357, 3942, 4438], '(PC-HC).': [107, 358], 'In': [108, 156, 359, 407, 921, 3025, 3280, 3326, 3338, 4536], 'nucleus,': [110, 361], 'localized': [113, 364], 'solely': [114, 365], 'PC-HC,': [116, 241, 367, 492, 1619], 'whereas': [117, 368, 2944, 3265, 4197, 4524], 'protein': [120, 186, 191, 371, 437, 442, 1519, 1882], 'exhibits': [121, 372], 'dual': [122, 373], 'centromeric': [123, 374, 1034, 4437], 'non-centromeric': [125, 376], 'localization.': [126, 377], 'Mutational': [127, 378], 'analysis': [128, 379], 'defined': [129, 380], 'amino': [131, 382, 2766, 4246, 4273, 4316, 4340, 4406], 'acids': [132, 383, 2767, 4274, 4317, 4341, 4407], 'responsible': [133, 384, 1108, 4414], 'for': [134, 148, 240, 385, 399, 491, 506, 533, 1109, 1632, 2012, 2038, 2464, 2679, 2689, 2694, 2700, 3316, 3335, 3346, 3644, 4121, 4231, 4252, 4309, 4415, 4447], 'distinct': [136, 387, 1658], 'as': [142, 144, 393, 395, 818, 1146, 2135, 2211, 2450, 2529, 2567, 2612, 3208, 3247, 3593, 3979, 3981], 'well': [143, 394, 3980], 'sequence': [146, 211, 397, 462, 2496, 3330, 3850, 4248], 'required': [147, 398], 'specific': [150, 194, 401, 445, 4272, 4405], 'subcellular': [151, 402, 1663, 4481], 'localization': [152, 403, 1664, 3294, 4482, 4494, 4512, 4525], 'this': [154, 405, 2447, 2893], 'isoform.': [155, 406, 1459, 2894, 3298], 'proliferating': [157, 408], 'cells,': [158, 409, 1531, 1629, 3009, 3949, 3962, 4539], 'upstream': [165, 416, 2301], 'regulatory': [166, 210, 417, 461, 2300], 'region': [167, 418, 2041, 3245, 3779, 3835, 3928, 4015, 4256, 4276, 4301, 4319, 4409], 'target': [171, 213, 249, 422, 464, 500, 1025, 1044, 3923], 'genes': [172, 214, 218, 423, 465, 469, 1026, 1045, 4445], 'correlates': [173, 424], 'their': [175, 226, 426, 477, 1031], 'positive': [176, 427], 'by': [178, 429, 1885, 2018, 2069, 2132, 2166, 2243, 2250, 2683, 4042, 4090, 4228], 'Ikaros.': [179, 430, 2923], 'Results': [180, 431, 2256, 2742, 3954, 4325], 'suggest': [181, 432, 1720, 4209], 'restricts': [187, 438], 'toward': [193, 444, 1686, 3816, 4153], 'PC-HC': [195, 446, 3332, 3340, 3379, 3917], 'repeats.': [196, 447], 'propose': [198, 449, 1693], 'a': [199, 450, 819, 1208, 1296, 1434, 1694, 1791, 2167, 2176, 2184, 2258, 2719, 2888, 2935, 3825, 3875, 3987, 4013, 4029, 4076, 4103, 4154, 4173, 4176, 4236, 4360], 'model,': [200, 451], 'whereby': [201, 452, 1696], 'hIK-H-deficient': [205, 456], 'would': [215, 236, 466, 487, 4135], 'recruit': [216, 467, 4444], 'these': [217, 468, 1431, 4162, 4284], 'restrictive': [221, 472], 'compartment,': [223, 474], 'resulting': [224, 475, 1893], 'repression.': [227, 478], 'presence': [229, 480, 4254, 4270], 'complex': [235, 486], 'alter': [237, 488], 'its': [238, 489, 2945], 'leading': [242, 493], 'remodeling': [245, 496, 1114], 'activation': [247, 498, 1039, 1677, 1850], 'genes.': [250, 501], 'essential': [505], 'proper': [507], 'stem': [508], 'cell': [509, 1291, 1676, 1750, 1757, 1766, 1780, 1788, 2889, 2906, 2932, 2958, 3002, 3568], '(1Nichogiannopoulou': [511], 'A.': [512, 546, 578, 585, 627, 666, 679, 703, 727, 799, 826, 897, 974, 1001, 1173, 1189, 1251, 1267, 1313, 1326, 1356, 1392, 1837, 1866, 2316, 2354, 2402, 2425, 2427, 3429, 3502], 'Trevisan': [513], 'M.': [514, 554, 668, 719, 745, 834, 1055, 1077, 1157, 1235, 1315, 1340, 1378, 2326, 2418, 2420, 2423, 2533, 2822, 3521, 4458], 'Neben': [515, 2353], 'S.': [516, 572, 584, 633, 678, 713, 723, 729, 737, 754, 850, 878, 882, 1325, 1831, 1860, 2141, 2217, 2277, 2320, 2346, 2404, 3428, 3598, 3651, 3703], 'Friedrich': [517], 'C.': [518, 664, 756, 764, 766, 779, 783, 787, 899, 959, 1161, 1171, 1239, 1249, 1311, 1344, 1354, 1382, 2318, 3350, 3401, 3458, 3523], 'Georgopoulos': [519, 555, 835, 853, 975, 1002, 1190, 1268, 3624, 3729], 'K.': [520, 556, 574, 699, 709, 717, 836, 854, 951, 955, 976, 1003, 1053, 1191, 1269, 1924, 1936, 2810, 2814, 2816, 2818, 2820, 3623, 3625, 3728, 3730, 4456], 'J.': [521, 705, 707, 760, 768, 785, 1163, 1193, 1241, 1271, 1346, 1384, 1399, 1420, 1481, 1507, 1551, 1577, 2329, 2361, 2381, 2428, 2541, 2793, 2869, 3136, 3150, 3442, 3486, 3519, 3526], 'Exp.': [522, 2823], 'Med.': [523], '1999;': [524, 680, 748, 888, 1181, 1259, 1327, 1364, 1402, 1843, 1872], '190:': [525], '1201-1214Crossref': [526], 'PubMed': [527, 564, 589, 621, 638, 683, 773, 793, 844, 862, 891, 906, 968, 983, 1010, 1067, 1088, 1197, 1275, 1330, 1405, 1425, 1486, 1512, 1556, 1582, 1846, 1875, 1948, 2155, 2231, 2291, 2340, 2372, 2392, 2412, 2439, 2546, 2798, 2833, 2874, 3141, 3161, 3363, 3414, 3433, 3448, 3467, 3492, 3513, 3532, 3614, 3632, 3665, 3690, 3719, 3737, 4470], 'Scopus': [528, 565, 590, 622, 639, 684, 774, 794, 845, 863, 892, 907, 969, 984, 1011, 1068, 1089, 1198, 1276, 1331, 1406, 1426, 1487, 1513, 1557, 1583, 1949, 2156, 2232, 2292, 2341, 2373, 2393, 2413, 2440, 2547, 2799, 2834, 2875, 3142, 3162, 3364, 3415, 3434, 3449, 3468, 3493, 3514, 3533, 3615, 3633, 3666, 3691, 3720, 3738, 4471], '(184)': [529], 'Google': [530, 567, 592, 624, 641, 686, 751, 776, 796, 809, 847, 865, 894, 909, 971, 986, 1013, 1070, 1091, 1184, 1200, 1262, 1278, 1333, 1367, 1408, 1428, 1489, 1515, 1559, 1585, 1847, 1876, 1951, 2158, 2234, 2294, 2343, 2375, 2395, 2415, 2442, 2549, 2801, 2836, 2877, 3144, 3164, 3366, 3417, 3436, 3451, 3470, 3495, 3516, 3535, 3617, 3635, 3668, 3693, 3722, 3740, 4473], 'Scholar)': [531, 810, 2443, 2550], 'normal': [534, 3007], 'hematopoiesis': [535], 'lymphoid,': [538], 'myeloid,': [539, 1528], 'erythroid': [541, 1530], 'lineages': [542], '(2Wang': [543, 823], 'J.H.': [544, 824, 1413, 1474, 1544, 2786], 'Nichogiannopoulou': [545, 825], 'Wu': [547, 661, 827, 851, 1308], 'L.': [548, 550, 656, 660, 828, 830, 1153, 1187, 1231, 1265, 1303, 1307, 1336, 1370], 'Sun': [549, 829], 'Sharpe': [551, 831], 'A.H.': [552, 832], 'Bigby': [553, 833], 'Immunity.': [557, 612, 837], '1996;': [558, 838, 1194, 1272, 3489], '5:': [559, 839, 1182, 1260, 1365], '537-549Abstract': [560, 840], 'Full': [561, 616, 618, 841, 859, 1062, 1064, 1083, 1085, 2335, 2337, 2367, 2369, 2387, 2389, 2434, 2436, 2828, 2830, 3156, 3158, 3685, 3687, 4465, 4467], 'Text': [562, 617, 619, 842, 860, 1063, 1065, 1084, 1086, 2336, 2338, 2368, 2370, 2388, 2390, 2435, 2437, 2829, 2831, 3157, 3159, 3686, 3688, 4466, 4468], 'PDF': [563, 620, 843, 861, 1066, 1087, 2339, 2371, 2391, 2438, 2832, 3160, 3689, 4469], '(505)': [566, 846], 'Scholar,': [568, 593, 625, 687, 752, 777, 797, 848, 866, 895, 972, 1071, 1185, 1263, 1334, 1368, 1409, 1490, 1560, 2344, 2376, 2396, 2416, 2802, 3145, 3418, 3437, 3452, 3471, 3496, 3517, 3618, 3723], '3Lopez': [569], 'R.A.': [570], 'Schoetz': [571], 'DeAngelis': [573], "O'Neill": [575], 'D.': [576, 876, 1073, 3356, 3407, 3462, 3602, 3677, 3707], 'Bank': [577], 'Proc.': [579, 673, 1320, 3423], 'Natl.': [580, 674, 1321, 3424], 'Acad.': [581, 675, 1322, 3425], 'Sci.': [582, 676, 1323, 3426], 'U.': [583, 677, 1324, 3427], '2002;': [586, 790, 806, 2384, 3153, 3611, 3716], '99:': [587], '602-607Crossref': [588], '(85)': [591, 3692], '4Papathanasiou': [594], 'P.': [595, 629, 631, 801, 852, 953, 2328, 3147, 3506, 3621, 3726], 'Perkins': [596], 'A.C.': [597], 'Cobb': [598, 1925, 3605, 3710], 'B.S.': [599, 1926, 2139, 2215, 2275, 3606, 3649, 3711], 'Ferrini': [600, 3603, 3708], 'R.': [601, 603, 886, 1934, 3456, 3604, 3709], 'Sridharan': [602], 'Hoyne': [604], 'G.F.': [605], 'Nelms': [606], 'K.A.': [607], 'Smale': [608, 960, 1050, 1074, 1941, 2148, 2224, 2284, 3607, 3658, 3678, 3712, 4453], 'S.T.': [609, 961, 1051, 1075, 1942, 2149, 2225, 2285, 3608, 3659, 3679, 3713, 4454], 'Goodnow': [610], 'C.C.': [611, 3358, 3409, 3454], '2003;': [613, 635, 903, 1080, 1509, 1579, 2431, 2871, 3138, 3682], '19:': [614, 3511], '131-144Abstract': [615], '(123)': [623], '5Dumortier': [626], 'Kirstetter': [628], 'Kastner': [630], 'Chan': [632], 'Blood.': [634, 1842, 1871], '101:': [636], '2219-2226Crossref': [637], '(68)': [640], 'Scholar).': [642, 910, 1014, 1092, 1201, 1279, 1429, 1586, 1848, 1877, 1952, 2159, 2235, 2295, 2837, 3165, 3367, 3536, 3636, 3741, 4474], 'Loss': [643], 'has': [647, 813, 1855, 2270, 2843, 3576, 3582, 3943, 4244, 4260], 'been': [648, 814, 1286, 1856, 1920, 2271, 2312, 2844, 3324, 3577], 'associated': [649], 'development': [651], 'malignancies,': [654], '(6Sun': [655, 1302], 'Heerema': [657, 1304], 'N.': [658, 693, 695, 697, 743, 1169, 1247, 1305, 1352, 1390, 2812], 'Crotty': [659, 1154, 1232, 1306, 1337, 1375], 'X.': [662, 1309, 3352, 3403], 'Navara': [663, 1160, 1238, 1310, 1343, 1381], 'Vassilev': [665, 1172, 1250, 1312, 1355, 1391], 'Sensel': [667, 1156, 1234, 1314, 1339, 1377], 'Reaman': [669, 1174, 1252, 1316, 1357, 1395], 'G.H.': [670, 1175, 1253, 1317, 1358, 1396], 'Uckun': [671, 1176, 1254, 1318, 1359, 1397], 'F.M.': [672, 1177, 1255, 1319, 1360, 1398], '96:': [681, 1328], '680-685Crossref': [682, 1329], '(170)': [685, 1332], '7Nakayama': [688], 'H.': [689, 721, 733, 741, 868, 1159, 1237, 1342, 1380, 2348, 2352, 2804], 'Ishimaru': [690, 2805], 'F.': [691, 2324, 2806], 'Avitahl': [692], 'Sezaki': [694, 714, 2811], 'Fujii': [696], 'Nakase': [698, 2809], 'Ninomiya': [700], 'Y.': [701, 731, 735, 870, 880, 2808], 'Harashima': [702], 'Minowada': [704], 'Tsuchiyama': [706], 'Imajoh': [708], 'Tsubota': [710], 'T.': [711, 715, 739, 872, 874, 1833, 1835, 1862, 1864, 3600, 3705], 'Fukuda': [712], 'Kojima': [716], 'Hara': [718], 'Takimoto': [720], 'Yorimitsu': [722], 'Takahashi': [724, 879], 'I.': [725, 1841, 1870], 'Miyata': [726], 'Taniguchi': [728], 'Tokunaga': [730], 'Gondo': [732], 'Niho': [734], 'Nakao': [736], 'Kyo': [738], 'Dohy': [740], 'Kamada': [742], 'Harada': [744, 2821], 'Cancer': [746, 804, 1179, 1257, 1362], 'Res.': [747, 805, 1180, 1258, 1363, 3509], '59:': [749], '3931-3934PubMed': [750], '8Olivero': [753], 'Maroc': [755, 782], 'Beillard': [757], 'E.': [758, 1496, 1566, 2400, 2858, 3125, 3504], 'Gabert': [759, 784], 'Nietfeld': [761], 'W.': [762], 'Chabannon': [763, 786], 'Tonnelle': [765], 'Br.': [767], 'Haematol.': [769], '2000;': [770, 2152, 2228, 2288, 2364, 2825, 3662], '110:': [771], '826-830Crossref': [772], '(37)': [775], '9Tonnelle': [778], 'Calmels': [780], 'B.': [781, 2406, 3500], 'Leuk.': [788], 'Lymphoma.': [789], '43:': [791], '29-35Crossref': [792], '(10)': [795], '10Karlsson': [798], 'Soderkvist': [800], 'Zhuang': [802], 'S.M.': [803], '62:': [807], '2650-2653PubMed': [808], 'suggested': [815], 'tumor': [820], 'suppressor': [821], '11Winandy': [849], 'Cell.': [855, 1058, 3681, 4461], '1995;': [856, 3360, 3411], '83:': [857], '289-299Abstract': [858], '(362)': [864], '12Okano': [867], 'Saito': [869], 'Miyazawa': [871], 'Shinbo': [873], 'Chou': [875], 'Kosugi': [877], 'Odani': [881], 'Niwa': [883], 'O.': [884], 'Kominami': [885], 'Oncogene.': [887], '18:': [889], '6677-6683Crossref': [890], '(52)': [893], '13Rebollo': [896], 'Schmitt': [898], 'Immunol.': [900, 1079, 1421, 1482, 1508, 1552, 1578, 2542, 2794, 2870, 3137], 'Cell': [901, 963, 978, 1005, 3627, 3732], 'Biol.': [902, 964, 979, 1006, 2330, 2362, 2382, 2429, 3151, 3488, 3528, 3628, 3733], '81:': [904], '171-175Crossref': [905], '(108)': [908, 3616, 3721], 'alternatively': [915], 'isoforms.': [920, 1994, 3543, 4066], 'lymphoid': [923, 2905], 'cells': [924, 1540, 1727, 1808, 2101, 2113, 2124, 2523, 2528, 2852, 3029, 3067, 3094, 3119, 3173, 3188, 3199, 3539, 3559, 3592, 3596, 3639], 'most': [926], 'commonly': [927], 'expressed': [928, 1522, 2892, 2926, 3047, 3196, 3958, 4008], 'isoforms': [929, 1095, 1122, 1136, 1143, 1220, 1703, 2515, 2900, 3045, 3214, 3277, 3392, 3701, 3748, 3765, 3939, 4051, 4170, 4488], 'are': [930, 1100, 1790, 2449, 2455, 2743, 3640, 4413], 'IK-VI,': [931], 'which': [932, 943, 3797, 4134], 'was': [933, 1432, 1883, 1896, 1988, 2516, 2582, 2880, 2925, 2947, 3012, 3099, 3195, 3240, 3810, 3872, 3882, 3890, 4073, 4192, 4199, 4388, 4505, 4515, 4529], 'initially': [934], 'thought': [935, 1101], 'encode': [937], 'full-length': [939], 'protein,': [940], 'IK-V,': [942], 'lacks': [944], 'first': [946, 1591], 'N-terminal': [947, 1124], '(14Hahm': [950], 'Ernst': [952], 'Lo': [954], 'Kim': [956], 'G.S.': [957], 'Turck': [958], 'Mol.': [962, 977, 1004, 3443, 3487, 3527, 3626, 3680, 3731], '1994;': [965, 980, 1007], '14:': [966, 981, 1008, 2153, 2229, 2289, 3663], '7111-7123Crossref': [967], '(198)': [970], '15Molnar': [973], '8292-8303Crossref': [982, 1009], '(373)': [985, 1012], 'Scholar);': [987], 'designated': [988, 1462], 'Ik-1': [989], 'Ik-2,': [991], 'respectively,': [992], 'nomenclature': [995, 1466], 'Georgopoulous': [997], 'et': [998, 1469], 'al.': [999, 1470], '(15Molnar': [1000], 'hypothesized': [1017, 1205, 4442], 'control': [1022], 'elements': [1023], 'aid': [1029], 'recruitment': [1032], 'foci.': [1035], 'This': [1036], 'results': [1037, 1711, 2965, 3908, 4040], 'or': [1040, 1819, 2057, 2060, 2111, 2122, 2556, 3106, 3564, 3695, 4148, 4380], 'repression': [1041], '(16Brown': [1046, 4449], 'K.E.': [1047, 1930, 2145, 2221, 2281, 3655, 4450], 'Guest': [1048, 4451], 'S.S.': [1049, 4452], 'Hahm': [1052, 4455], 'Merkenschlager': [1054, 1076, 4457], 'Fisher': [1056, 1939, 2146, 2222, 2282, 3656, 4459], 'A.G.': [1057, 1940, 2147, 2223, 2283, 3657, 4460], '1997;': [1059, 4462], '91:': [1060, 4463], '845-854Abstract': [1061, 4464], '(658)': [1069, 4472], '17Liberg': [1072], 'Trends': [1078], '24:': [1081, 3630, 3735], '567-570Abstract': [1082], '(16)': [1090, 3365, 3416], 'Larger': [1093], 'like': [1096], 'IK-V': [1097, 2955], 'IK-VI': [1099, 1438, 2782, 2939, 2953, 4101, 4112], 'act': [1103, 1145], 'synergistically': [1104], 'be': [1107, 1207], 'expression.': [1119], 'Smaller': [1120], 'lacking': [1123], 'fingers': [1126], 'do': [1127, 3201], 'not': [1128, 2779, 2849, 2983, 3038, 3169, 3202, 3323, 3571, 3885, 3905, 4026, 4396], 'DNA.': [1130, 4352], 'Heterodimers': [1131], 'between': [1132, 1445, 1636, 2073, 2770, 4161], 'large': [1133, 3274], 'small': [1135, 1142], 'poorly,': [1139], 'suggesting': [1140], 'can': [1144], 'dominant': [1147, 1227], 'negative': [1148, 1228, 2568], 'inhibitors': [1149], '(18Sun': [1152, 1230], 'M.L.': [1155, 1233, 1338, 1376], 'Sather': [1158, 1236, 1341, 1379], 'Nachman': [1162, 1240, 1345, 1383, 2536], 'Steinherz': [1164, 1242, 1347, 1385], 'P.G.': [1165, 1243, 1348, 1386], 'Gaynon': [1166, 1244, 1349, 1387], 'P.S.': [1167, 1245, 1350, 1388], 'Seibel': [1168, 1246, 1351, 1389], 'Mao': [1170, 1248, 1353], 'Clin.': [1178, 1256, 1361, 1400], '2112-2120PubMed': [1183, 1261, 1366], '19Sun': [1186, 1264], 'Liu': [1188, 1266], 'EMBO': [1192, 1270], '15:': [1195, 1273], '5358-5369Crossref': [1196, 1274], '(307)': [1199, 1277], 'Malignant': [1202], 'transformation': [1203], 'direct': [1209], 'consequence': [1210], 'altered': [1212], '(or': [1213], 'diminished)': [1214], 'larger': [1218], 'because': [1221], 'overexpression': [1223], 'smaller,': [1226], 'ones': [1229], 'Previous': [1280], 'performed': [1287, 2210, 3951], 'using': [1288, 1824, 1957, 2045, 2183, 2252, 2518, 2551, 2908, 2968, 3242, 4075, 4517], 'systems.': [1292], 'Human': [1293, 2492, 2756, 3537, 4100, 4242, 4424], 'identified': [1295, 1457, 3919, 4336], 'number': [1297], 'additional': [1299, 1442, 2764], 'splice': [1300, 1435], 'forms': [1301], '18Sun': [1335], '20Sun': [1369], 'Goodman': [1371], 'P.A.': [1372], 'Wood': [1373], 'C.M.': [1374], 'Juran': [1393], 'B.D.': [1394], 'Oncol.': [1401], '17:': [1403], '3753-3766Crossref': [1404], '(99)': [1407], '21Payne': [1410], 'K.J.': [1411, 1472, 1492, 1542, 1562, 2784, 2854, 3121], 'Nicolas': [1412, 1473, 1543, 2785], 'Zhu': [1414, 1475, 1497, 1545, 1567, 2787, 2859, 3126], 'J.Y.': [1415, 1476, 1498, 1546, 1568, 2788, 2860, 3127], 'Barsky': [1416, 1477, 1501, 1547, 1571, 2789, 2863, 3130], 'L.W.': [1417, 1478, 1502, 1548, 1572, 2790, 2864, 3131], 'Crooks': [1418, 1479, 1505, 1549, 1575, 2791, 2867, 3134], 'G.M.': [1419, 1480, 1506, 1550, 1576, 2792, 2868, 3135], '2001;': [1422, 1483, 1553, 2795], '167:': [1423, 1484, 1554, 2796], '1867-1870Crossref': [1424, 1485, 1555, 2797], '(30)': [1427, 1488, 1558, 2800], 'Among': [1430], 'IK-H,': [1433], 'variant': [1436], 'includes': [1440], 'an': [1441, 2763, 2909, 3243, 3394, 3641, 4126], '60': [1443], 'bases': [1444], 'exons': [1446, 2771], '2': [1447, 2580, 2772], '3': [1449, 2774, 3071], '(Fig.': [1450, 2775, 2940, 2960, 3051, 3068, 3082, 3108, 3211, 3278, 3760, 3791, 3861, 3999, 4034, 4094, 4326, 4378, 4411, 4489], '1A),': [1451], 'thus': [1452, 1630], 'making': [1453], 'it': [1454, 1532, 2879, 3575, 4137, 4440], 'longest': [1456], '(IK-H': [1460], 'Ik1+': [1463], 'Payne': [1468, 1503, 1573, 2865, 3132], '(21Payne': [1471, 1541, 2783], '22Payne': [1491, 1561], 'Huang': [1493, 1563, 2855, 3122], 'G.': [1494, 1564, 2143, 2219, 2279, 2378, 2856, 3123, 3653, 3675], 'Sahakian': [1495, 1565, 2857, 3124], 'Barteneva': [1499, 1569, 2861, 3128], 'N.S.': [1500, 1570, 2862, 3129], 'M.A.': [1504, 1574, 2539, 2866, 3133], '170:': [1510, 1580, 2872, 3139], '3091-3098Crossref': [1511, 1581, 2873, 3140], '(41)': [1514, 1584, 2876, 3143], 'Scholar)).': [1516], 'IK-H': [1518, 2749, 2842, 2924, 3098, 3239, 3258, 3288, 4243, 4425, 4533], 'abundantly': [1521], 'primary': [1524, 1537, 1806, 3022, 3091], 'B,': [1526, 2305], 'NK,': [1527], 'barely': [1534], 'detectable': [1535], 'Here': [1587], 'we': [1588, 1626, 2996, 3030, 3254, 3284, 3553, 3950, 4164], '2The': [1598], 'abbreviations': [1599], 'used': [1600, 1627, 1897, 1902, 1989, 2445, 2566, 2583, 2607, 3207, 3381, 3554, 3883, 4389, 4476], 'are:': [1601], 'hIK,': [1602], 'Ikaros;': [1604], 'HA,': [1605], 'hemagglutinin;': [1606], 'FITC,': [1607], 'fluorescein': [1608], 'isothiocyanate;': [1609], 'ChIP,': [1610], 'immunoprecipitation': [1612], 'assay;': [1613, 1618], 'EMSA,': [1614], 'electrophoretic': [1615, 3395], 'mobility': [1616, 3396], 'shift': [1617, 2207, 2267, 3397], 'heterochromatin.': [1621], 'proteins.': [1622], 'For': [1623, 2053], 'our': [1624, 1637], 'allowing': [1631], 'more': [1633, 1731], 'valid': [1634], 'comparisons': [1635], 'data': [1639, 4037, 4124, 4208], 'obtained': [1642, 1769, 1998, 2967], 'studies.': [1645], 'exhibit': [1657], 'abilities': [1661, 3589], 'patterns.': [1665], 'Increased': [1666], 'isoform': [1672, 2759, 2993, 3194, 4542], '(hIK-H)': [1673], 'during': [1674], 'determines': [1678], 'specificity': [1682], 'repetitive': [1687], 'sequences': [1688, 2302, 3376], 'located': [1689], 'within': [1690, 2718, 3302, 3318, 3916, 4275, 4318, 4408], 'PC-HC.': [1691], 'model': [1695, 3643], 'coordinated': [1697], 'regulates': [1704], 'Our': [1710], 'expose': [1712], 'unique': [1713, 3345], 'properties': [1714], 'may': [1728], 'occur': [1729], 'through': [1730], 'complicated': [1732], 'mechanisms': [1733], 'than': [1734, 2950, 3102, 3812], 'mouse.': [1737], 'Cells—Human': [1738], 'CCRF-CEM': [1739], '(CEM)': [1740], 'MOLT-4': [1742, 3221, 3251], 'leukemia': [1744, 4502], 'T-cell': [1745, 1849, 2023, 3080, 3223, 4503], 'lines,': [1746], 'Ramos': [1748], 'B': [1749, 2649, 2654, 2931], 'line,': [1751, 1758, 1781, 1784, 3224], '293T': [1754, 2100, 2522, 3198, 3558, 3567, 3591, 3638, 3948, 3961, 4053], 'endothelial': [1755], 'kidney': [1756], 'NIH/3T3': [1763], '(3T3)': [1764], 'fibroblast': [1765], 'line': [1767, 1789, 3569, 4504], 'were': [1768, 1809, 1955, 1997, 2016, 2043, 2067, 2102, 2114, 2125, 2161, 2209, 2241, 2565, 2572, 2590, 2611, 2676, 2706, 2729, 2966, 3004, 3046, 3189, 3231, 4303, 4307, 4321, 4364], 'American': [1771], 'Type': [1772], 'Culture': [1773], 'Collection': [1774], '(ATCC).': [1775], '7OZ3': [1778], 'pre-B': [1779], 'BAL17': [1782], 'B-cell': [1783], 'VL3-3M2': [1786, 2110], 'thymocyte': [1787], 'generous': [1792, 2086], 'gift': [1793, 2087], 'laboratory': [1796, 2090], 'Stephen': [1798], 'Smale,': [1799], 'HHMI,': [1800], 'UCLA,': [1801], 'Los': [1802], 'Angeles,': [1803], 'CA.': [1804], 'Peripheral': [1805], 'isolated': [1810], 'donor': [1813], 'peripheral': [1814, 2022, 3064], 'blood': [1815], '(American': [1816], 'Red': [1817, 1981], 'Cross),': [1818], 'spleen': [1820], 'C57BL/6': [1822], 'mice': [1823], 'nylon': [1826], 'wool': [1827], 'column': [1828], 'method': [1829, 2048], '(23Matikainen': [1830, 1859], 'Sareneva': [1832, 1861], 'Ronni': [1834, 1863, 3599, 3704], 'Lehtonen': [1836, 1865], 'Koskinen': [1838, 1867], 'P.J.': [1839, 1868], 'Julkunen': [1840, 1869], '93:': [1844, 1873], '1980-1991Crossref': [1845, 1874], 'PMA': [1852], 'anti-CD3': [1854], 'previously': [1858, 1922, 2137, 2213, 2273, 2314, 2530], 'Antibodies—Specific': [1878], 'antibody': [1879, 1971, 2564, 2911, 2970, 3237, 3259, 3268, 3289], 'against': [1880, 3238, 4519], 'generated': [1884, 2044], 'immunizing': [1886], 'rabbits': [1887], 'KLH-conjugated': [1889], 'peptide': [1890, 3246], 'TYGADDFRDFHAIIIPKSF.': [1891], 'rabbit': [1894], 'anti-serum': [1895], 'at': [1898, 2163, 2731, 2934, 3048, 4224], '1:1000': [1899], 'dilution.': [1900], 'Antibodies': [1901], 'detect': [1904, 1991, 3291], 'C': [1906, 2916], 'terminus': [1907, 1912, 2917, 2976], '(IK-CTS)': [1908, 2912], 'N': [1911, 2042, 2065, 2975, 3244, 3304, 4277, 4302, 4320, 4410], '(IK-NTS)': [1913, 2971], '(24Hahm': [1923], 'McCarty': [1927], 'A.S.': [1928, 3673], 'Brown': [1929, 2144, 2220, 2280, 2538, 3654], 'Klug': [1931], 'C.A.': [1932], 'Lee': [1933, 3457], 'Akashi': [1935], 'Weissman': [1937], 'I.L.': [1938], 'Genes': [1943, 2150, 2226, 2286, 3609, 3660, 3714], 'Dev.': [1944, 2151, 2227, 2287, 3610, 3661, 3715], '1998;': [1945, 2332], '12:': [1946], '782-796Crossref': [1947], '(209)': [1950], 'Anti-Ikaros': [1953], 'antibodies': [1954, 1961, 1996, 4518, 4534], 'visualized': [1956, 1978], 'FITC-goat': [1958], 'anti-rabbit': [1959], 'IgG': [1960, 1984, 2561], '(Jackson': [1962, 1985], 'ImmunoResearch,': [1963], 'West': [1964], 'Grove,': [1965], 'PA).': [1966], 'HA-specific': [1968], 'mouse': [1969, 2920, 2978, 3019, 3092], 'monoclonal': [1970], 'HA.11': [1972], '(Covance': [1973], 'Research': [1974], 'Products,': [1975], 'Harrisburg,': [1976], 'PA),': [1977], 'Texas': [1980], 'goat': [1982], 'anti-mouse': [1983], 'Immuno': [1986], 'Research),': [1987], 'HA-tagged': [1992, 2058, 4509], 'Anti-Helios': [1995], 'Santa': [2000], 'Cruz': [2001], 'Biotechnology': [2002], '(Santa': [2003], 'Cruz,': [2004], 'CA).': [2005, 2052, 2099], 'Plasmids,': [2006], 'Transfection,': [2007], 'Retroviral': [2009], 'Transduction—': [2010], 'cDNAs': [2011], 'amplified': [2017, 2068], 'RT-PCR': [2019], 'total': [2024, 2726], 'RNA': [2025], 'cloned': [2027, 2072], 'into': [2028], 'mammalian': [2030], 'vector': [2032, 2084], 'pcDNA3': [2033], '(Invitrogen).': [2034], 'Alanine': [2035], 'substitution': [2036], 'mutants': [2037, 3697, 4306], 'QuikChange': [2047], '(Stratagene,': [2049], 'La': [2050], 'Jolla,': [2051], 'retrovirus': [2054, 2129], 'generation,': [2055], '(HA': [2062], 'tag': [2063, 4522], 'terminus)': [2066], 'PCR': [2070, 2609, 2674, 2704], 'BglII': [2074], 'EcoRI': [2076], 'sites': [2077, 2454, 3315, 3759, 3975, 4021], 'MSCV': [2080], 'IRES': [2081], 'GFP': [2082], '(MIG)': [2083], '(a': [2085], 'David': [2092], 'Baltimore,': [2093], 'California': [2094], 'Institute': [2095], 'Technology,': [2097], 'Pasadena,': [2098], 'transfected': [2103], 'via': [2104], 'calcium': [2106], 'phosphate': [2107], 'method.': [2108], 'CEM,': [2109], '3T3': [2112, 2123], 'infected': [2115, 2126], 'amphotropic': [2117, 2128], 'retrovirus.': [2118], 'Confocal': [2119, 2171], 'Microscopy—CEM,': [2120], 'VL3-3M2,': [2121], 'analyzed': [2131, 2707, 2730], 'confocal': [2133, 4477], 'microscopy': [2134, 4478], '(25Cobb': [2138, 2214, 2274, 3648], 'Morales-Alcelay': [2140, 2216, 2276, 3650], 'Kleiger': [2142, 2218, 2278, 3652, 3674], '2146-2160Crossref': [2154, 2230, 2290, 3664], '(210)': [2157, 2233, 2293, 3667], 'Images': [2160], 'acquired': [2162], 'room': [2164], 'temperature': [2165], 'Leica': [2168, 2177, 2186], 'TCS-SP': [2169], 'MP': [2170], 'Multiphoton': [2173], 'Microscope': [2174], 'DM-LFS': [2178], 'body': [2179], '(upright': [2180], 'fixed-stage': [2181], 'microscope)': [2182], '×100': [2185], 'HX': [2187], 'PLAPO': [2188], '(Planapo)': [2189], 'oil': [2190], 'immersion': [2191], 'lens': [2192], 'numerical': [2194], 'aperture': [2195], '1.4': [2197], '(Heidelberg,': [2198], 'Germany).': [2199], 'Biochemical': [2200], 'Experiments—Nuclear': [2201], 'extractions,': [2202], 'Western': [2203], 'blots,': [2204], 'gel': [2206, 2266], 'experiments': [2208], 'Differences': [2236], 'quantified': [2242], 'measuring': [2244], 'strength': [2246], 'shifted': [2248], 'bands': [2249, 3183, 3230], 'phosphorimaging': [2251], 'ImageQuant': [2253], '5.1': [2254], 'program.': [2255], 'represent': [2257], 'mean': [2259], 'value': [2260], 'three': [2262, 2746, 3044, 3273, 4404], 'different': [2263, 3342], 'experiments.': [2264, 2748], 'probe': [2268, 3752, 3876, 3894, 4077, 4096, 4142, 4174, 4384], 'IkBS4': [2269], 'Probes': [2296, 2444], 'derived': [2297, 3372, 3774, 3819, 3877, 3895], 'Granzyme': [2304, 2648, 2653], 'IKCa1,': [2306], 'VPAC-1,': [2307], 'STAT4,': [2308], 'FAAH': [2310], '(26Wargnier': [2315], 'Lafaurie': [2317], 'Legros-Maida': [2319], 'Bourge': [2321], 'J.F.': [2322], 'Sigaux': [2323], 'Sasportes': [2325], 'Paul': [2327, 3522], 'Chem.': [2331, 2363, 2383, 2430, 3152], '273:': [2333], '35326-35331Abstract': [2334], '(53)': [2342], '27Ghanshani': [2345], 'Wulff': [2347], 'Miller': [2349], 'M.J.': [2350], 'Rohm': [2351], 'Gutman': [2355], 'G.A.': [2356], 'Cahalan': [2357], 'M.D.': [2358], 'Chandy': [2359], 'K.G.': [2360], '275:': [2365], '37137-37149Abstract': [2366], '(363)': [2374], '28Dorsam': [2377], 'Goetzl': [2379], 'E.J.': [2380], '277:': [2385, 3154], '13488-13493Abstract': [2386], '(21)': [2394], '29Yap': [2397], 'W.H.': [2398], 'Yeoh': [2399], 'Tay': [2401], 'Brenner': [2403], 'Venkatesh': [2405], 'FEBS': [2407], 'Lett.': [2408], '2005;': [2409, 2543], '579:': [2410], '4470-4478Crossref': [2411], '(34)': [2414], '30Maccarrone': [2417], 'Bari': [2419], 'Di': [2421], 'Rienzo': [2422], 'Finazzi-Agro': [2424], 'Rossi': [2426], '278:': [2432], '32726-32732Abstract': [2433], '(101)': [2441], 'article': [2448], 'follows': [2451], '(Ikaros': [2452], 'underlined):': [2456], 'single': [2457, 3826, 3988, 4030, 4155, 4177, 4204, 4237, 4382], 'site': [2458, 3991, 4033, 4180, 4205, 4383], 'probe:': [2459], 'GAGTTACAGGAAAAGTATTTGGTTGTGAGAATTGCCCAAAGGTGTCAA;': [2460], 'IKBS40:': [2461], 'GAGTTACAGGAAAAGTATTTGGTTGTGAGAATTGCCCAAAGGTGTCAAGGTTATGGAAAAGAGTTACA.': [2462], 'Sequences': [2463, 2604], 'probes:': [2466], 'γ': [2467, 2477, 2614, 2619, 2624, 2629, 3777, 3832, 3897, 4085], 'satellite': [2468, 2478, 2494, 3778, 3833, 3848, 3898, 4086], 'chromosome': [2471, 2481, 3348, 3781, 3838, 3902], '8': [2472, 2616, 2621, 3782, 3839, 4114], '(γ': [2473, 2485, 3783, 3840, 3976, 3992, 4022], 'Sat': [2474, 2486], '8):': [2475], 'GCGAGACCGCAGGGAATGCTGGGAGCCTCCC;': [2476], '8-2': [2482, 2626, 2631, 3834], '(single': [2483], 'site)': [2484], '8-2):': [2487, 3842], 'GAGACTGCAGGAAATGCTAGGAT;': [2488], 'Beta': [2489], 'D:': [2490], 'GGGTGGAGGAAAGGCATGAGAGCTCTGCCCAGGCTGCTCCCACAGCCC;': [2491], 'α': [2493, 2634, 2638, 3847, 3995], 'consensus': [2495, 3828, 3846, 4146, 4157, 4238], '(α': [2497, 3851], 'sat):': [2498], 'GGCCTATGGTGGAAAAGGAAATATCTTC;': [2499], 'CENP-B': [2500, 2642, 2645, 3857], 'box:': [2501, 3858], 'GAGGCCTTCGTTGGAAACGGGATTAT;': [2502], 'Satellite': [2503], '3:': [2504], 'ATTCCATTCCATTCCATTCCATTCCATTCC.': [2505], 'ChIP': [2506, 2519, 3952, 4001], '(Chromatin': [2507], 'Immunoprecipitation)': [2508], 'Assay—In': [2509], 'vivo': [2510, 3946, 3965, 4012, 4047], 'tested': [2517, 4165, 4308], 'assays': [2520, 4002], 'activated': [2526, 3018, 3118, 3171], '(31Kwan': [2532], 'Powell': [2534], 'D.R.': [2535], 'T.Y.': [2537], 'Eur.': [2540], '35:': [2544], '1267-1274Crossref': [2545], '(17)': [2548], '10': [2552], 'μg': [2553], 'IK-CTS': [2555, 3267], 'Ik-H': [2557], 'antibodies.': [2558], 'Immunoprecipitations': [2559], 'no': [2563, 3888], 'controls.': [2569], 'Chromatin': [2570], 'immunoprecipitates': [2571], 'resuspended': [2573, 2591], '50': [2575], 'μlof': [2576], 'sterile': [2577, 2596], 'H2O,': [2578], 'μl': [2581, 2594], 'each': [2585, 3193, 3347], 'PCR.': [2586, 2603], 'Total': [2587], 'input': [2588], 'samples': [2589, 2717], '100': [2593], 'H2O': [2597], 'then': [2599], 'diluted': [2600], '1:100': [2601], 'before': [2602], 'primers': [2606], 'reactions': [2610], 'follows:': [2613], 'sat': [2615, 2620, 2625, 2630, 2635, 2639, 3784, 3841, 3977, 3993, 3996, 4023], 'forward,': [2617, 2627, 2636, 2643, 2651, 2660, 2668], '5′-GTTGATGGTGGCTTGGGTG-3′;': [2618], 'reverse,': [2622, 2632, 2640, 2646, 2656, 2664, 2672], '5′-CCATTTACGAGAAACACAGGC-3′;': [2623], '5′-CGCCACAACCAAAAACGTTG-3′;': [2628], '5′-CAAGGCCTGGGGATTTACAG-3′;': [2633], '5′-CATTCTCAGAAACTTCTTTG-3′;': [2637], '5′-CTTCTGTCTAGTTTTTATGTG-3′;': [2641], '5′-AATCTGCAAGTGGATATTTG-3′;': [2644], '5′-CTACAAAAAGAGTGTTTCAAA-3′;': [2647], 'promoter': [2650, 2655, 2659, 2663, 2667, 2671], '5′-CTGATGGATTTAGCAGCATGG-3′;': [2652], '5′-AGAGGAAAGAGGTGGAGCAG-3′;': [2657], 'IKCa1': [2658, 2662], '5′-TCTACACGTATTGGGTTTCG-3′;': [2661], '5′-GCACACAACACAACCTACAC-3′;': [2665], 'VPAC-1': [2666, 2670], '5′-CAGCCTGGGAAGATAAGTGG-3′;': [2669], '5′-CGTCGTGAGACATTTATAGGC-3′.': [2673], 'conditions': [2675], '95': [2677, 2687], '°C': [2678, 2688, 2693, 2699], '5': [2680, 3111], 'min,': [2681], 'followed': [2682], '30': [2684, 2690, 2695], 'cycles': [2685], 's,': [2691, 2696], '58': [2692], '72': [2698], '45': [2701], 's.': [2702], 'Final': [2703], 'products': [2705], 'on': [2708, 2737, 3772], 'agarose': [2709, 2740], 'gels': [2710], '(2%)': [2711], 'ethidium': [2713], 'bromide': [2714], 'staining.': [2715], 'All': [2716], 'particular': [2720, 3930], 'set': [2721], '(anti-Ikaros': [2722], 'antibodies,': [2723], 'IgG,': [2724], 'control)': [2728], 'same': [2733, 2739], 'time': [2734], 'electrophoresed': [2736], 'gel.': [2741], 'representative': [2744], 'independent': [2747], 'Is': [2750], 'Differentially': [2751], 'Expressed': [2752], 'Mouse': [2754], 'Lymphoid': [2757], 'Cells—Ikaros': [2758], 'H': [2760], '(IK-H)': [2761], 'contains': [2762, 3341, 3754, 3824, 4017], '20': [2765], '(region': [2768], 'N)': [2769], '1A)': [2776], 'present': [2780], '32Nakayama': [2803], 'Katayama': [2807], 'Takenaka': [2813], 'Shinagawa': [2815], 'Ikeda': [2817], 'Niiya': [2819], 'Hematol.': [2824], '28:': [2826], '1232-1238Abstract': [2827], '(18)': [2835], 'Because': [2838], 'abundant': [2839, 3175], 'detected': [2845, 3269, 4516, 4530], 'human,': [2847, 3167], 'but': [2848, 3037, 3168, 4025], '(22Payne': [2853, 3120], 'Scholar),': [2878, 3669, 3694], 'study': [2883, 3546], 'type': [2890], 'examined': [2896, 3013], 'lines': [2907, 2933, 2959, 3003, 3081], 'recognizes': [2914, 2973], 'both': [2919, 3015, 3115, 3795], 'level': [2936], 'comparable': [2937, 3049], '1B,': [2941, 2961, 3083], 'lanes': [2942, 2962, 3053, 3070, 3084, 3110, 3762, 3793, 3863, 4098, 4184, 4328, 4334], '1–3,': [2943], '10-fold': [2948, 3100, 3853, 4108, 4193], 'lower': [2949, 3101], '4–6).': [2963], 'Identical': [2964], 'another': [2969], '(data': [2982, 3884, 3904], 'shown).': [2984, 3906], 'To': [2985, 3177, 3932, 4159, 4491], 'determine': [2986], 'if': [2987], 'differing': [2989], 'patterns': [2990], 'observed': [2997, 3873, 3891, 4041, 4074, 4123], 'characteristic': [3005], 'resting': [3016, 3116], 'resting,': [3026], 'hIk-V,': [3036], 'hIK-H;': [3039], 'however,': [3040], 'following': [3041], 'activation,': [3042], 'all': [3043, 3270, 3336], 'levels': [3050], '1C,': [3052, 3069, 3109], '1–4).': [3054, 4099, 4185], 'Thus,': [3055, 3166, 3544, 3637, 4403], 'activated,': [3062], 'primary,': [3063], '4)': [3073], 'similar': [3075, 3768, 3866, 4295], '1–3).': [3085, 3763], 'Consistent': [3086], 'previous': [3088], 'reports,': [3089], 'mIK-VI': [3105, 4198, 4220], 'mIK-V': [3107], '6),': [3113], '33Sun': [3146], 'Loh': [3148], 'H.H.': [3149], '12854-12860Abstract': [3155], '(20)': [3163], 'murine,': [3170], 'express': [3174, 3203, 3540, 3562, 3572, 4508], 'IK-H.': [3176], 'verify': [3178], 'top': [3181, 3229], 'seen': [3184], 'hIK-VI,': [3192, 3957], '(which': [3200], 'endogenous': [3204, 3217, 4527], 'Ikaros),': [3205], 'size': [3209], 'markers': [3210], '1D).': [3212], 'Overexpressed': [3213], 'co-migrated': [3215], 'confirming': [3225], 'A': [3235, 3865, 4087], 'polyclonal': [3236], 'prepared': [3241], 'epitope.': [3249], 'Using': [3250], 'nuclear': [3252, 3555], 'extract,': [3253], 'show': [3255, 4003], 'detects': [3260], 'only': [3261], '1E).': [3279], 'reported': [3282], 'here': [3283], 'will': [3285], 'use': [3286], 'Specific': [3299], 'Amino': [3300], 'Acids': [3301, 3508], 'Region': [3303], 'Determine': [3305], 'Reduced': [3307], 'Binding': [3309], 'Ability': [3310], 'IK-H—The': [3312], 'potential': [3313, 3920], 'identified.': [3325], 'mice,': [3327], 'uniform': [3334], 'chromosomes.': [3337, 3931], 'humans,': [3339], 'sequences,': [3343], 'often': [3344], '(34Lee': [3349, 3400], 'Li': [3351, 3402], 'Jabs': [3353, 3404], 'E.W.': [3354, 3405], 'Court': [3355, 3406, 3461], 'Lin': [3357, 3408], 'Chromosoma.': [3359, 3410, 3463], '104:': [3361, 3412], '103-112Crossref': [3362, 3413], 'designed': [3369], 'probes': [3371, 3773, 3818], 'published': [3374], 'them': [3382], 'test': [3384], 'individual': [3390, 3551, 3699], 'assay': [3398], '(EMSA)': [3399], '35Waye': [3419], 'J.S.': [3420, 3441], 'Willard': [3421], 'H.F.': [3422, 3439], '1989;': [3430], '86:': [3431], '6250-6254Crossref': [3432], '(133)': [3435], '36Willard': [3438], 'Waye': [3440], 'Evol.': [3444], '1987;': [3445], '25:': [3446], '207-214Crossref': [3447], '(158)': [3450], '37Lin': [3453], 'Sasi': [3455], 'Fan': [3459], 'Y.S.': [3460], '1993;': [3464], '102:': [3465], '333-339Crossref': [3466], '(28)': [3469], '38Romanova': [3472], 'L.Y.': [3473], 'Deriagin': [3474], 'G.V.': [3475], 'Mashkova': [3476], 'T.D.': [3477], 'Tumeneva': [3478], 'I.G.': [3479], 'Mushegian': [3480], 'A.R.': [3481], 'Kisselev': [3482], 'L.L.': [3483], 'Alexandrov': [3484], 'I.A.': [3485], '261:': [3490], '334-340Crossref': [3491], '(65)': [3494], '39Choo': [3497], 'K.H.': [3498], 'Vissel': [3499], 'Nagy': [3501], 'Earle': [3503], 'Kalitsis': [3505], 'Nucleic': [3507], '1991;': [3510], '1179-1182Crossref': [3512], '(213)': [3515], '40Prosser': [3518], 'Frommer': [3520], 'Vincent': [3524], 'P.C.': [3525], '1986;': [3529], '187:': [3530], '145-155Crossref': [3531], '(134)': [3534], 'extracts': [3556], 'transduced': [3560, 3580, 4506], 'hIK-H.': [3565, 4118], 'does': [3570], 'shown': [3578], 'identical': [3583, 4245], 'phosphorylation': [3584], 'status': [3585], '(41Dovat': [3597, 3702], 'Russell': [3601, 3706], '16:': [3612, 3717], '2985-2990Crossref': [3613, 3718], '42Gomez-del': [3619, 3724], 'Arco': [3620, 3725], 'Maki': [3622, 3727], '2004;': [3629, 3734], '2797-2807Crossref': [3631, 3736], '(76)': [3634, 3739], 'established': [3642], 'studying': [3645], 'protein-protein': [3670], 'interactions': [3671], '(43McCarty': [3672], 'Eisenberg': [3676], '11:': [3683], '459-470Abstract': [3684], 'phosphomimetic': [3696], 'Both': [3742, 3764], 'bound': [3749], 'IKBS4': [3751], 'optimal': [3756], '2A,': [3761, 3792], 'also': [3766], 'exhibited': [3767], 'affinities': [3771], '8)': [3785], 'beta': [3788], 'D': [3789], 'repeat': [3790], '4–9),': [3794], 'contained': [3798, 4234], 'sites.': [3802], 'However,': [3803], 'stronger': [3811, 3860], '(PC-HC)': [3822], 'site:': [3830], '8-fold': [3843], 'stronger;': [3844, 3854], 'Sat):': [3852], '6-fold': [3859], '2B,': [3862], '1–9).': [3864], 'difference': [3867, 4069], 'when': [3874, 4375], 'pJ': [3879], 'alpha': [3880], 'box': [3881], 'shown),': [3886], 'while': [3887], 'X': [3903], 'These': [3907, 4036, 4207], 'reveal': [3909], 'specificities': [3912], 'establish': [3933], 'whether': [3934], 'actual': [3935], 'occurred': [3944], 'assays.': [3953], 'showed': [3955, 4102], 'individually': [3959], 'binds': [3963, 4010], 'repeats': [3969, 3984], 'contain': [3971, 3986], '8),': [3978, 4024], '8-2,': [3994], 'CENP-B)': [3998], '2C).': [4000, 4035], 'individually,': [4009], 'regions': [4027], 'confirm': [4038], 'EMSA': [4043], 'correlate': [4044], 'compared': [4056, 4218, 4265, 4421], 'containing': [4078, 4143, 4175], 'bindings': [4081], '(from': [4083], 'PC-HC)': [4088], 'separated': [4089], '40': [4091], 'base': [4092], 'pairs': [4093, 4338], '2D,': [4095, 4327], 'IKBS40;': [4097], 'over': [4107], 'times': [4115], 'Possible': [4119], 'explanations': [4120], 'include': [4125], 'increased': [4127, 4149, 4212, 4229], 'form': [4132], 'multimers,': [4133], 'enable': [4136], 'distant': [4145], 'sites,': [4147], 'site.': [4158, 4241], 'distinguish': [4160, 4492], 'possibilities': [4163], '(supplemental': [4181, 4385], 'Fig.': [4182, 4332, 4386], 'S1A,': [4183, 4333], 'unable': [4200], 'probe.': [4206], 'least': [4225], 'partly': [4226], 'caused': [4227], 'acid': [4247], 'except': [4251], 'N,': [4257], 'yet': [4258], 'decreased': [4261, 4416], 'If': [4268], 'interferes': [4278], 'binding,': [4281], 'mutation': [4282, 4343], 'should': [4285], 'give': [4286], 'Alanine-scanning': [4298], 'mutations': [4299, 4354], 'performed,': [4304], 'ability.': [4312, 4402], 'Initially,': [4313], 'consecutive': [4315], 'mutated': [4322, 4373], 'alanine.': [4324], '5–14': [4329], 'supplemental': [4331], '5–14)': [4335], 'whose': [4342], 'alanine': [4345], 'gave': [4346], 'Point': [4353], 'glycine,': [4356], 'phenylalanine,': [4357], 'lesser': [4361], 'extent,': [4362], 'histidine,': [4363], 'able': [4365], 'restore': [4367], 'either': [4376], 'IKBS40': [4377], '2E)': [4379], 'S1B)': [4387], 'EMSA.': [4391], 'Mutation': [4392], 'tyrosine': [4394], 'did': [4395], 'seem': [4397], 'affect': [4399], '2F)': [4412], 'Exhibits': [4426], 'Dual': [4427], 'Centromeric': [4428], 'Noncentromeric': [4430], 'Localization—In': [4431], 'lymphocytes,': [4433], 'localizes': [4435], 'where': [4439], 'destined': [4446], 'inactivation': [4448], 'examine': [4480], '3).': [4490], 'pattern': [4495], 'CEM': [4501, 4537], 'Subcellular': [4511], 'HA': [4521], '(red),': [4523], 'isoform-specific': [4532], '(green).': [4535], 'displa': [4543]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W1989718163', 'counts_by_year': [{'year': 2023, 'cited_by_count': 1}, {'year': 2021, 'cited_by_count': 4}, {'year': 2020, 'cited_by_count': 4}, {'year': 2018, 'cited_by_count': 1}, {'year': 2017, 'cited_by_count': 3}, {'year': 2016, 'cited_by_count': 3}, {'year': 2015, 'cited_by_count': 4}, {'year': 2014, 'cited_by_count': 7}, {'year': 2013, 'cited_by_count': 4}, {'year': 2012, 'cited_by_count': 1}], 'updated_date': '2024-09-17T15:05:51.486033', 'created_date': '2016-06-24'}

Publication Information

Video

Basic Information

Access and Citation

AI Researcher Chatbot

Primary Location

Authors

Topics

Keywords

Related Works