Publication Information

{'id': 'https://openalex.org/W1989155925', 'doi': 'https://doi.org/10.1074/jbc.m104597200', 'title': 'Phosphatidylserine-specific Phospholipase A1Stimulates Histamine Release from Rat Peritoneal Mast Cells through Production of 2-Acyl-1-lysophosphatidylserine', 'display_name': 'Phosphatidylserine-specific Phospholipase A1Stimulates Histamine Release from Rat Peritoneal Mast Cells through Production of 2-Acyl-1-lysophosphatidylserine', 'publication_year': 2001, 'publication_date': '2001-08-01', 'ids': {'openalex': 'https://openalex.org/W1989155925', 'doi': 'https://doi.org/10.1074/jbc.m104597200', 'mag': '1989155925', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/11395520'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m104597200', 'pdf_url': 'http://www.jbc.org/article/S0021925820896598/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S0021925820896598/pdf', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5078636344', 'display_name': 'Hiroyuki Hosono', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I74801974', 'display_name': 'The University of Tokyo', 'ror': 'https://ror.org/057zh3y96', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I74801974']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Hiroyuki Hosono', 'raw_affiliation_strings': ['Graduate School of Pharmaceutical Sciences, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033, Japan and the'], 'affiliations': [{'raw_affiliation_string': 'Graduate School of Pharmaceutical Sciences, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033, Japan and the', 'institution_ids': ['https://openalex.org/I74801974']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5026162371', 'display_name': 'Junken Aoki', 'orcid': 'https://orcid.org/0000-0001-9435-1896'}, 'institutions': [{'id': 'https://openalex.org/I74801974', 'display_name': 'The University of Tokyo', 'ror': 'https://ror.org/057zh3y96', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I74801974']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Junken Aoki', 'raw_affiliation_strings': ['Graduate School of Pharmaceutical Sciences, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033, Japan and the'], 'affiliations': [{'raw_affiliation_string': 'Graduate School of Pharmaceutical Sciences, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033, Japan and the', 'institution_ids': ['https://openalex.org/I74801974']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5085076158', 'display_name': 'Yuki Nagai', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I74801974', 'display_name': 'The University of Tokyo', 'ror': 'https://ror.org/057zh3y96', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I74801974']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Yuki Nagai', 'raw_affiliation_strings': ['Graduate School of Pharmaceutical Sciences, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033, Japan and the'], 'affiliations': [{'raw_affiliation_string': 'Graduate School of Pharmaceutical Sciences, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033, Japan and the', 'institution_ids': ['https://openalex.org/I74801974']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5047192208', 'display_name': 'Koji Bandoh', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I74801974', 'display_name': 'The University of Tokyo', 'ror': 'https://ror.org/057zh3y96', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I74801974']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Koji Bandoh', 'raw_affiliation_strings': ['Graduate School of Pharmaceutical Sciences, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033, Japan and the'], 'affiliations': [{'raw_affiliation_string': 'Graduate School of Pharmaceutical Sciences, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033, Japan and the', 'institution_ids': ['https://openalex.org/I74801974']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5061787293', 'display_name': 'Mayuko Ishida', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I33858575', 'display_name': 'Nagoya City University', 'ror': 'https://ror.org/04wn7wc95', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I33858575']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Mayuko Ishida', 'raw_affiliation_strings': ['Faculty of Pharmaceutical Sciences, Nagoya City University, 3-1 Tanabe-dori, Mizuho-ku, Nagoya, Aichi 467-0027, Japan'], 'affiliations': [{'raw_affiliation_string': 'Faculty of Pharmaceutical Sciences, Nagoya City University, 3-1 Tanabe-dori, Mizuho-ku, Nagoya, Aichi 467-0027, Japan', 'institution_ids': ['https://openalex.org/I33858575']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5029449740', 'display_name': 'Ryo Taguchi', 'orcid': 'https://orcid.org/0009-0001-5275-4563'}, 'institutions': [{'id': 'https://openalex.org/I33858575', 'display_name': 'Nagoya City University', 'ror': 'https://ror.org/04wn7wc95', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I33858575']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Ryo Taguchi', 'raw_affiliation_strings': ['Faculty of Pharmaceutical Sciences, Nagoya City University, 3-1 Tanabe-dori, Mizuho-ku, Nagoya, Aichi 467-0027, Japan'], 'affiliations': [{'raw_affiliation_string': 'Faculty of Pharmaceutical Sciences, Nagoya City University, 3-1 Tanabe-dori, Mizuho-ku, Nagoya, Aichi 467-0027, Japan', 'institution_ids': ['https://openalex.org/I33858575']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5101493202', 'display_name': 'Hiroyuki Arai', 'orcid': 'https://orcid.org/0000-0002-3057-6671'}, 'institutions': [{'id': 'https://openalex.org/I74801974', 'display_name': 'The University of Tokyo', 'ror': 'https://ror.org/057zh3y96', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I74801974']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Hiroyuki Arai', 'raw_affiliation_strings': ['Graduate School of Pharmaceutical Sciences, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033, Japan and the'], 'affiliations': [{'raw_affiliation_string': 'Graduate School of Pharmaceutical Sciences, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033, Japan and the', 'institution_ids': ['https://openalex.org/I74801974']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5109959543', 'display_name': 'Keizo Inoue', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I74801974', 'display_name': 'The University of Tokyo', 'ror': 'https://ror.org/057zh3y96', 'country_code': 'JP', 'type': 'education', 'lineage': ['https://openalex.org/I74801974']}], 'countries': ['JP'], 'is_corresponding': False, 'raw_author_name': 'Keizo Inoue', 'raw_affiliation_strings': ['Graduate School of Pharmaceutical Sciences, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033, Japan and the'], 'affiliations': [{'raw_affiliation_string': 'Graduate School of Pharmaceutical Sciences, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033, Japan and the', 'institution_ids': ['https://openalex.org/I74801974']}]}], 'institution_assertions': [], 'countries_distinct_count': 1, 'institutions_distinct_count': 2, 'corresponding_author_ids': [], 'corresponding_institution_ids': [], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 0.81, 'has_fulltext': True, 'fulltext_origin': 'ngrams', 'cited_by_count': 79, 'citation_normalized_percentile': {'value': 0.838872, 'is_in_top_1_percent': False, 'is_in_top_10_percent': False}, 'cited_by_percentile_year': {'min': 94, 'max': 95}, 'biblio': {'volume': '276', 'issue': '32', 'first_page': '29664', 'last_page': '29670'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T11346', 'display_name': 'Mast cells and histamine', 'score': 0.9991, 'subfield': {'id': 'https://openalex.org/subfields/2403', 'display_name': 'Immunology'}, 'field': {'id': 'https://openalex.org/fields/24', 'display_name': 'Immunology and Microbiology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, 'topics': [{'id': 'https://openalex.org/T11346', 'display_name': 'Mast cells and histamine', 'score': 0.9991, 'subfield': {'id': 'https://openalex.org/subfields/2403', 'display_name': 'Immunology'}, 'field': {'id': 'https://openalex.org/fields/24', 'display_name': 'Immunology and Microbiology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T11308', 'display_name': 'Sphingolipid Metabolism and Signaling', 'score': 0.9991, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T12286', 'display_name': 'Erythrocyte Function and Pathophysiology', 'score': 0.9961, 'subfield': {'id': 'https://openalex.org/subfields/2737', 'display_name': 'Physiology'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/lysophosphatidylethanolamine', 'display_name': 'Lysophosphatidylethanolamine', 'score': 0.45073855}], 'concepts': [{'id': 'https://openalex.org/C1122143', 'wikidata': 'https://www.wikidata.org/wiki/Q61233', 'display_name': 'Histamine', 'level': 2, 'score': 0.7799469}, {'id': 'https://openalex.org/C2779637612', 'wikidata': 'https://www.wikidata.org/wiki/Q2354337', 'display_name': 'Phosphatidylserine', 'level': 4, 'score': 0.714797}, {'id': 'https://openalex.org/C2779726688', 'wikidata': 'https://www.wikidata.org/wiki/Q191989', 'display_name': 'Mast cell', 'level': 2, 'score': 0.5556761}, {'id': 'https://openalex.org/C55493867', 'wikidata': 'https://www.wikidata.org/wiki/Q7094', 'display_name': 'Biochemistry', 'level': 1, 'score': 0.5309194}, {'id': 'https://openalex.org/C2776551241', 'wikidata': 'https://www.wikidata.org/wiki/Q24768001', 'display_name': 'Phospholipase A2', 'level': 3, 'score': 0.50835603}, {'id': 'https://openalex.org/C12927208', 'wikidata': 'https://www.wikidata.org/wiki/Q210430', 'display_name': 'Phospholipase', 'level': 3, 'score': 0.47355786}, {'id': 'https://openalex.org/C185592680', 'wikidata': 'https://www.wikidata.org/wiki/Q2329', 'display_name': 'Chemistry', 'level': 0, 'score': 0.46993786}, {'id': 'https://openalex.org/C2781112429', 'wikidata': 'https://www.wikidata.org/wiki/Q3269788', 'display_name': 'Lysophosphatidylethanolamine', 'level': 5, 'score': 0.45073855}, {'id': 'https://openalex.org/C2778597717', 'wikidata': 'https://www.wikidata.org/wiki/Q420248', 'display_name': 'Phospholipase C', 'level': 3, 'score': 0.43421692}, {'id': 'https://openalex.org/C61322309', 'wikidata': 'https://www.wikidata.org/wiki/Q423143', 'display_name': 'Sphingomyelin', 'level': 3, 'score': 0.4142415}, {'id': 'https://openalex.org/C181199279', 'wikidata': 'https://www.wikidata.org/wiki/Q8047', 'display_name': 'Enzyme', 'level': 2, 'score': 0.40468436}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.30567873}, {'id': 'https://openalex.org/C2778918659', 'wikidata': 'https://www.wikidata.org/wiki/Q186915', 'display_name': 'Phospholipid', 'level': 3, 'score': 0.25473416}, {'id': 'https://openalex.org/C98274493', 'wikidata': 'https://www.wikidata.org/wiki/Q128406', 'display_name': 'Pharmacology', 'level': 1, 'score': 0.1754593}, {'id': 'https://openalex.org/C2776330855', 'wikidata': 'https://www.wikidata.org/wiki/Q650187', 'display_name': 'Phosphatidylcholine', 'level': 4, 'score': 0.16476867}, {'id': 'https://openalex.org/C41625074', 'wikidata': 'https://www.wikidata.org/wiki/Q176088', 'display_name': 'Membrane', 'level': 2, 'score': 0.13929996}, {'id': 'https://openalex.org/C203014093', 'wikidata': 'https://www.wikidata.org/wiki/Q101929', 'display_name': 'Immunology', 'level': 1, 'score': 0.1246649}], 'mesh': [{'descriptor_ui': 'D006632', 'descriptor_name': 'Histamine', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D008246', 'descriptor_name': 'Lysophospholipids', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D008407', 'descriptor_name': 'Mast Cells', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D010741', 'descriptor_name': 'Phospholipases A', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D000818', 'descriptor_name': 'Animals', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D017209', 'descriptor_name': 'Apoptosis', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D001921', 'descriptor_name': 'Brain', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D001921', 'descriptor_name': 'Brain', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002384', 'descriptor_name': 'Catalysis', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002417', 'descriptor_name': 'Cattle', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002462', 'descriptor_name': 'Cell Membrane', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D002462', 'descriptor_name': 'Cell Membrane', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002851', 'descriptor_name': 'Chromatography, High Pressure Liquid', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D003208', 'descriptor_name': 'Concanavalin A', 'qualifier_ui': 'Q000494', 'qualifier_name': 'pharmacology', 'is_major_topic': False}, {'descriptor_ui': 'D003208', 'descriptor_name': 'Concanavalin A', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D003432', 'descriptor_name': 'Cross-Linking Reagents', 'qualifier_ui': 'Q000494', 'qualifier_name': 'pharmacology', 'is_major_topic': False}, {'descriptor_ui': 'D003432', 'descriptor_name': 'Cross-Linking Reagents', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D004305', 'descriptor_name': 'Dose-Response Relationship, Drug', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D005434', 'descriptor_name': 'Flow Cytometry', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D019812', 'descriptor_name': 'Heparan Sulfate Proteoglycans', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D019812', 'descriptor_name': 'Heparan Sulfate Proteoglycans', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D006493', 'descriptor_name': 'Heparin', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D006493', 'descriptor_name': 'Heparin', 'qualifier_ui': 'Q000494', 'qualifier_name': 'pharmacology', 'is_major_topic': False}, {'descriptor_ui': 'D006632', 'descriptor_name': 'Histamine', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D006632', 'descriptor_name': 'Histamine', 'qualifier_ui': 'Q000737', 'qualifier_name': 'chemistry', 'is_major_topic': False}, {'descriptor_ui': 'D006801', 'descriptor_name': 'Humans', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D006868', 'descriptor_name': 'Hydrolysis', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D019169', 'descriptor_name': 'Jurkat Cells', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008246', 'descriptor_name': 'Lysophospholipids', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008407', 'descriptor_name': 'Mast Cells', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D010741', 'descriptor_name': 'Phospholipases A', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D054466', 'descriptor_name': 'Phospholipases A1', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D051381', 'descriptor_name': 'Rats', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011994', 'descriptor_name': 'Recombinant Proteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D011994', 'descriptor_name': 'Recombinant Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D012694', 'descriptor_name': 'Serine', 'qualifier_ui': 'Q000737', 'qualifier_name': 'chemistry', 'is_major_topic': False}, {'descriptor_ui': 'D012694', 'descriptor_name': 'Serine', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}], 'locations_count': 2, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m104597200', 'pdf_url': 'http://www.jbc.org/article/S0021925820896598/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/11395520', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m104597200', 'pdf_url': 'http://www.jbc.org/article/S0021925820896598/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 32, 'referenced_works': ['https://openalex.org/W100550672', 'https://openalex.org/W1456597060', 'https://openalex.org/W1525360648', 'https://openalex.org/W1696959307', 'https://openalex.org/W1794030813', 'https://openalex.org/W1917990591', 'https://openalex.org/W1931867546', 'https://openalex.org/W1937036162', 'https://openalex.org/W1964992571', 'https://openalex.org/W1973512716', 'https://openalex.org/W1977406435', 'https://openalex.org/W1984486964', 'https://openalex.org/W1989691947', 'https://openalex.org/W1995054371', 'https://openalex.org/W1997680217', 'https://openalex.org/W1997718624', 'https://openalex.org/W1998117809', 'https://openalex.org/W2005399107', 'https://openalex.org/W2009996454', 'https://openalex.org/W2031059672', 'https://openalex.org/W2039802164', 'https://openalex.org/W2040827725', 'https://openalex.org/W2040856308', 'https://openalex.org/W2054818358', 'https://openalex.org/W2071834868', 'https://openalex.org/W2085500458', 'https://openalex.org/W2092580183', 'https://openalex.org/W2152311269', 'https://openalex.org/W2186748399', 'https://openalex.org/W229200327', 'https://openalex.org/W2300552860', 'https://openalex.org/W2409248153'], 'related_works': ['https://openalex.org/W2549041080', 'https://openalex.org/W2521341032', 'https://openalex.org/W2470996196', 'https://openalex.org/W2402243167', 'https://openalex.org/W2396622802', 'https://openalex.org/W2252971779', 'https://openalex.org/W2003579166', 'https://openalex.org/W1993816515', 'https://openalex.org/W1977320865', 'https://openalex.org/W1970544486'], 'abstract_inverted_index': {'Lysophosphatidylserine': [0, 212], '(1-acyl-2-lyso-PS)': [1, 213, 861], 'has': [2, 31, 173, 214, 243, 385, 671, 907, 927, 993, 1142, 1163, 1274, 4012, 4693, 4960, 5248, 5258, 5605, 5656, 5770, 5848, 5910, 6025], 'been': [3, 32, 215, 244, 633, 672, 909, 928, 995, 1165, 1275, 2682, 5250, 5259, 5657, 5771, 5850, 5912, 6008, 6026], 'shown': [4, 216, 3461, 3622, 3807, 3915, 3986, 4005, 4370, 4461, 4747, 5508, 6027], 'to': [5, 67, 190, 217, 279, 402, 487, 565, 635, 745, 864, 971, 987, 1098, 1138, 1177, 1345, 1825, 1926, 2030, 2037, 2067, 2089, 2095, 2214, 2398, 2548, 2599, 2747, 2827, 2886, 3029, 3226, 3255, 3284, 3336, 3372, 3433, 3453, 3778, 3786, 3844, 3882, 3931, 4021, 4040, 4141, 4144, 4475, 4525, 4566, 4771, 4818, 4869, 4930, 4967, 5252, 5364, 5369, 5584, 5614, 5664, 5741, 5773, 5813, 5852, 5935, 5956, 5962, 6028, 6038, 6068], 'stimulate': [6, 205, 218, 417, 3227, 3256, 3434, 3454, 3845, 3932, 4022, 4476, 4819, 4968, 5615, 5774, 5936], 'histamine': [7, 46, 108, 115, 141, 219, 258, 320, 327, 353, 478, 1988, 2008, 3257, 3278, 3286, 3423, 3455, 3466, 3526, 3609, 3652, 3846, 3884, 3934, 3992, 4023, 4042, 4082, 4279, 4384, 4478, 4757, 4778, 4887, 4920, 4949, 4970, 4983, 5042, 5228, 5775, 5815, 5858, 5937, 6055], 'release': [8, 47, 116, 142, 220, 259, 328, 354, 1975, 1989, 2009, 3258, 3287, 3424, 3456, 3467, 3527, 3571, 3610, 3847, 3935, 3993, 4024, 4043, 4083, 4148, 4203, 4280, 4416, 4479, 4758, 4779, 4888, 4921, 4950, 4971, 4984, 5043, 5229, 5776, 5816, 5859, 5938], 'from': [9, 48, 117, 126, 163, 221, 260, 329, 338, 375, 481, 867, 983, 1240, 1348, 1390, 1423, 1435, 1512, 1526, 1529, 1632, 2093, 2307, 2375, 2619, 2809, 2861, 2993, 3043, 3259, 3314, 3425, 3457, 3468, 3487, 3528, 3611, 3686, 3722, 3848, 3936, 3994, 4025, 4044, 4072, 4084, 4258, 4281, 4456, 4471, 4480, 4518, 4586, 4759, 4780, 4951, 4972, 4985, 5044, 5057, 5230, 5351, 5777, 5817, 5939], 'rat': [10, 222, 434, 552, 925, 1242, 1441, 1802, 2233, 2287, 2494, 2535, 2563, 2624, 2909, 4085, 4238, 5191, 5220, 5293, 5421, 5552, 5554], 'peritoneal': [11, 223, 435, 553, 1531, 1634, 1647, 1803, 2910, 4086, 4239, 5096, 5294, 5558], 'mast': [12, 130, 206, 224, 342, 418, 436, 554, 728, 1154, 1374, 1397, 1673, 1708, 3229, 3261, 3402, 3405, 3435, 3613, 3709, 3727, 3739, 3850, 3923, 3942, 4075, 4087, 4741, 5596, 5616, 5893, 5990], 'cells': [13, 127, 166, 225, 339, 378, 463, 555, 753, 774, 819, 840, 1630, 1648, 1653, 1670, 1674, 1688, 1706, 1713, 1735, 1798, 1800, 1839, 1896, 2274, 2314, 2903, 2911, 2915, 3262, 3406, 3427, 3614, 3706, 3710, 3728, 3734, 3802, 3851, 3866, 3906, 3924, 3959, 4065, 4073, 4076, 4088, 4094, 4128, 4235, 4240, 4474, 4488, 4533, 4592, 4904, 5001, 5052, 5097, 5138, 5157, 5170, 5295, 5365, 5597, 5617, 5732, 5894, 5983], '(RPMC)': [14, 226], 'triggered': [15, 227, 5860], 'by': [16, 210, 228, 422, 472, 560, 869, 1106, 1157, 1495, 1623, 1781, 1842, 1952, 2171, 2315, 2725, 2823, 2953, 3022, 3102, 3489, 3692, 4244, 4365, 4454, 4545, 4617, 4744, 4996, 5024, 5077, 5088, 5292, 5345, 5371, 5523, 5649, 5668, 5819, 5861], 'FcεRI': [17, 58, 229, 270, 2033, 3668, 4876, 4909, 5840, 5870], '(high': [18, 230], 'affinity': [19, 174, 231, 386, 439, 567, 4695, 4735, 5607, 5636], 'receptor': [20, 232, 440, 677], 'for': [21, 175, 233, 387, 441, 569, 678, 1753, 1830, 1882, 1940, 1987, 1997, 2149, 2297, 2394, 2429, 2570, 2711, 2816, 2940, 3008, 3161, 3215, 3219, 3412, 3543, 3667, 4106, 4183, 4198, 4276, 4381, 4393, 4696, 4736, 4740, 4804, 5175, 5329, 5608, 5637, 5679, 5995, 6052, 6061, 6076, 6089], 'IgE)': [22, 234], 'cross-linking,': [23, 235], 'although': [24, 236, 1109, 1160, 1350, 2071, 4913, 5900, 6032], 'the': [25, 35, 55, 137, 140, 164, 179, 183, 237, 247, 267, 349, 352, 376, 391, 395, 548, 683, 893, 901, 920, 984, 1100, 1122, 1143, 1278, 1364, 1373, 1409, 1530, 1613, 1616, 1629, 1633, 1645, 1694, 1734, 1744, 1760, 1782, 1789, 1826, 1836, 1895, 1907, 1928, 1931, 1948, 1953, 1982, 1993, 2011, 2032, 2039, 2064, 2076, 2138, 2166, 2172, 2308, 2312, 2399, 2414, 2430, 2433, 2473, 2584, 2600, 2672, 2679, 2703, 2757, 2773, 2781, 2831, 2887, 2917, 2931, 2948, 2954, 2994, 3030, 3044, 3109, 3138, 3166, 3175, 3185, 3203, 3246, 3289, 3323, 3345, 3352, 3361, 3365, 3373, 3416, 3426, 3472, 3484, 3496, 3499, 3531, 3558, 3577, 3584, 3603, 3616, 3627, 3642, 3649, 3689, 3697, 3732, 3738, 3764, 3774, 3779, 3782, 3797, 3831, 3840, 3849, 3887, 3921, 3927, 3997, 4061, 4090, 4114, 4124, 4142, 4154, 4161, 4191, 4209, 4216, 4230, 4308, 4347, 4372, 4422, 4429, 4457, 4465, 4468, 4472, 4486, 4497, 4512, 4528, 4532, 4539, 4551, 4583, 4609, 4621, 4633, 4643, 4650, 4656, 4669, 4678, 4756, 4767, 4794, 4805, 4809, 4814, 4860, 4873, 4906, 4936, 4954, 4962, 5012, 5025, 5031, 5074, 5093, 5124, 5129, 5142, 5218, 5262, 5266, 5298, 5330, 5402, 5411, 5543, 5548, 5557, 5574, 5585, 5593, 5619, 5642, 5665, 5675, 5708, 5713, 5742, 5781, 5784, 5823, 5837, 5867, 5888, 5904, 5946, 5963, 5978, 6021, 6040, 6054, 6077, 6090], 'precise': [26, 238], 'mechanism': [27, 239], 'of': [28, 52, 57, 62, 69, 100, 182, 201, 240, 264, 269, 274, 281, 312, 394, 413, 551, 562, 617, 630, 686, 727, 739, 751, 771, 896, 923, 1116, 1121, 1132, 1271, 1366, 1387, 1411, 1533, 1612, 1658, 1668, 1681, 1728, 1746, 1768, 1784, 1816, 1862, 1909, 1919, 1956, 1981, 2004, 2013, 2042, 2085, 2140, 2143, 2154, 2174, 2291, 2311, 2370, 2378, 2385, 2392, 2404, 2408, 2413, 2432, 2493, 2534, 2562, 2583, 2593, 2622, 2651, 2657, 2671, 2919, 2935, 2956, 3018, 3027, 3036, 3092, 3104, 3116, 3149, 3156, 3198, 3210, 3224, 3248, 3291, 3302, 3330, 3338, 3354, 3368, 3379, 3420, 3474, 3498, 3522, 3533, 3549, 3554, 3568, 3576, 3588, 3605, 3618, 3644, 3651, 3665, 3767, 3776, 3812, 3842, 3876, 3889, 3894, 3929, 3947, 3957, 3999, 4036, 4063, 4092, 4118, 4126, 4153, 4165, 4193, 4208, 4220, 4227, 4232, 4278, 4298, 4351, 4357, 4377, 4383, 4421, 4433, 4467, 4500, 4514, 4527, 4531, 4560, 4588, 4608, 4620, 4635, 4681, 4752, 4769, 4808, 4816, 4827, 4833, 4863, 4875, 4908, 4938, 4942, 4956, 5095, 5126, 5265, 5300, 5332, 5413, 5427, 5511, 5545, 5550, 5560, 5576, 5621, 5645, 5783, 5807, 5825, 5832, 5839, 5846, 5855, 5869, 5906, 5949, 5966, 5981, 5989, 6042, 6080, 6093], 'lyso-PS': [29, 122, 156, 241, 334, 368, 618, 679, 860, 897, 905, 991, 1179, 1389, 1910, 2069, 2168, 2987, 3281, 3332, 3683, 3719, 4068, 4449, 4501, 4515, 4567, 4670, 4835, 4989, 5022, 5065, 5087, 5121, 5184, 5334, 5362, 5397, 5408, 5728], 'production': [30, 51, 242, 263, 906, 1283, 1410, 2592, 3378, 4955, 5023, 5122, 5331, 5409], 'obscure.': [33, 245], 'In': [34, 132, 185, 246, 344, 397, 789, 1339, 1361, 1759, 2019, 2804, 3163, 4547, 5010, 5063, 5144, 5179, 5337, 5354, 5500, 5930, 6012], 'present': [36, 248, 4926, 5013, 5254, 5944], 'study': [37, 249, 2050, 2102, 4927, 4944, 5581], 'we': [38, 250, 1110, 1642, 1763, 3601, 3695, 3700, 3745, 3871, 5181, 5340, 5358, 5717, 5901], 'show': [39, 90, 251, 302, 3675, 4254, 4291, 5083, 5541], 'that': [40, 68, 97, 121, 252, 280, 309, 333, 674, 992, 1103, 1140, 1149, 1172, 1382, 1403, 1644, 2425, 3269, 3337, 3344, 3360, 3483, 3682, 3702, 3718, 3735, 3793, 3860, 3987, 4006, 4033, 4051, 4067, 4508, 4668, 4788, 4826, 4946, 5084, 5116, 5136, 5165, 5217, 5325, 5342, 5361, 5420, 5462, 5509, 5542, 5592, 5602, 5660, 5674, 5719, 5780, 5958, 6019, 6024], 'phosphatidylserine-specific': [41, 253, 426], 'phospholipase': [42, 254, 427, 432, 870, 1170, 1368, 2121], 'A1,': [43, 255], 'PS-PLA1,': [44, 74, 176, 256, 286, 388, 968, 1232, 2470, 3421, 4828, 4912, 4976, 4980, 5346, 5603, 5745], 'stimulates': [45, 257, 3465, 3990, 4948, 5595], 'RPMC': [49, 146, 261, 358, 687, 1528, 1578, 1614, 1696, 1770, 1853, 2040, 3235, 3469, 3529, 3537, 3690, 3753, 3833, 3874, 3878, 3900, 3937, 3995, 4026, 4100, 4177, 4387, 4481, 4491, 4598, 4781, 4820, 4871, 4898, 4952, 5004, 5046, 5059, 5778, 5818], 'through': [50, 262, 2318, 4953], '2-acyl-1-lyso-PS': [53, 63, 265, 275, 1141, 2199, 3225, 3397, 3485, 4966], 'in': [54, 75, 266, 287, 468, 485, 808, 813, 904, 919, 1153, 1237, 1277, 1372, 1396, 1408, 1581, 1615, 1693, 1716, 1725, 1743, 1813, 1835, 1870, 1891, 1906, 1947, 2010, 2048, 2063, 2100, 2129, 2137, 2205, 2279, 2471, 2542, 2702, 2736, 2866, 2916, 2930, 2947, 3003, 3097, 3137, 3184, 3245, 3288, 3377, 3415, 3462, 3471, 3477, 3530, 3557, 3615, 3623, 3641, 3750, 3763, 3770, 3800, 3808, 3816, 3824, 3886, 3898, 3916, 3981, 3996, 4077, 4089, 4113, 4123, 4190, 4360, 4371, 4462, 4538, 4582, 4632, 4649, 4655, 4685, 4748, 4774, 4836, 4848, 4872, 4885, 4905, 4935, 5040, 5073, 5150, 5177, 5189, 5246, 5255, 5261, 5335, 5401, 5415, 5466, 5504, 5516, 5520, 5547, 5579, 5598, 5618, 5726, 5765, 5836, 5866, 5895, 6045], 'presence': [56, 268, 1745, 1908, 2139, 2918, 2932, 3247, 3417, 3473, 3532, 3559, 3643, 3888, 3998, 4091, 4115, 4125, 4192, 4874, 4907, 5620, 5838], 'cross-linker.': [59, 271], 'The': [60, 272, 615, 1379, 1440, 1610, 1679, 1838, 1852, 2198, 2303, 2382, 2552, 2574, 2605, 2648, 2706, 2731, 2836, 2997, 3016, 3119, 3132, 3222, 3265, 3328, 3940, 4195, 4294, 4355, 4606, 4627, 4925, 5392, 5844, 5992], 'potency': [61, 273], 'was': [64, 82, 104, 161, 276, 294, 316, 373, 916, 1234, 1377, 1433, 1510, 1619, 1689, 1779, 1823, 1924, 1934, 1950, 1976, 2015, 2035, 2109, 2169, 2200, 2235, 2373, 2389, 2483, 2578, 2596, 2617, 2654, 2666, 2692, 2709, 2723, 2734, 2761, 2814, 3020, 3038, 3123, 3135, 3159, 3169, 3178, 3200, 3213, 3232, 3253, 3271, 3282, 3299, 3333, 3428, 3451, 3658, 3662, 3896, 3903, 3985, 4003, 4242, 4303, 4363, 4379, 4482, 4516, 4615, 4879, 4894, 4928, 4994, 5038, 5070, 5347, 5398, 5811, 5827, 5933], 'almost': [65, 277, 3334, 4647, 4961, 5348], 'equal': [66, 278], '1-acyl-2-lyso-PS.': [70, 282], 'A': [71, 283, 444, 1171, 2023, 3655, 4891], 'catalytically': [72, 284, 4008], 'inactive': [73, 285, 2468, 4009], 'which': [76, 172, 288, 384, 557, 915, 2027, 2472, 3630, 3751, 4132, 4564, 5193, 5604], 'an': [77, 85, 289, 297, 465, 627, 1129, 1175, 1726, 2060, 2480, 2892, 3062, 3677, 4694, 4789, 5606, 5635], 'active': [78, 290, 577, 2474, 3400, 3492], 'serine': [79, 291, 2475], 'residue': [80, 87, 292, 299, 2476], '(Ser166)': [81, 293], 'replaced': [83, 295, 2478], 'with': [84, 134, 149, 157, 168, 296, 346, 361, 369, 380, 1542, 1664, 1738, 1807, 1876, 1899, 2111, 2158, 2285, 2410, 2479, 2694, 2753, 2765, 2772, 2840, 2854, 2880, 2891, 2925, 3050, 3061, 3237, 3243, 3318, 3409, 3546, 3633, 3639, 3756, 3836, 3909, 3953, 4109, 4135, 4186, 4396, 4494, 4550, 4557, 4568, 4604, 4825, 4901, 4990, 5007, 5048, 5066, 5185, 5564, 5651, 5710], 'alanine': [86, 298], 'did': [88, 300, 3673, 4289, 4764], 'not': [89, 301, 908, 994, 1112, 1126, 1164, 2079, 2104, 3341, 3350, 3674, 3724, 4290, 4535, 4625, 4630, 4654, 4765, 4783, 4853, 4978, 5107, 5399, 6007], 'such': [91, 303, 476, 796, 1356, 1671, 2417, 2985, 3676, 3960, 4734, 4843, 5169, 5333, 5627, 5982, 5998], 'activity.': [92, 304, 3678, 4293], 'sPLA2-IIA,': [93, 305, 1371], 'another': [94, 306, 990, 5907], 'secretory': [95, 307, 431, 483, 549, 965, 1169, 5908], 'PLA2': [96, 308], 'is': [98, 123, 310, 335, 558, 573, 619, 742, 862, 898, 1104, 1118, 1136, 1151, 1180, 1265, 1343, 1384, 1394, 2028, 2059, 2427, 2477, 3357, 3398, 3431, 3491, 3572, 3684, 3716, 3720, 3760, 3790, 3814, 3822, 4019, 4038, 4069, 4149, 4200, 4204, 4274, 4369, 4417, 4451, 4506, 4672, 4738, 4802, 4831, 5027, 5123, 5133, 5148, 5290, 5323, 5327, 5366, 5410, 5464, 5582, 5590, 5662, 5677, 5721, 5754, 5760, 5786, 5942, 5954, 5960], 'capable': [99, 311, 1386, 4832], 'producing': [101, 313, 1158, 1388, 4834, 5727, 5766, 5984], 'lyso-PSin': [102, 314], 'vitro,': [103, 315, 1340, 4849], 'also': [105, 317, 743, 1352, 3312, 3730, 4004, 5114, 5215, 5249, 5658, 5707, 5849, 6066], 'a': [106, 318, 675, 735, 805, 972, 1119, 1405, 1665, 1859, 1979, 2091, 2280, 2319, 2324, 2328, 2543, 2550, 2571, 2717, 3009, 3024, 3051, 3105, 3113, 3147, 3153, 3207, 3439, 3478, 3883, 3954, 4007, 4255, 5117, 5173, 5424, 5755, 5805, 5830, 5896, 5986], 'poor': [107, 319], 'inducer': [109, 321], 'against': [110, 322, 3401, 3493, 5892], 'RPMC.': [111, 323, 3459, 3978, 4045, 4282, 4761, 4939, 5231, 5940], 'PS-PLA1': [112, 187, 324, 399, 1124, 1150, 1383, 2234, 2288, 2372, 2388, 2396, 2409, 2495, 2536, 2660, 2698, 2856, 2937, 3476, 3490, 3523, 3607, 3646, 3777, 3843, 3930, 3988, 4011, 4037, 4052, 4119, 4199, 4288, 4302, 4358, 4378, 4402, 4409, 4455, 4692, 4770, 4792, 4878, 4933, 4947, 5037, 5085, 5176, 5196, 5326, 5414, 5428, 5463, 5512, 5546, 5577, 5725, 5764, 5826, 5932, 5974], 'significantly': [113, 325, 3853, 4918], 'stimulated': [114, 139, 326, 351, 1898, 4081, 4919, 4981, 5222], 'crude': [118, 330, 1646, 1695, 3698, 3873, 3899, 3922, 3941, 4174, 4490, 4597, 4760, 4870, 5003, 5058], 'RPMC,': [119, 331, 3494, 3629, 3699], 'indicating': [120, 332, 3343], 'mainly': [124, 336, 1657, 3762, 3946], 'derived': [125, 337, 4071], 'other': [128, 340, 623, 793, 1354, 1522, 1669, 1687, 1705, 2411, 3707, 3733, 3958, 4690, 5103, 5749], 'than': [129, 341, 582, 3708, 3977, 4883, 5724, 5751, 5763], 'cells.': [131, 152, 343, 364, 1709, 1776, 2006, 3740, 3758, 3772, 3805, 3829, 4001, 4097, 4522, 5973, 5991, 6097], 'agreement': [133, 345, 4549], 'this': [135, 347, 580, 1107, 1341, 1362, 2049, 2101, 2805, 3743, 3982, 4943, 5338, 5580, 6013, 6043], 'phenomenon,': [136, 348], 'enzyme': [138, 350, 902, 1264, 1342, 2434, 4014, 4865, 5026, 5032, 5594, 5785, 6023, 6044], 'more': [143, 355, 576, 3975, 4881], 'efficiently': [144, 194, 356, 406, 3989, 4056, 4839], 'when': [145, 357, 3297, 3626, 3660, 3920, 4057, 4485, 4896], 'were': [147, 359, 1421, 1492, 1524, 1540, 1579, 1714, 1736, 1805, 1840, 1854, 1897, 2283, 2305, 2538, 2565, 2608, 2700, 2770, 2778, 2802, 2821, 2838, 2889, 2923, 2951, 2991, 3000, 3048, 3100, 3241, 3295, 3311, 3407, 3541, 3631, 3637, 3754, 3834, 3907, 3925, 3971, 4104, 4133, 4181, 4391, 4492, 4542, 4580, 4629, 4645, 4866, 4899, 5005], 'mixed': [148, 360, 1764, 2764, 3755, 3835], 'apoptotic': [150, 165, 202, 362, 377, 414, 3757, 3801, 3825, 3837, 3865, 4064, 4093, 4233, 4473, 4487, 4589, 4902, 5000, 5049, 5099, 5137, 5967], 'Jurkat': [151, 363, 818, 1711, 1775, 2901, 3818, 3828, 3838, 4127, 4234, 4590, 4903, 5050, 6095], 'Under': [153, 365, 2980, 3032], 'these': [154, 366, 2981, 3033, 3331, 4047], 'conditions,': [155, 367, 2982, 3034], 'unsaturated': [158, 370, 4686, 4991, 5067, 5186], 'fatty': [159, 371, 981, 2053, 2156, 2216, 3346, 4687, 4992, 5068, 5187], 'acid': [160, 372, 982, 2217, 2406, 2990, 3347, 4570, 4575], 'released': [162, 374, 3653], 'treated': [167, 379, 2879, 3908, 4493], 'PS-PLA1.': [169, 381, 1913, 3569, 3693, 3892, 4194, 4495, 4605, 4745, 5009, 5711], 'Finally,': [170, 382], 'heparin,': [171, 383, 5609], 'completely': [177, 389, 4754, 5610], 'blocked': [178, 390, 2839, 4755], 'stimulatory': [180, 392], 'effect': [181, 393, 3521, 3604, 5824, 5845], 'enzyme.': [184, 396, 1123, 4810, 5743], 'conclusion,': [186, 398], 'may': [188, 400, 1173, 5171, 5394, 5705], 'bind': [189, 401], 'heparan': [191, 403, 4799, 5652], 'sulfate': [192, 404, 4800, 5653], 'proteoglycan,': [193, 405], 'hydrolyze': [195, 407, 1127, 4054, 4772, 4854], 'PS': [196, 408, 583, 868, 1096, 1417, 1420, 1777, 3410, 3430, 3449, 3464, 3488, 3534, 3555, 3619, 3687, 3723, 3759, 3794, 3813, 3862, 3895, 4055, 4228, 4295, 4530, 4773, 4847, 5090, 5127, 5140, 5146, 5166, 5370, 5941, 5959, 5976], 'appearing': [197, 409], 'on': [198, 410, 682, 978, 1833, 2001, 2714, 3524, 3608, 3688, 3726, 3731, 3781, 3796, 3864, 4060, 4229, 4856, 5034, 5092, 5109, 5128, 5141, 5168, 5641, 5748, 5945, 5977], 'plasma': [199, 411, 684, 3783], 'membranes': [200, 412, 1392], 'cells,': [203, 415, 3403, 3819, 3839, 5100, 5968, 5970], 'and': [204, 416, 479, 768, 802, 837, 930, 975, 1148, 1273, 1281, 1359, 1393, 1418, 1429, 1474, 1603, 1662, 1675, 1686, 1771, 1811, 1828, 1874, 1930, 2097, 2176, 2194, 2209, 2295, 2327, 2402, 2421, 2529, 2556, 2591, 2610, 2745, 2763, 2775, 2800, 2825, 2848, 2873, 2877, 2958, 2988, 3006, 3012, 3140, 3152, 3174, 3187, 3206, 3309, 3325, 3422, 3551, 3581, 3867, 3879, 3891, 3951, 3968, 4018, 4066, 4158, 4213, 4237, 4368, 4400, 4426, 4562, 4573, 4596, 4640, 4653, 4662, 4793, 4822, 4846, 4850, 4911, 4987, 5029, 5153, 5242, 5289, 5461, 5519, 5533, 5556, 5569, 5588, 5631, 5639, 5673, 5952, 5971, 6004, 6057, 6083, 6085], 'cell': [207, 419, 729, 815, 1155, 1375, 1398, 1860, 1984, 2707, 2784, 2790, 2949, 3045, 3230, 3436, 3579, 3798, 3943, 4156, 4211, 4424, 4458, 4469, 4540, 4651, 4657, 4742, 4795, 5035, 5075, 5111, 5130, 5352, 5403, 5643, 5666], 'activation': [208, 420, 1156, 1376, 3231, 3437, 4743, 4821, 4937], 'mediated': [209, 421], '2-acyl-1-lyso-PS.': [211, 423, 2197], 'phosphatidylserine': [424, 490], 'lysophosphatidylserine': [425, 512], 'A1': [428], 'group': [429, 1181], 'IIA': [430, 1182], 'A2': [433, 871, 2122], 'cell(s)': [437], 'high': [438, 566, 2072, 4915, 5787], 'IgE': [442, 570, 1445, 1880, 3240, 6082], 'concanavalin': [443, 2022], 'sodium': [445, 2737], 'dodecylsulfate': [446], 'polyacrylamide': [447], 'gel': [448, 2740], 'electrophoresis': [449, 2741], 'dinitrophenylated': [450], 'Ascaris': [451], 'fluorescein': [452], 'isothiocyanate': [453], 'polymerase': [454, 2544], 'chain': [455, 2545, 3363, 3501], 'reaction': [456, 873, 1932, 2546], 'mass': [457, 3013, 3054, 3133, 5078], 'spectrometry': [458, 3014], 'electrospray': [459, 3063], 'ion': [460, 2321, 3064, 3142, 3189], 'source': [461, 3065, 5426], 'Mast': [462], 'play': [464], 'important': [466, 2428, 4739, 4803], 'role': [467, 895, 1365, 1407, 6041], 'immediate-type': [469], 'allergic': [470], 'reactions': [471], 'releasing': [473], 'chemical': [474], 'mediators': [475, 795, 5997], 'as': [477, 797, 900, 1146, 1357, 1549, 1621, 1636, 1672, 1703, 1707, 1978, 1992, 2196, 2237, 2332, 2418, 2485, 2540, 2568, 2612, 2626, 2986, 3067, 3202, 3272, 3274, 3574, 3961, 4151, 4206, 4248, 4307, 4310, 4419, 4613, 4844, 4965, 5628, 5999], 'serotonin': [480], 'their': [482], 'granules': [484], 'response': [486, 550, 581], 'antigens.': [488], 'Exogenous': [489], '(PS)1': [491], '(1Martin': [492], 'T.W.': [493, 516, 585, 639], 'Lagunoff': [494, 517, 586, 640], 'D.': [495, 518, 587, 641], 'Proc.': [496], 'Natl.': [497], 'Acad.': [498], 'Sci.': [499, 5918], 'U.': [500], 'S.': [501, 695, 714, 755, 1031, 1212, 1251, 1289, 1306, 1456, 1477, 1481, 2636, 5380], 'A.': [502, 778, 881, 1454, 1963, 2220, 3382, 3506, 5236, 5238, 5310], '1978;': [503, 1484], '75:': [504], '4997-5000Crossref': [505], 'PubMed': [506, 523, 541, 592, 610, 646, 664, 702, 721, 763, 784, 832, 854, 888, 959, 1025, 1044, 1061, 1091, 1201, 1228, 1258, 1315, 1336, 1469, 1487, 1572, 2189, 2227, 2267, 2362, 2462, 2524, 2643, 2971, 3084, 3389, 3513, 4340, 4725, 5209, 5286, 5317, 5387, 5456, 5495, 5699, 5925], 'Scopus': [507, 524, 542, 593, 611, 647, 665, 703, 722, 764, 785, 833, 855, 889, 960, 1026, 1045, 1062, 1092, 1202, 1259, 1316, 1470, 1488, 1573, 2190, 2228, 2268, 2363, 2463, 2525, 2644, 2972, 3085, 3390, 3514, 4341, 4726, 5210, 5318, 5388, 5457, 5496, 5700, 5926], '(14)': [508, 1046], 'Google': [509, 526, 544, 595, 613, 649, 667, 705, 724, 766, 787, 835, 857, 891, 962, 1028, 1047, 1064, 1094, 1204, 1229, 1261, 1299, 1318, 1337, 1472, 1490, 1575, 2192, 2230, 2270, 2365, 2465, 2527, 2646, 2974, 3087, 3392, 3516, 4343, 4728, 5212, 5287, 5320, 5390, 5459, 5498, 5702, 5802, 5885, 5928], 'Scholar)': [510, 545, 767, 836, 1473, 1491, 2193, 2975, 5288, 5460], 'or': [511, 1801, 1911, 2120, 2908, 2933, 3418, 3564, 3803, 4095, 4116, 4122, 4173, 4405, 4489, 4511, 5002, 5056, 5098, 5155, 5224, 5296, 5647], '(lyso-PS;': [513], '1-acyl-2-lyso-PS)': [514], '(2Martin': [515, 584, 638], 'Nature.': [519, 588, 642], '1979;': [520, 538, 589, 607, 643, 661], '279:': [521, 590, 644], '250-252Crossref': [522, 591, 645], '(103)': [525, 594, 648], 'Scholar,': [527, 596, 650, 706, 1029, 1048, 1065, 1300, 1319], '3Smith': [528, 597, 651], 'G.A.': [529, 598, 652], 'Hesketh': [530, 599, 653], 'T.R.': [531, 600, 654], 'Plumb': [532, 601, 655], 'R.W.': [533, 602, 656], 'Metcalfe': [534, 603, 657], 'J.C.': [535, 604, 658], 'FEBS': [536, 605, 659, 779], 'Lett.': [537, 606, 660, 759, 780], '105:': [539, 608, 662], '58-62Crossref': [540, 609, 663], '(54)': [543, 612, 666], 'strongly': [546, 4049], 'enhances': [547], '(RPMC),': [556], 'initiated': [559], 'binding': [561, 1783, 1817, 4247], 'antigen-IgE': [563], 'complexes': [564, 3304], 'receptors': [568], '(FcεRI).': [571], 'Lyso-PS': [572, 741], '∼1,000': [574], 'times': [575, 1702, 3974], 'at': [578, 734, 1268, 1756, 1858, 1885, 1903, 1936, 1943, 2146, 2202, 2300, 2727, 2943, 2976, 3112, 3146, 3171, 3180, 3276, 3322, 3364, 3438, 3446, 4259, 4677, 4914, 5297, 5829], 'inducing': [579, 4886], 'Scholar).': [614, 668, 725, 788, 858, 963, 1095, 1230, 1262, 1338, 1576, 1973, 2231, 2271, 2366, 2466, 2647, 3088, 3393, 4344, 4729, 5213, 5321, 5391, 5499, 5703, 5803, 5886, 5929], 'action': [616], 'highly': [620], 'specific;': [621], 'all': [622], 'lysophospholipids': [624, 2984], '(including': [625], 'lysophosphatidyl-d-serine,': [626], 'optical': [628, 1130], 'isomer': [629, 1131], 'lysophosphatidyl-l-serine)': [631], 'have': [632, 1174, 5359, 5507, 5634, 6006], 'reported': [634, 744, 5251, 5772, 5851], 'be': [636, 732, 865, 1099, 2090, 3787, 4666, 5163, 5172, 5253, 5514, 5706, 5853, 5864, 6017], 'ineffective': [637], 'Thus,': [669, 3714, 3773, 5887], 'it': [670, 1135, 1351, 3715, 3821, 3984, 4058, 4505, 4824, 4851, 5105, 5161, 5257, 5589, 6015], 'suggested': [673], 'specific': [676, 2383, 2649], 'should': [680], 'exist': [681], 'membrane': [685, 1117, 3691, 3784, 4797, 5980], '(4Horigome': [688], 'K.': [689, 693, 710, 712, 941, 947, 1007, 1013, 1037, 1050, 1054, 1073, 1079, 1194, 1245, 1249, 1293, 1308, 1327, 1448, 1462, 1555, 1557, 1565, 2249, 2255, 2344, 2350, 2444, 2450, 2506, 2512, 2630, 2634, 4322, 4328, 4707, 4713, 5198, 5202, 5269, 5376, 5378, 5438, 5444, 5477, 5483, 5534, 5796, 5879], 'Tamori-Natori': [690], 'Y.': [691, 708, 821, 842, 937, 1003, 1067, 1075, 1323, 2245, 2340, 2440, 2502, 3075, 4318, 4703, 5240, 5374, 5434, 5471, 5479, 5685], 'Inoue': [692, 711, 946, 1012, 1036, 1053, 1078, 1193, 1248, 1292, 1307, 1326, 1461, 1564, 2254, 2349, 2449, 2511, 2633, 4327, 4712, 5201, 5377, 5443, 5482, 5795, 5878], 'Nojima': [694, 713, 1250, 2635, 5379], 'J.': [696, 715, 826, 850, 935, 948, 1001, 1014, 1038, 1055, 1069, 1080, 1195, 1216, 1219, 1252, 1561, 1567, 1966, 2183, 2243, 2256, 2338, 2351, 2438, 2451, 2500, 2513, 2637, 2965, 3073, 3078, 4316, 4329, 4701, 4714, 5203, 5234, 5281, 5381, 5432, 5445, 5473, 5484, 5529, 5688, 5797, 5880], 'Biochem.': [697, 716, 849, 1039, 1056, 1196, 1253, 2184, 2638, 2966, 5204, 5382, 5917], '(Tokyo).': [698, 717, 1040, 1057, 1197, 1254, 2639, 5205, 5383], '1986;': [699, 718, 5384], '100:': [700, 719, 5385], '571-579Crossref': [701], '(32)': [704], '5Tamori-Natori': [707], 'Horigome': [709, 5375], '581-590Crossref': [720, 5386], '(15)': [723, 5389], 'Enhancement': [726], 'degranulation': [730], 'can': [731, 4053, 4665, 5162, 5513, 5863, 6016], 'observed': [733, 5216, 5828, 5865], 'submicromolar': [736], '(<10−7m)': [737], 'concentration': [738, 2073, 2084, 3440, 5782, 5806, 5831], 'lyso-PS.': [740, 1414, 3249, 3355, 3869, 5767], 'potentiate': [746], 'nerve': [747, 5225], 'growth': [748, 5226], 'factor-induced': [749, 5227], 'differentiation': [750], 'PC12': [752], '(6Lourenssen': [754], 'Blennerhassett': [756], 'M.G.': [757], 'Neurosci.': [758], '1998;': [760, 5283], '248:': [761], '77-80Crossref': [762], '(43)': [765], 'regulate': [769], 'proliferation': [770], 'human': [772, 2900, 5468, 6094], 'T': [773, 1712, 2902, 4591, 5051, 6096], '(7Bellini': [775], 'F.': [776], 'Bruni': [777, 880, 5309], '1993;': [781, 1312, 5799, 5882], '316:': [782], '1-4Crossref': [783], '(64)': [786], 'addition,': [790, 5011, 5064, 5145, 5501], 'lyso-PS,': [791, 5343, 5856], 'like': [792, 5102], 'lysophospholipid': [794], 'lysophosphatidic': [798, 2989, 6000], 'acid,': [799, 6001], 'sphingosine': [800], '1-phosphate,': [801], 'sphingosylphosphorylcholine,': [803], 'induces': [804], 'transient': [806], 'increase': [807], 'cytosolic': [809], 'free': [810, 2155], 'calcium': [811], '([Ca2+]i)': [812], 'several': [814, 1998, 3503, 5521], 'lines': [816, 2791], 'including': [817], '(8Xu': [820], 'Casey': [822, 845], 'G.': [823, 846, 879, 1325, 5277, 5308], 'Mills': [824, 847], 'G.B.': [825, 848], 'Cell.': [827], 'Physiol.': [828, 2185, 2967, 5282], '1995;': [829, 851, 1058, 5206], '163:': [830], '441-450Crossref': [831], '(78)': [834], 'ovarian': [838], 'cancer': [839], '(9Xu': [841], 'Fang': [843], 'X.J.': [844], '309:': [852], '933-940Crossref': [853], '(252)': [856], 'Although': [859], 'thought': [863], 'produced': [866, 2484, 2779, 3486, 3685, 3721, 4453, 5291, 5344], '(PLA2)': [872], '(10Mietto': [874, 5303], 'L.': [875, 5304], 'Boarato': [876, 5305], 'E.': [877, 5306], 'Toffano': [878, 5307], 'Biochim.': [882, 1309, 5311], 'Biophys.': [883, 1310, 5312], 'Acta.': [884, 1311, 5313], '1987;': [885, 1255, 2640, 5314], '930:': [886, 5315], '145-153Crossref': [887, 5316], '(19)': [890, 5319], 'Scholar),': [892], 'physiological': [894, 5586], 'unclear': [899], 'involved': [903, 1152, 1395], 'fully': [910, 996, 6009], 'elucidated.': [911], 'Recently,': [912], 'PS-specific': [913], 'PLA1,': [914], 'first': [917, 1235, 3746, 6022], 'discovered': [918], 'culture': [921, 1238, 2309, 2380, 2620, 3046], 'medium': [922, 1719, 1742, 2621, 2929], 'activated': [924, 1241, 2623, 5151, 5190, 5219, 5551], 'platelets,': [926, 5192, 5553], 'purified': [929, 1541, 1769, 2306, 2386, 2611, 2618, 2652, 3628, 3752, 3832, 3877, 4099, 4170, 4897, 5045], 'cloned': [931], '(11Sato': [932, 998, 2240, 2335, 2435, 2497, 4313, 4698, 5429], 'T.': [933, 943, 999, 1009, 1033, 1071, 1458, 1553, 2241, 2251, 2336, 2346, 2436, 2446, 2498, 2508, 4314, 4324, 4699, 4709, 5430, 5440, 5475], 'Aoki': [934, 1000, 1068, 1560, 2242, 2337, 2437, 2499, 4315, 4700, 5431, 5472], 'Nagai': [936, 1002, 2244, 2339, 2439, 2501, 4317, 4702, 5433], 'Dohmae': [938, 1004, 2246, 2341, 2441, 2503, 4319, 4704, 5435], 'N.': [939, 1005, 1192, 1452, 2247, 2342, 2442, 2504, 4320, 4705, 5436, 5792, 5875], 'Takio': [940, 1006, 2248, 2343, 2443, 2505, 4321, 4706, 5437], 'Doi': [942, 1008, 2250, 2345, 2445, 2507, 4323, 4708, 5439], 'Arai': [944, 1010, 1076, 2252, 2347, 2447, 2509, 4325, 4710, 5441, 5480], 'H.': [945, 1011, 1077, 1190, 1450, 1479, 2253, 2348, 2448, 2510, 4326, 4711, 5243, 5442, 5481, 5531], 'Biol.': [949, 1015, 1081, 1220, 1463, 2257, 2352, 2452, 2514, 4330, 4715, 5446, 5485, 5689], 'Chem.': [950, 1016, 1082, 1221, 2258, 2353, 2453, 2515, 4331, 4716, 5447, 5486, 5690], '1997;': [951, 1017, 1333, 2259, 2354, 2454, 2516, 4332, 4717, 5448, 5919], '272:': [952, 1018, 2260, 2355, 2455, 2517, 4333, 4718, 5449], '2192-2198Abstract': [953, 1019, 2261, 2356, 2456, 2518, 4334, 4719, 5450], 'Full': [954, 956, 1020, 1022, 1086, 1088, 1225, 2262, 2264, 2357, 2359, 2457, 2459, 2519, 2521, 4335, 4337, 4720, 4722, 5451, 5453, 5490, 5492, 5694, 5696, 5922], 'Text': [955, 957, 1021, 1023, 1087, 1089, 1226, 2263, 2265, 2358, 2360, 2458, 2460, 2520, 2522, 4336, 4338, 4721, 4723, 5452, 5454, 5491, 5493, 5695, 5697, 5923], 'PDF': [958, 1024, 1090, 1227, 2266, 2361, 2461, 2523, 4339, 4724, 5455, 5494, 5698, 5924], '(120)': [961, 1027, 2269, 2364, 2464, 2526, 4342, 4727, 5458], 'This': [964, 1263, 3481, 3679, 4030, 4523, 4785, 5704, 5753], 'enzyme,': [966, 1108], 'called': [967], 'belongs': [969, 2397], 'structurally': [970], 'lipase': [973, 1432, 2114, 2400, 2415, 2420, 5630], 'family': [974], 'acts': [976, 5033, 5747], 'specifically': [977], 'PS,': [979, 1349, 3317], 'hydrolyzing': [980, 4296, 5089], 'sn-1': [985, 3324, 3374], 'position': [986, 3367, 4680], 'produce': [988, 1178, 1346, 6029], '2-acyl-1-lyso-PS,': [989, 1159, 4673, 5985], 'characterized': [997, 1166], '12Higashi': [1030], 'Kobayashi': [1032, 1457], 'Kudo': [1034, 1051, 1187, 1328, 1459, 5199, 5686, 5793, 5876], 'I.': [1035, 1052, 1188, 1285, 1302, 1329, 1460, 5200, 5687, 5794, 5877], '1988;': [1041], '103:': [1042], '442-447Crossref': [1043], '13Yokoyama': [1049], '117:': [1059, 5207], '1280-1287Crossref': [1060, 5208], '(31)': [1063, 5211], '14Nagai': [1066], 'Sato': [1070, 5474], 'Amano': [1072, 5476], 'Matsuda': [1074, 1556, 5478], '1999;': [1083, 5487], '274:': [1084, 5284, 5488], '11053-11059Abstract': [1085, 5489], '(49)': [1093, 5497], 'appears': [1097, 3795, 4059], 'only': [1101, 3470, 3725], 'phospholipid': [1102], 'hydrolyzed': [1105], 'do': [1111], 'know': [1113], 'what': [1114], 'type': [1115], 'target': [1120, 5174], 'does': [1125, 3349, 4852, 5106], 'phosphatidyl-d-serine,': [1128], 'phosphatidyl-l-serine.': [1133], 'Thus': [1134, 1692, 3979, 5160, 5573], 'reasonable': [1137], 'assume': [1139, 5718], 'same': [1144, 4861, 4963], 'activity': [1145, 2077, 2384, 2431, 2650, 3329, 3353, 4015, 4035, 4273, 4297, 4376, 4552], '1-acyl-2-lyso-PS': [1147, 1347, 3310, 4959], 'its': [1161, 5612, 5669], 'function': [1162, 4807, 5640], 'yet.': [1167, 6011], 'Another': [1168, 5405], 'ability': [1176, 3223, 3841, 3928, 4466, 4768, 4815, 4964, 5613], 'sPLA2': [1183], '(sPLA2-IIA)': [1184], '(15Komada': [1185], 'M.': [1186, 1247, 1291, 1304, 1321, 1563, 2632, 3077, 5683, 5790, 5873], 'Mizushima': [1189], 'Kitamura': [1191], '1989;': [1198, 1222, 1296], '106:': [1199], '545-547Crossref': [1200], '(65)': [1203], 'Scholar,16Seilhamer': [1205], 'J.J.': [1206], 'Pruzanski': [1207], 'W.': [1208], 'Vadas': [1209], 'P.': [1210, 1961], 'Plant': [1211], 'Miller': [1213], 'J.A.': [1214], 'Kloss': [1215], 'Johnson': [1217], 'L.K.': [1218], '264:': [1223], '5335-5338Abstract': [1224], 'Like': [1231, 3250, 4689], 'sPLA2-IIA': [1233, 2615, 2653, 4817, 4830, 4838, 4884, 4917, 5661, 5720, 5746, 5759, 5768, 5808, 5820, 5847, 5862], 'identified': [1236, 5913], 'supernatants': [1239, 2950], 'platelets': [1243, 2625, 5152, 5221, 5422], '(17Horigome': [1244, 2629], 'Hayakawa': [1246, 2631, 3072], '101:': [1256, 2641], '625-631Crossref': [1257, 2642], '(94)': [1260, 2645], 'often': [1266], 'detected': [1267, 4581, 4631, 4646, 4671, 4995, 5072, 5183, 5260, 5400, 5465], 'various': [1269, 3552, 5467, 5524], 'sites': [1270, 2582, 2670, 5518], 'inflammation': [1272, 1279], 'implicated': [1276], 'process': [1280], 'eicosanoid': [1282], '(18Kudo': [1284], 'Chang': [1286], 'H.W.': [1287], 'Hara': [1288, 1305, 1498, 5791, 5874, 6071], 'Murakami': [1290, 1303, 6060], 'Dermatologia': [1294], '(Basel).': [1295], '1:': [1297], '72-76Crossref': [1298], '19Kudo': [1301], '1170:': [1313], '217-231Crossref': [1314], '(371)': [1317], '20Murakami': [1320], 'Nakatani': [1322, 5684], 'Atsumi': [1324], 'Crit.': [1330], 'Rev.': [1331], 'Immunol.': [1332, 1483, 5798, 5881], '17:': [1334, 1467], '225-283Crossref': [1335], 'able': [1344, 3254, 3283], 'hydrolyzes': [1353, 4840, 5975], 'phospholipids': [1355, 4682, 4842, 4855, 5750], 'phosphatidylethanolamine': [1358, 4845], 'phosphatidylcholine.': [1360], 'study,': [1363, 2806, 5339], 'two': [1367, 1889, 2487, 5889], 'As,': [1369], 'PS-PLA1and': [1370], 'investigated.': [1378], 'results': [1380, 3294, 3857, 4941, 5081, 5540], 'indicate': [1381, 1402, 3859, 4050, 4945], 'indeed': [1385], 'intact': [1391, 4857, 5110], 'activation.': [1399], 'Our': [1400, 5538], 'findings': [1401], 'PS-PLA1plays': [1404], 'key': [1406, 5118], 'bioactive': [1412, 6030], 'lysophospholipid,': [1413, 6031], 'Bovine': [1415], 'brain': [1416], 'di-oleoyl': [1419], 'purchased': [1422, 1511, 1525], 'Avanti': [1424], 'Polar': [1425], 'Lipids': [1426, 4537], '(Alabaster,': [1427], 'AL),': [1428], 'Rhizopus': [1430], 'delemar': [1431, 2113], 'obtained': [1434, 3296, 3659, 4895], 'Seikagaku': [1436], 'Corporation': [1437], '(Tokyo,': [1438], 'Japan).': [1439, 1504, 1520], 'monoclonal': [1442, 1507, 1748, 1879, 2776, 2787, 2807, 2857, 3239, 3635], 'anti-2,4-dinitrophenylatedAscaris': [1443], '(DNP-As)': [1444], 'antibody': [1446, 1508, 1749, 2808], '(21Hara': [1447], 'Komatsu': [1449], 'Tsutsumi': [1451], 'Ujiie': [1453], 'Ikeda': [1455], 'Pharm.': [1464], 'Bull.': [1465], '1994;': [1466], '1121-1123Crossref': [1468], '(2)': [1471], 'DNP-As': [1475, 1902, 3244, 3640], '(22Katayama': [1476], 'Shionoya': [1478], 'Ohtake': [1480], 'Microbiol.': [1482], '22:': [1485, 5920], '89-101Crossref': [1486], '(348)': [1489], 'kind': [1493], 'donated': [1494], 'Dr.': [1496, 6049, 6058, 6069, 6086], 'Kiyoto': [1497, 6070], '(Kissei': [1499, 6072], 'Pharmaceutical': [1500, 6073], 'Co.': [1501, 6074], 'Ltd.,': [1502], 'Nagano,': [1503], 'Anti-human': [1505], 'Fas': [1506], '(CH-11)': [1509], 'Medical': [1513], '&': [1514], 'Biological': [1515], 'Laboratories': [1516], 'Co.,': [1517], 'Ltd.': [1518], '(Nagoya,': [1519], 'All': [1521, 4046], 'chemicals': [1523], 'Sigma.': [1527], 'cavity': [1532, 1635, 5559], 'male': [1534], 'Wistar': [1535], 'rats,': [1536], 'weighing': [1537], '200–250': [1538], 'g,': [1539], 'Percoll': [1543], '(Amersham': [1544], 'Pharmacia': [1545, 2897], 'Biotech,': [1546], 'Uppsala,': [1547], 'Sweden)': [1548], 'described': [1550, 2238, 2333, 2613, 2627, 3068, 4249, 4311], 'previously': [1551, 2239, 2334, 2628, 3069, 4312, 5182, 5418], '(23Suzuki-Nishimura': [1552], 'Nagaya': [1554], 'Uchida': [1558], 'M.K.': [1559], 'Umeda': [1562], 'Jpn.': [1566], 'Pharmacol.': [1568, 1967], '1991;': [1569], '57:': [1570], '79-90Crossref': [1571], '(17)': [1574], 'Purified': [1577, 3234, 3536], 'suspended': [1580, 1857], 'HEPES-buffered': [1582, 1871, 1892, 1921, 2044], 'Tyrode': [1583, 1872, 1893, 1922, 2045], 'solution': [1584, 1873, 1923, 2046], '(137': [1585], 'mm': [1586, 1589, 1592, 1595, 1598, 1601, 2131], 'NaCl,': [1587], '2.7': [1588], 'KCl,': [1590], '12': [1591, 3157], 'HEPES,': [1593], '1': [1594, 1765, 2376, 2695, 3306], 'MgCl2,': [1596], '2': [1597, 1650, 1772, 2150, 3117, 3442], 'CaCl2,': [1599], '5.6': [1600], 'dextrose,': [1602], '0.01%': [1604, 2052, 2099], 'bovine': [1605, 2055, 2086, 3315], 'serum': [1606, 1724, 2056, 2087], 'albumin,': [1607], 'pH': [1608, 2135, 2978, 3130], '7.4).': [1609], 'purity': [1611], 'final': [1617], 'preparation': [1618, 1697, 3944], '>95%,': [1620], 'estimated': [1622, 4507], 'toluidine': [1624], 'blue': [1625, 2329], 'staining.': [1626], 'We': [1627, 2081, 4445, 4730, 4811, 5214, 5417, 5600, 6047, 6064], 'used': [1628, 2036, 2047, 2098, 2195, 2210, 2539, 2567, 2815, 3007, 3122, 3160, 3201, 3214, 3300, 3663, 3747, 3872, 5578], 'recovered': [1631, 2374, 2701, 2724, 2992, 4517, 5350], '“crude': [1637], 'RPMC.”': [1638], 'Using': [1639], 'Wright-Giemsa': [1640], 'staining': [1641, 2752], 'confirmed': [1643, 4032, 4616], '(about': [1649], '×': [1651, 1766, 1773, 1796, 1864, 1938, 2276, 2729, 2905, 2913, 3195, 3443, 3539, 4102, 4130, 4179, 4389, 4520], '107': [1652], 'per': [1654], 'rat)': [1655], 'consisted': [1656, 3945], 'mononuclear': [1659, 1682, 3948], 'leukocytes': [1660, 1677, 3949, 3963], '(macrophages': [1661, 3950], 'monocytes)': [1663, 3952], 'minor': [1666, 3955], 'population': [1667, 3901, 3956], 'polymorphonuclear': [1676, 1684, 3962], '(neutrophils).': [1678], 'ratio': [1680], 'leukocytes,': [1683, 1685], 'typically': [1690], '94:1:5.': [1691], 'there': [1698, 5953], 'are': [1699, 1990, 3583, 4160, 4215, 4346, 4428, 4683, 5423, 5566, 5733, 6035, 6065], 'about': [1700, 3972, 5833], '20': [1701, 1751, 2712, 3973], 'many': [1704, 3705], 'Human': [1710], 'maintained': [1715], 'RPMI': [1717, 1740, 2927], '1640': [1718, 1741, 2928], 'containing': [1720, 2843, 2869, 3126], '5%': [1721, 1729, 2844, 2870], 'fetal': [1722], 'calf': [1723], 'atmosphere': [1727], 'CO2.': [1730], 'To': [1731, 3394, 3741], 'induce': [1732, 4145, 5814], 'apoptosis,': [1733], 'incubated': [1737, 1829, 2110, 2296, 2853, 2924, 3242, 3408, 3542, 3638, 4105, 4182, 4392, 4603, 5006], 'serum-free': [1739, 2926], 'anti-Fas': [1747, 4136], '(CH-11,': [1750], 'ng/ml)': [1752], '4': [1754, 1944, 3912, 3918, 4138, 5054, 5061], 'h': [1755, 2213, 2299, 4139], '37': [1757, 1886, 1904, 2147, 2944], '°C.': [1758, 1887, 1945, 2302, 2945], 'co-culture': [1761, 3748], 'system,': [1762, 2676], '104': [1767, 1865], '105': [1774, 1797, 2277], 'exposure': [1778, 3811, 4226, 5147], 'measured': [1780, 4304, 4364], 'FITC-labeled': [1785], 'annexin': [1786], 'V': [1787, 3212, 4246], 'using': [1788, 1845, 2716, 2780, 2830, 4305], 'Annexin': [1790, 1819], 'V-FITC': [1791, 1820], 'Kit': [1792], '(Immunotech).': [1793], 'Briefly,': [1794], '5': [1795, 1863, 1941, 4028], '(apoptotic': [1799], 'cells)': [1804, 2907], 'washed': [1806, 1855], 'ice-cold': [1808, 1920], 'phosphate-buffered': [1809], 'saline': [1810, 2842, 2868], 'resuspended': [1812], '495': [1814], 'µl': [1815], 'buffer.': [1818], '(5': [1821, 2107, 3647], 'µl)': [1822, 3091], 'added': [1824, 1925, 4359, 4868], 'suspension': [1827], '10': [1831, 1877], 'min': [1832, 1884, 1942, 2713, 2942, 3414, 3545, 4108, 4185, 4395], 'ice': [1834, 2715], 'dark.': [1837], 'analyzed': [1841, 3049, 3696, 4544], 'flow': [1843, 1848, 3106, 3114, 3154], 'cytometry': [1844], 'EPICS': [1846], 'XL': [1847], 'cytometer': [1849], '(Beckman': [1850], 'Coulter).': [1851], 'once,': [1856], 'density': [1861], 'RPMC/ml': [1866], '(in': [1867], '0.2': [1868], 'ml)': [1869], 'sensitized': [1875], 'µg/ml': [1878, 1901, 3548, 4413, 5810], 'anti-DNP-As': [1881, 6081], '30': [1883, 2941, 3181], 'After': [1888, 1914, 2152, 2678, 2720, 2751], 'washes': [1890], 'solution,': [1894], '60': [1900], '°C': [1905, 2148, 2204, 3151], 'recombinant': [1912, 2286, 2371, 2387, 2594, 2936, 3475, 3606, 3645, 4975, 5008], '15': [1915, 3413, 3544, 4107, 4184, 4394], 'min,': [1916], '1.2': [1917], 'ml': [1918], 'terminate': [1927], 'reaction,': [1929], 'mixture': [1933], 'centrifuged': [1935], '800': [1937], 'g': [1939], 'Histamine': [1946, 1974, 3570, 4147, 4202, 4415], 'supernatant': [1949, 2310, 3047, 4470, 4541, 4587, 4652, 5076, 5549], 'determined': [1951, 2082, 4243], 'fluorometric': [1954], 'assay': [1955, 2065, 3885, 4362, 6056], 'Shore': [1957], 'et': [1958], 'al.': [1959], '(24Shore': [1960], 'Burkhalter': [1962], 'Chon': [1964], 'V.': [1965], 'Exp.': [1968], 'Ther.': [1969], '1956;': [1970], '127:': [1971], '182-186Google': [1972], 'calculated': [1977], 'percentage': [1980], 'total': [1983, 3578, 4155, 4210, 4423, 4529], 'content.': [1985], 'Values': [1986, 4345], 'presented': [1991, 5715], 'means': [1994, 3103, 3585, 4162, 4217, 4348, 4430], '±': [1995, 2017, 3586, 4163, 4218, 4349, 4431], 'S.E.': [1996, 3587, 4164, 4219, 4350, 4432], 'replicate': [1999], 'experiments': [2000, 4143, 5503], 'different': [2002, 3319, 4262, 5898], 'samples': [2003, 2820, 3093], 'pooled': [2005], 'Spontaneous': [2007], 'absence': [2012, 2934, 3290, 3419, 3565, 3617, 4117, 4634, 5868], 'compounds': [2014], '3.4': [2016], '3.3%.': [2018], 'some': [2020, 5018], 'cases,': [2021, 3165], '(ConA;': [2024], '100': [2025, 3547], 'µg/ml),': [2026, 3648, 4112], 'known': [2029, 3432], 'cross-link': [2031], 'receptor,': [2034], 'prime': [2038], 'instead': [2041, 3301, 3664, 3875], 'IgE-antigen.': [2043], 'contains': [2051], 'acid-free': [2054], 'albumin.': [2057], 'Albumin': [2058], 'essential': [2061, 5678], 'factor': [2062, 5119, 5406], 'system': [2066, 3749, 3983], 'evaluate': [2068], 'activity,': [2070], '(>1%)': [2074], 'affected': [2075], '(data': [2078, 2103, 3340, 4534, 4624, 4782], 'shown).': [2080, 2105, 4536, 4626, 4784], 'optimal': [2083], 'albumin': [2088], 'range': [2092], '0.01': [2094], '0.1%': [2096, 3127], 'Diacyl-PS': [2106], 'µmol)': [2108], 'R.': [2112, 3071], '(20': [2115], 'mg/ml;': [2116], 'Seikagaku-kogyo,': [2117], 'Tokyo,': [2118], 'Japan)': [2119], '(from': [2123], 'porcine': [2124], 'pancreas,': [2125], 'Roche': [2126], 'Molecular': [2127], 'Biochemicals)': [2128], '50': [2130, 4750, 5834], 'Tris': [2132], 'malate': [2133], 'buffer,': [2134], '5.7,': [2136], '0.25': [2141], 'volume': [2142], 'diethyl': [2144, 2159], 'ether,': [2145], 'h.': [2151], 'extraction': [2153], 'acids': [2157, 2664, 4993, 5069, 5188], 'ether/petroleum': [2160], 'ether': [2161], '(1:1;': [2162], 'v:v),': [2163], 'four': [2164], 'times,': [2165], 'remaining': [2167], 'extracted': [2170, 2952, 2998], 'method': [2173, 2955], 'Bligh': [2175, 2957], 'Dyer': [2177, 2180, 2959, 2962], '(25Bligh': [2178, 2960], 'E.C.': [2179, 2961], 'W.F.': [2181, 2963], 'Can.': [2182, 2964], '1959;': [2186, 2968], '37:': [2187, 2969], '911-917Crossref': [2188, 2970], '(42871)': [2191, 2973], 'stored': [2201], '−80': [2203], 'chloroform/methanol': [2206, 3004, 3098], '(2:1;': [2207], 'v:v)': [2208], 'within': [2211], '24': [2212], 'avoid': [2215], 'migration': [2218, 3497], '(26Pluckthun': [2219, 3381, 3505], 'Dennis': [2221, 3383, 3507], 'E.A.': [2222, 3384, 3508, 5915], 'Biochemistry.': [2223, 3385, 3509], '1982;': [2224, 3386, 3510], '21:': [2225, 3387, 3511], '1743-1750Crossref': [2226, 3388, 3512], '(220)': [2229, 3391, 3515], 'Recombinant': [2232], 'prepared': [2236, 2860, 3313], 'Briefly': [2272], 'Sf9': [2273], '(8': [2275], 'cells/ml)': [2278], 'spinner': [2281], 'flask': [2282], 'infected': [2284, 2313, 2379], 'baculovirus': [2289, 2585, 2595], '(multiplicity': [2290], 'infection': [2292], '=': [2293], '10)': [2294], '96': [2298], '27': [2301], 'proteins': [2304], 'sequential': [2316], 'passages': [2317], 'DEAE': [2320], 'exchange': [2322], 'column,': [2323, 2326], 'heparin-Sepharose': [2325], 'Sepharose': [2330], 'column': [2331], 'Approximately': [2367], '400': [2368], 'µg': [2369], 'liter': [2377], 'fluid.': [2381], '2.8': [2390], 'nmol/min·µg': [2391, 2656], 'protein': [2393, 2616, 2690, 2722, 2759, 2833], 'PS.': [2395, 5752], 'family,': [2401, 2416], 'alignment': [2403], 'amino': [2405, 2663], 'sequences': [2407], 'members': [2412], 'lipoprotein': [2419, 5632], 'hepatic': [2422, 5629], 'lipase,': [2423, 5633], 'indicated': [2424], 'Ser166': [2426, 4284], 'Catalytically': [2467], 'mutant': [2469, 2606, 4010, 4287, 4301, 4408, 4979], 'Ala': [2481, 4286, 4300, 4407], 'residue,': [2482], 'follows:': [2486], 'oligonucleotides,': [2488], '5′-GGGGGGAATTCATGTGTCCTGGCCTCTGGGGGACA-3′': [2489], '(nucleotide': [2490, 2531, 2559], 'positions': [2491, 2532, 2560], '124': [2492], 'cDNA': [2496, 2661], 'Scholar))': [2528], '5′-GAGCCCCCAGAGCGACACCAATGA-3′': [2530], '485–508': [2533], 'cDNA),': [2537], 'primers': [2541, 2569], '(PCR)': [2547], 'introduce': [2549], 'mutation.': [2551], 'amplified': [2553], 'PCR': [2554, 2576], 'product': [2555, 2577], 'oligonucleotide,': [2557], 'CCCCCAAGCTTCTACACACAGGCCATTTTCAGGTC': [2558], '1348–1371': [2561], 'PS-PLA1),': [2564], 'then': [2566, 2878], 'second': [2572], 'PCR.': [2573], 'resulting': [2575, 3376], 'introduced': [2579, 2683, 3101], 'into': [2580, 2668, 3108, 5020], 'EcoRI/HindIII': [2581], 'transfer': [2586, 2834], 'vector': [2587, 2674], 'pFASTBAC1': [2588], 'plasmid': [2589, 2680], '(Invitrogen),': [2590], 'performed': [2597], 'according': [2598], "manufacturer's": [2601], 'instructions': [2602], '(Bac-to-Bac': [2603], 'system).': [2604], 'PS-PLA1proteins': [2607], 'expressed': [2609, 3573, 4150, 4205, 4418], 'above.': [2614], '32': [2655], 'protein.': [2658], 'Rat': [2659, 2697], '(encoding': [2662], 'Val27–Val456)': [2665], 'ligated': [2667], 'theBamHI/HindIII': [2669], 'pET21c': [2673], '(pET': [2675], 'Novagen).': [2677], 'had': [2681], 'intoEscherichia': [2684], 'coli': [2685], 'strain': [2686], 'BL21': [2687], '(DE3)': [2688], '(Novagen),': [2689], 'expression': [2691, 5412, 5510], 'induced': [2693, 5515], 'mmisopropyl-β-d-thiogalactopyranoside.': [2696], 'polypeptides': [2699], 'insoluble': [2704, 2732], 'fraction.': [2705], 'pellet': [2708, 2733], 'sonicated': [2710], 'tip-type': [2718], 'sonicator.': [2719], 'sonication,': [2721], 'ultracentrifugation': [2726], '100,000': [2728], 'g.': [2730], 'dissolved': [2735, 3002, 3096], 'dodecyl': [2738], 'sulfate-polyacrylamide': [2739], '(SDS-PAGE)': [2742], 'sample': [2743], 'buffer': [2744], 'subjected': [2746, 3880], '10%': [2748], 'acrylamide': [2749], 'SDS-PAGE.': [2750], 'Coomassie': [2754], 'Brilliant': [2755], 'Blue,': [2756], 'corresponding': [2758], 'band': [2760], 'excised': [2762], "Freund's": [2766], 'adjuvant.': [2767], 'BALB/c': [2768], 'mice': [2769], 'immunized': [2771], 'protein,': [2774], 'antibodies': [2777, 2858, 2888, 4137], 'PAI': [2782], 'myeloma': [2783], 'line.': [2785], 'Eight': [2786], 'antibody-producing': [2788], 'hybridoma': [2789], '(clones': [2792], '7F10,': [2793], '8H7,': [2794], '10G4,': [2795], '12B12,': [2796], '12D9,': [2797], '15D12,': [2798, 2863], '16F1,': [2799], '20D4)': [2801], 'established.': [2803], 'clone': [2810, 2862], '15D12': [2811], '(mouse': [2812], 'IgG1)': [2813], 'Western': [2817, 4366], 'blotting.': [2818], 'Protein': [2819], 'separated': [2822], 'SDS-PAGE': [2824], 'transferred': [2826], 'nitrocellulose': [2828], 'filters': [2829, 2837], 'Bio-Rad': [2832], 'system.': [2835], 'Tris-buffered': [2841, 2867], '(w/v)': [2845], 'skimmed': [2846, 2871], 'milk': [2847, 2872], '0.05%': [2849, 2874], '(v/v)': [2850], 'Tween': [2851, 2875], '20,': [2852, 2876], 'anti-rat': [2855], '(ascites': [2859], 'diluted': [2864], '1:1000)': [2865], 'anti-mouse': [2881], 'IgG-horseradish': [2882], 'peroxidase.': [2883], 'Proteins': [2884], 'bound': [2885], 'visualized': [2890], 'enhanced': [2893, 3904, 4484, 5149], 'chemiluminescence': [2894], 'kit': [2895], '(ECL,Amersham': [2896], 'Biotech).': [2898], 'Apoptotic': [2899], '(2.3': [2904], '108': [2906, 2914, 4521], '(2.4': [2912], 'ConA': [2920, 3298, 3661, 3890, 3910, 4110, 4187, 4397], '(100': [2921, 4111, 4188, 4398], 'µg/ml))': [2922], '(1.8': [2938], 'µg/ml)': [2939, 3561, 4189, 4399], 'Phospholipids': [2946], 'acidic': [2977, 2983], '(2.5).': [2979], 'organic': [2995], 'phase.': [2996], 'lipids': [2999, 3019, 4644], 'dried,': [3001], '(1:1),': [3005], 'functional': [3010], 'bioassay': [3011], 'analysis.': [3015], 'recovery': [3017, 3035], 'monitored': [3021], 'adding': [3023], 'trace': [3025], 'amount': [3026, 3650, 4356, 5575], '1-[14C]oleoyl-lyso-PS': [3028, 3037], 'samples.': [3031], 'always': [3039], '>95%.': [3040], 'Lipid': [3041], 'extracts': [3042], 'Quattro': [3052], 'II': [3053], 'spectrometer': [3055, 3134], '(Micromass,': [3056], 'Manchester,': [3057], 'United': [3058], 'Kingdom)': [3059], 'equipped': [3060], '(ESI)': [3066], '(27Taguchi': [3070], 'Takeuchi': [3074], 'Ishida': [3076], 'Mass': [3079], 'Spectrom.': [3080], '2000;': [3081], '35:': [3082], '953-966Crossref': [3083], '(141)': [3086], 'Aliquots': [3089], '(2': [3090, 4129], '(100–200': [3094], 'pmol/µl)': [3095], '(2:1)': [3099], 'injector': [3107], 'ESI': [3110], 'chamber': [3111], 'rate': [3115, 3155], 'µl/min.': [3118], 'eluting': [3120], 'solvent': [3121], 'acetonitrile/methanol/water': [3124], '(2:3:1)': [3125], 'ammonium': [3128], 'formate,': [3129], '6.4.': [3131], 'operated': [3136], 'positive': [3139, 3186], 'negative': [3141, 3188], 'modes.': [3143, 3190], 'Nitrogen': [3144], 'gas': [3145], 'temperature': [3148], '80': [3150], 'liter/min': [3158], 'drying.': [3162], 'most': [3164], 'capillary': [3167], 'voltage': [3168, 3177], 'set': [3170, 3179], '3.7': [3172], 'kV,': [3173], 'cone': [3176], 'V,': [3182], 'both': [3183], 'For': [3191], 'MS/MS': [3192, 4618], 'experiments,': [3193], '3–4': [3194], '10−4': [3196], 'torr': [3197], 'argon': [3199], 'collision': [3204, 3208], 'gas,': [3205], 'energy': [3209], '30–40': [3211], 'obtaining': [3216], 'fragment': [3217], 'ions': [3218, 4623], 'precursor': [3220], 'ions.': [3221], 'antigen-dependent': [3228], 'determined.': [3233, 3429], 'primed': [3236], 'anti-DNP': [3238, 3634], '1-oleoyl-2-lyso-PS,': [3251], '2-oleoyl-1-lyso-PS': [3252, 3270, 3339], 'IgE-antigen-stimulated': [3260, 3612], '(Fig.1': [3263], 'A).': [3264, 3855, 4890], 'dose-dependent': [3266, 3479], 'curve': [3267, 3519, 4197, 4499], 'showed': [3268, 5341, 5419, 5601], 'potent': [3273, 4882, 5723, 5762], '1-oleoyl-2-lyso-PS': [3275], 'stimulating': [3277, 5041], 'release.': [3279, 4385], 'Neither': [3280], 'enhance': [3285, 4041], 'antigen.': [3292], 'Similar': [3293], 'IgE-antigen': [3303, 3666], '(Fig.': [3305, 3670, 3911, 4027, 4502, 4593, 4637, 4659, 4922, 5053, 5060, 5623, 5729, 5842], 'B).': [3307, 4029, 4924, 5062], '2-Acyl-1-lyso-PS': [3308], 'brain-derived': [3316], 'acyl': [3320, 3362, 3500, 4675], 'chains': [3321, 4676], 'sn-2': [3326, 3366, 4679], 'positions.': [3327], 'identical': [3335], 'shown),': [3342], 'moiety': [3348], 'affect': [3351], 'It': [3356, 3789, 4002, 4664, 5132, 5322, 5655], 'generally': [3358, 3791], 'accepted': [3359, 3792, 5135], '2-acyl-lysophospholipids': [3369], 'easily': [3370], 'migrates': [3371], 'position,': [3375], '1-acyl-lysophospholipids': [3380], 'determine': [3395, 4931], 'whether': [3396, 4448, 4733, 4932], 'really': [3399], 'ConA-primed': [3404, 3458], 'liposomes': [3411], 'above': [3441], '10−5m.': [3444], 'However,': [3445, 4762], 'lower': [3447], 'concentrations,': [3448, 4916], 'alone': [3450, 5769], 'unable': [3452, 4020], 'As': [3460, 3621, 3806, 3914, 4460, 4746], 'Fig.2,': [3463], 'manner.': [3480], 'shows': [3482], 'since': [3495, 4674, 4829], 'takes': [3502], 'hours': [3504], 'Scholar).Figure': [3517], '2Dose-response': [3518], 'showing': [3520], 'ConA-stimulated': [3525], 'liposomes.': [3535, 3620], '(1': [3538, 3560, 4101, 4178, 4388, 4412], '104)': [3540, 4103, 4180, 4390], 'ConA,': [3550], 'concentrations': [3553, 5544], 'liposomes,': [3556], '(closed': [3562, 4175], 'circles)': [3563, 3567, 4172, 4176], '(open': [3566, 4171], 'percent': [3575, 4152, 4207, 4420], 'histamine,': [3580, 4157, 4212, 4425], 'values': [3582, 4159, 4214, 4427, 4559], 'three': [3589, 4166, 4221, 4261, 4352, 4434], 'independent': [3590, 4167, 4222, 4353, 4435, 5854], 'experiments.View': [3591, 4263, 4436], 'Large': [3592, 4264, 4437], 'Image': [3593, 4265, 4438], 'Figure': [3594, 4266, 4439], 'ViewerDownload': [3595, 4267, 4440], 'Hi-res': [3596, 4268, 4441], 'image': [3597, 4269, 4442], 'Download': [3598, 4270, 4443], '(PPT)': [3599, 4444], 'Next': [3600], 'examined': [3602, 4447, 4732, 4813], 'Fig.': [3624, 3917, 4600], '3,': [3625], 'pretreated': [3632, 4134], 'IgE,': [3636], 'increased.': [3654], 'similar': [3656, 4892], 'result': [3657, 3680, 4031, 4786, 4893, 5393], 'cross-linking': [3669], '3).': [3671], 'PS-PLA1alone': [3672], 'suggests': [3681], 'When': [3694, 3830, 4859], 'found': [3701, 5360, 5934], 'they': [3703, 3970], 'contain': [3704], '(see': [3711, 3965], '“Experimental': [3712, 3966, 4251], 'Procedures”).': [3713], 'possible': [3717, 5324, 5591, 5756], 'but': [3729, 3820, 3902, 4977, 5736], 'reside': [3736], 'near': [3737], 'test': [3742], 'possibility,': [3744], 'located': [3761], 'inner': [3765, 5947], 'leaflet': [3766, 5948], 'lipid': [3768, 4584, 5950, 5987, 5996], 'bilayers': [3769], 'normal': [3771, 3817], 'accessibility': [3775], 'substrate': [3780], 'seems': [3785], 'limited.': [3788], 'surface': [3799, 4062, 4231, 4796, 5094, 5644, 5965], 'cytokine-activated': [3804], 'Fig.4': [3809], 'C,': [3810], 'limited': [3815, 3897], 'evident': [3823], '(anti-Fas': [3826], 'antibody-treated)': [3827], 'increased': [3852, 3938], '(Fig.4': [3854], 'These': [3856, 5080], 'clearly': [3858, 5082], 'PS-PLA1hydrolyzes': [3861], 'exposed': [3863, 5091, 5167, 5961], 'produces': [3868, 5086], 'Next,': [3870], 'them': [3881], 'Exposure': [3893], 'after': [3905, 4999], 'D).': [3913], 'B,': [3919, 4169, 4374, 4464], 'used,': [3926], 'ConA-induced': [3933, 4477], 'significantly.': [3939], '(neutrophils)': [3964], 'Procedures”),': [3967], 'together': [3969], 'numerous': [3976], 'again': [3980], 'FcεRI-dependent': [3991], 'PS-exposing': [4000], 'no': [4013], '(Fig.5': [4016], 'A)': [4017, 5055], 'catalytic': [4034, 4292, 4375], 'required': [4039, 4275, 4380, 5812, 6037], 'data': [4048, 4553, 5714], 'actually': [4070, 4452, 5071], 'surrounding': [4074], 'vivo.Figure': [4078], '4PS-PLA1': [4079], 'effectively': [4080], 'non-mast': [4096], 'A,': [4098, 4283], '(400': [4120], 'ng/ml),': [4121], '105),': [4131], 'prior': [4140], 'apoptosis.': [4146], 'experiments.': [4168, 4223, 4354], 'dose-response': [4196], 'shown.': [4201], 'C': [4224], 'andD,': [4225], '(C)': [4236], '(D)': [4241], 'FITC-annexin': [4245], 'under': [4250], 'Procedures.”': [4252], 'Results': [4253], 'representative': [4256], 'experiment': [4257], 'least': [4260], '(PPT)Figure': [4271], '5Catalytic': [4272], 'stimulation': [4277, 4382], '→': [4285], 'Ser166→': [4299, 4406], '1-[14C]acyl-2-lyso-PS': [4306], 'substrate,': [4309], 'each': [4361, 4864], 'blotting': [4367], 'inset.': [4373], 'Crude': [4386], 'wild-type': [4401], '(lane': [4403, 4410], '1)': [4404, 4958], '2)': [4411, 4974], 'each).': [4414], 'further': [4446, 4543, 6033], 'itself': [4450], 'membranes.': [4459, 4858, 5036, 5112], 'Fig.6': [4463], 'greatly': [4483], 'From': [4496, 5712], 'standard': [4498], '6': [4503, 4594, 4601], 'A),': [4504], '∼8': [4509], 'nmol': [4510], 'equivalent': [4513], '2.3': [4519], 'corresponds': [4524], '4%': [4526], 'ESI-MS.': [4546], 'good': [4548], '(Fig.6': [4554], 'B),': [4555], 'signals': [4556, 4628], 'm/z': [4558, 4577], '522.4,': [4561], '494.3,': [4563], 'correspond': [4565], 'oleic': [4569], '(18:1,': [4571], 'm/z522.4),': [4572], 'palmitoleic': [4574], '(16:1,': [4576], '494.3),': [4578], 'respectively,': [4579], 'fraction': [4585, 4658], 'C)': [4595], '(ConA-treated,': [4599], 'G)': [4602], 'identity': [4607], 'peak': [4610], '(m/z': [4611], '522.4)': [4612], '18:1-lyso-PS': [4614], 'analysis': [4619, 4998], 'daughter': [4622], 'PS-PLA1treatment': [4636], '6,': [4638, 4660], 'D': [4639], 'H).': [4641], 'Interestingly': [4642], 'exclusively': [4648, 5349], 'E': [4661], 'I).': [4663], 'concluded': [4667, 5164], 'rich': [4684], 'acids.': [4688], 'lipases,': [4691, 5626], 'heparin': [4697, 4737, 4753, 4763, 5622, 5638], 'next': [4731], 'Fig.7,': [4749], 'ng/ml': [4751, 5835], 'inhibit': [4766], 'vitro': [4775], 'nor': [4776], 'lyso-PS-induced': [4777], 'indicates': [4787], 'association': [4790], 'between': [4791], 'via': [4798], 'proteoglycan': [4801], 'cellular': [4806], 'finally': [4812], 'compared': [4823], 'vitro.': [4837], 'anionic': [4841], 'amounts': [4862], 'separately': [4867], 'cross-linker,': [4877], 'much': [4880], '(Fig.8': [4889], 'co-cultured': [4900, 5047], 'cross-linker': [4910, 5841], '8': [4923], 'undertaken': [4929], 'participates': [4934], 'Three': [4940], '2-acyl-1-lyso-PS:': [4957], 'IgE-antigen-induced': [4969, 4982], 'RPMC;': [4973, 4986], '3)': [4988], 'MS': [4997], 'results,': [5014], 'summarized': [5015], 'below,': [5016], 'provide': [5017], 'insights': [5019], 'how': [5021, 5030], 'regulated': [5028], 'effective': [5039], 'spectrometry.': [5079], 'although,': [5101], 'phospholipases,': [5104], 'act': [5108, 5891], 'They': [5113], 'suggest': [5115, 5957], 'regulating': [5120, 5407], 'availability': [5125], 'surface.': [5131, 5143], 'well': [5134], 'expose': [5139], 'cytokine-stimulated': [5154, 5972], 'ConA-treated': [5156], '(this': [5158], 'study).': [5159], 'vivo.': [5178, 5336, 5416, 5599, 6046], 'fact,': [5180], 'abundantly': [5194], 'express': [5195], '(13Yokoyama': [5197], 'IgE-antigen-': [5223], '2K.': [5232], 'Kawamoto,': [5233], 'Aoki,': [5235, 5530], 'Tanaka,': [5237], 'Itakura,': [5239], 'Kiso,': [5241], 'Matsuda,': [5244], 'manuscript': [5245], 'preparation.Lyso-PS': [5247], 'vivo:': [5256], 'aqueous': [5263], 'humor': [5264], 'eyes': [5267], '(28Liliom': [5268], 'Guan': [5270], 'Z.': [5271], 'Tseng': [5272], 'J.L.': [5273], 'Desiderio': [5274], 'D.M.': [5275], 'Tigyi': [5276], 'Watsky': [5278], 'M.A.': [5279], 'Am.': [5280], 'C1065-C1074Crossref': [5285], 'site': [5299], 'tissue': [5301], 'injury': [5302], 'responsible': [5328], 'supernatant.': [5353], 'our': [5355, 5505], 'previous': [5356], 'work': [5357], 'applied': [5363], 'immediately': [5367], 'converted': [5368], 'acylation': [5372], '(5Tamori-Natori': [5373], 'explain': [5395], 'why': [5396, 5758], 'fractions.': [5404], 'major': [5425], 'tissues': [5469, 5522], '(14Nagai': [5470], 'preliminary': [5502, 5539], 'laboratory': [5506], 'inflammatory': [5517, 5525], 'stimuli.': [5526], '3Y.': [5527], 'Nagai,': [5528], 'Arai,': [5532], 'Inoue,': [5535], 'unpublished': [5536], 'data.': [5537], 'plasma,': [5555], 'rats': [5561], 'injected': [5562], 'intraperitoneally': [5563], 'casein': [5565], '400,': [5567], '5,': [5568], '150': [5570], 'ng/ml,': [5571], 'respectively.': [5572], 'close': [5583], 'levels,': [5587], 'lost': [5611], '7).': [5624], 'Many': [5625], 'hepatocyte': [5646], 'adipocyte': [5648], 'interacting': [5650], 'proteoglycan.': [5654], 'demonstrated': [5659], 'attached': [5663], 'surfaces': [5667], 'C-terminal': [5670], 'heparin-binding': [5671], 'domain': [5672], 'attachment': [5676], 'prostaglandin': [5680], 'biosynthesis': [5681], '(29Murakami': [5682], '1996;': [5691], '271:': [5692], '30041-30051Abstract': [5693], '(122)': [5701], 'case': [5709], 'here,': [5716], 'less': [5722, 5761], '8).': [5730, 5843], 'Living': [5731], 'normally': [5734, 5943], 'resistant': [5735], 'become': [5737], 'susceptible': [5738], 'during': [5739], 'apoptosis': [5740], 'Unlike': [5744], 'reason': [5757], 'provided': [5779], 'enough': [5788], '(30Murakami': [5789, 5872], '151:': [5800, 5883], '5675-5684PubMed': [5801, 5884], 'Indeed,': [5804], '>20': [5809], 'alone.': [5821], 'Conversely,': [5822], 'because': [5857], 'cross-linkers': [5871], 'PLAs': [5890], 'very': [5897], 'manner,': [5899], 'cannot': [5902], 'exclude': [5903], 'involvement': [5905], 'PLA2that': [5909], 'recently': [5911], '(31Dennis': [5914], 'Trends': [5916], '1-2Abstract': [5921], '(758)': [5927], 'summary,': [5931], 'bilayers,': [5951], 'evidence': [5955], 'outer': [5964, 5979], 'dead': [5969], 'messenger': [5988], 'synthetic': [5993], 'pathways': [5994], 'platelet-activating': [6002], 'factor,': [6003], 'sphingosine-1-phosphate': [6005], 'solved': [6010], 'sense': [6014], 'said': [6018], 'PS-PLA1is': [6020], 'studies': [6034], 'definitely': [6036], 'demonstrate': [6039], 'thank': [6048], 'Tamiko': [6050], 'Suzuki-Nishimura': [6051], 'performing': [6053], 'Makoto': [6059], 'helpful': [6062], 'discussions.': [6063], 'indebted': [6067], 'Ltd.)': [6075], 'generous': [6078, 6091], 'gift': [6079, 6092], 'antigen': [6084], 'Yoshiko': [6087], 'Nishimura-Morita': [6088]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W1989155925', 'counts_by_year': [{'year': 2024, 'cited_by_count': 5}, {'year': 2022, 'cited_by_count': 3}, {'year': 2021, 'cited_by_count': 8}, {'year': 2020, 'cited_by_count': 5}, {'year': 2019, 'cited_by_count': 6}, {'year': 2018, 'cited_by_count': 3}, {'year': 2015, 'cited_by_count': 1}, {'year': 2014, 'cited_by_count': 3}, {'year': 2013, 'cited_by_count': 4}, {'year': 2012, 'cited_by_count': 6}], 'updated_date': '2025-01-08T03:38:48.766800', 'created_date': '2016-06-24'}