Kynurenic Acid as a Ligand for Orphan G Protein-coupled Receptor GPR35

Name: Work Video:
Duration: 3 min 30 s
Jinghong Wang; Nicole Simonavicius; Xiaosu Wu; Gayathri Swaminath; Jeff D. Reagan; Hui Tian; Lei Ling
{'id': 'https://openalex.org/W1984584304', 'doi': 'https://doi.org/10.1074/jbc.m603503200', 'title': 'Kynurenic Acid as a Ligand for Orphan G Protein-coupled Receptor GPR35', 'display_name': 'Kynurenic Acid as a Ligand for Orphan G Protein-coupled Receptor GPR35', 'publication_year': 2006, 'publication_date': '2006-06-06', 'ids': {'openalex': 'https://openalex.org/W1984584304', 'doi': 'https://doi.org/10.1074/jbc.m603503200', 'mag': '1984584304', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/16754668'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m603503200', 'pdf_url': 'http://www.jbc.org/article/S0021925819477223/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S0021925819477223/pdf', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5101654390', 'display_name': 'Jinghong Wang', 'orcid': 'https://orcid.org/0000-0002-6625-6995'}, 'institutions': [{'id': 'https://openalex.org/I1320553840', 'display_name': 'Amgen (United States)', 'ror': 'https://ror.org/03g03ge92', 'country_code': 'US', 'type': 'company', 'lineage': ['https://openalex.org/I1320553840']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Jinghong Wang', 'raw_affiliation_strings': ['Amgen Inc., South San Francisco, California 94080.'], 'affiliations': [{'raw_affiliation_string': 'Amgen Inc., South San Francisco, California 94080.', 'institution_ids': ['https://openalex.org/I1320553840']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5036343006', 'display_name': 'Nicole Simonavicius', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I1320553840', 'display_name': 'Amgen (United States)', 'ror': 'https://ror.org/03g03ge92', 'country_code': 'US', 'type': 'company', 'lineage': ['https://openalex.org/I1320553840']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Nicole Simonavicius', 'raw_affiliation_strings': ['Amgen Inc., South San Francisco, California 94080.'], 'affiliations': [{'raw_affiliation_string': 'Amgen Inc., South San Francisco, California 94080.', 'institution_ids': ['https://openalex.org/I1320553840']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5102206930', 'display_name': 'Xiaosu Wu', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I1320553840', 'display_name': 'Amgen (United States)', 'ror': 'https://ror.org/03g03ge92', 'country_code': 'US', 'type': 'company', 'lineage': ['https://openalex.org/I1320553840']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Xiaosu Wu', 'raw_affiliation_strings': ['Amgen Inc., South San Francisco, California 94080.'], 'affiliations': [{'raw_affiliation_string': 'Amgen Inc., South San Francisco, California 94080.', 'institution_ids': ['https://openalex.org/I1320553840']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5070879199', 'display_name': 'Gayathri Swaminath', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I1320553840', 'display_name': 'Amgen (United States)', 'ror': 'https://ror.org/03g03ge92', 'country_code': 'US', 'type': 'company', 'lineage': ['https://openalex.org/I1320553840']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Gayathri Swaminath', 'raw_affiliation_strings': ['Amgen Inc., South San Francisco, California 94080.'], 'affiliations': [{'raw_affiliation_string': 'Amgen Inc., South San Francisco, California 94080.', 'institution_ids': ['https://openalex.org/I1320553840']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5000268016', 'display_name': 'Jeff D. Reagan', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I1320553840', 'display_name': 'Amgen (United States)', 'ror': 'https://ror.org/03g03ge92', 'country_code': 'US', 'type': 'company', 'lineage': ['https://openalex.org/I1320553840']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Jeff Reagan', 'raw_affiliation_strings': ['Amgen Inc., South San Francisco, California 94080.'], 'affiliations': [{'raw_affiliation_string': 'Amgen Inc., South San Francisco, California 94080.', 'institution_ids': ['https://openalex.org/I1320553840']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5088091238', 'display_name': 'Hui Tian', 'orcid': 'https://orcid.org/0000-0003-4969-3306'}, 'institutions': [{'id': 'https://openalex.org/I1320553840', 'display_name': 'Amgen (United States)', 'ror': 'https://ror.org/03g03ge92', 'country_code': 'US', 'type': 'company', 'lineage': ['https://openalex.org/I1320553840']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Hui Tian', 'raw_affiliation_strings': ['Amgen Inc., South San Francisco, California 94080.'], 'affiliations': [{'raw_affiliation_string': 'Amgen Inc., South San Francisco, California 94080.', 'institution_ids': ['https://openalex.org/I1320553840']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5101728380', 'display_name': 'Lei Ling', 'orcid': 'https://orcid.org/0000-0002-5051-9797'}, 'institutions': [{'id': 'https://openalex.org/I1320553840', 'display_name': 'Amgen (United States)', 'ror': 'https://ror.org/03g03ge92', 'country_code': 'US', 'type': 'company', 'lineage': ['https://openalex.org/I1320553840']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Lei Ling', 'raw_affiliation_strings': ['Amgen Inc., South San Francisco, California 94080. Electronic address:'], 'affiliations': [{'raw_affiliation_string': 'Amgen Inc., South San Francisco, California 94080. Electronic address:', 'institution_ids': ['https://openalex.org/I1320553840']}]}], 'institution_assertions': [], 'countries_distinct_count': 1, 'institutions_distinct_count': 1, 'corresponding_author_ids': [], 'corresponding_institution_ids': [], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 7.226, 'has_fulltext': True, 'fulltext_origin': 'ngrams', 'cited_by_count': 611, 'citation_normalized_percentile': {'value': 0.996198, 'is_in_top_1_percent': True, 'is_in_top_10_percent': True}, 'cited_by_percentile_year': {'min': 99, 'max': 100}, 'biblio': {'volume': '281', 'issue': '31', 'first_page': '22021', 'last_page': '22028'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T11337', 'display_name': 'Tryptophan and brain disorders', 'score': 0.9998, 'subfield': {'id': 'https://openalex.org/subfields/2803', 'display_name': 'Biological Psychiatry'}, 'field': {'id': 'https://openalex.org/fields/28', 'display_name': 'Neuroscience'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, 'topics': [{'id': 'https://openalex.org/T11337', 'display_name': 'Tryptophan and brain disorders', 'score': 0.9998, 'subfield': {'id': 'https://openalex.org/subfields/2803', 'display_name': 'Biological Psychiatry'}, 'field': {'id': 'https://openalex.org/fields/28', 'display_name': 'Neuroscience'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T11541', 'display_name': 'Neuroendocrine regulation and behavior', 'score': 0.9943, 'subfield': {'id': 'https://openalex.org/subfields/3207', 'display_name': 'Social Psychology'}, 'field': {'id': 'https://openalex.org/fields/32', 'display_name': 'Psychology'}, 'domain': {'id': 'https://openalex.org/domains/2', 'display_name': 'Social Sciences'}}, {'id': 'https://openalex.org/T10051', 'display_name': 'Asthma and respiratory diseases', 'score': 0.9886, 'subfield': {'id': 'https://openalex.org/subfields/2737', 'display_name': 'Physiology'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/orphan-receptor', 'display_name': 'Orphan receptor', 'score': 0.6663736}, {'id': 'https://openalex.org/keywords/kynurenic-acid', 'display_name': 'Kynurenic acid', 'score': 0.6482124}, {'id': 'https://openalex.org/keywords/orphan-drug', 'display_name': 'Orphan drug', 'score': 0.4755116}], 'concepts': [{'id': 'https://openalex.org/C2779161069', 'wikidata': 'https://www.wikidata.org/wiki/Q2496179', 'display_name': 'Orphan receptor', 'level': 4, 'score': 0.6663736}, {'id': 'https://openalex.org/C2776841986', 'wikidata': 'https://www.wikidata.org/wiki/Q642217', 'display_name': 'Kynurenic acid', 'level': 4, 'score': 0.6482124}, {'id': 'https://openalex.org/C185592680', 'wikidata': 'https://www.wikidata.org/wiki/Q2329', 'display_name': 'Chemistry', 'level': 0, 'score': 0.50083303}, {'id': 'https://openalex.org/C75480439', 'wikidata': 'https://www.wikidata.org/wiki/Q1367466', 'display_name': 'Orphan drug', 'level': 2, 'score': 0.4755116}, {'id': 'https://openalex.org/C116569031', 'wikidata': 'https://www.wikidata.org/wiki/Q899107', 'display_name': 'Ligand (biochemistry)', 'level': 3, 'score': 0.4543407}, {'id': 'https://openalex.org/C23525593', 'wikidata': 'https://www.wikidata.org/wiki/Q15312389', 'display_name': 'Neuron-derived orphan receptor 1', 'level': 5, 'score': 0.4383447}, {'id': 'https://openalex.org/C98274493', 'wikidata': 'https://www.wikidata.org/wiki/Q128406', 'display_name': 'Pharmacology', 'level': 1, 'score': 0.42335188}, {'id': 'https://openalex.org/C170493617', 'wikidata': 'https://www.wikidata.org/wiki/Q208467', 'display_name': 'Receptor', 'level': 2, 'score': 0.41217774}, {'id': 'https://openalex.org/C55493867', 'wikidata': 'https://www.wikidata.org/wiki/Q7094', 'display_name': 'Biochemistry', 'level': 1, 'score': 0.33884096}, {'id': 'https://openalex.org/C71924100', 'wikidata': 'https://www.wikidata.org/wiki/Q11190', 'display_name': 'Medicine', 'level': 0, 'score': 0.27236405}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.25580603}, {'id': 'https://openalex.org/C60644358', 'wikidata': 'https://www.wikidata.org/wiki/Q128570', 'display_name': 'Bioinformatics', 'level': 1, 'score': 0.19148666}, {'id': 'https://openalex.org/C104317684', 'wikidata': 'https://www.wikidata.org/wiki/Q7187', 'display_name': 'Gene', 'level': 2, 'score': 0.19014707}, {'id': 'https://openalex.org/C2776885963', 'wikidata': 'https://www.wikidata.org/wiki/Q245204', 'display_name': 'Antagonist', 'level': 3, 'score': 0.17079997}, {'id': 'https://openalex.org/C63932345', 'wikidata': 'https://www.wikidata.org/wiki/Q422500', 'display_name': 'Nuclear receptor', 'level': 4, 'score': 0.14464194}, {'id': 'https://openalex.org/C86339819', 'wikidata': 'https://www.wikidata.org/wiki/Q407384', 'display_name': 'Transcription factor', 'level': 3, 'score': 0.08952564}], 'mesh': [], 'locations_count': 1, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m603503200', 'pdf_url': 'http://www.jbc.org/article/S0021925819477223/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m603503200', 'pdf_url': 'http://www.jbc.org/article/S0021925819477223/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [{'id': 'https://metadata.un.org/sdg/3', 'display_name': 'Good health and well-being', 'score': 0.51}], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 41, 'referenced_works': ['https://openalex.org/W100188745', 'https://openalex.org/W1482828226', 'https://openalex.org/W1571519589', 'https://openalex.org/W1834981029', 'https://openalex.org/W1868733321', 'https://openalex.org/W1964454325', 'https://openalex.org/W1964709968', 'https://openalex.org/W1965796890', 'https://openalex.org/W1968001320', 'https://openalex.org/W1971865087', 'https://openalex.org/W1975929837', 'https://openalex.org/W1978997108', 'https://openalex.org/W1982737489', 'https://openalex.org/W1986276041', 'https://openalex.org/W1995335058', 'https://openalex.org/W1997509253', 'https://openalex.org/W2007798588', 'https://openalex.org/W2010145371', 'https://openalex.org/W2011403383', 'https://openalex.org/W2034395399', 'https://openalex.org/W2035421462', 'https://openalex.org/W2052151503', 'https://openalex.org/W2062545296', 'https://openalex.org/W2067494870', 'https://openalex.org/W2069310788', 'https://openalex.org/W2074259147', 'https://openalex.org/W2076511407', 'https://openalex.org/W2081348073', 'https://openalex.org/W2082216078', 'https://openalex.org/W2085901707', 'https://openalex.org/W2087539536', 'https://openalex.org/W2091196189', 'https://openalex.org/W2091275560', 'https://openalex.org/W2102964449', 'https://openalex.org/W2109014958', 'https://openalex.org/W2128326754', 'https://openalex.org/W2140881278', 'https://openalex.org/W2158025896', 'https://openalex.org/W2162704444', 'https://openalex.org/W2167775905', 'https://openalex.org/W2316156263'], 'related_works': ['https://openalex.org/W4249850777', 'https://openalex.org/W4243862461', 'https://openalex.org/W4231489727', 'https://openalex.org/W2568631126', 'https://openalex.org/W2129904325', 'https://openalex.org/W2105910857', 'https://openalex.org/W2087198642', 'https://openalex.org/W2064930430', 'https://openalex.org/W2051625890', 'https://openalex.org/W2041040626'], 'abstract_inverted_index': {'Local': [0, 162], 'catabolism': [1, 163, 3581], 'of': [2, 30, 34, 89, 116, 164, 192, 196, 251, 278, 393, 438, 487, 547, 550, 560, 566, 981, 998, 1002, 1086, 1234, 1464, 1469, 1479, 1639, 1832, 1873, 1966, 2054, 2258, 2344, 2407, 2561, 2569, 2620, 2729, 2744, 2750, 2804, 2855, 2876, 2933, 2956, 2998, 3054, 3111, 3136, 3198, 3211, 3269, 3294, 3302, 3381, 3409, 3440, 3452, 3543, 3562, 3566, 3579, 3594, 3605, 3747, 3773, 3782, 3896, 3965, 3977, 4004, 4128, 4320, 4330, 4342, 4399, 4407, 4452, 4476, 4491, 4508, 4541, 4597, 4671, 4685, 4710, 4762, 4797, 5113, 5168], 'the': [3, 23, 27, 35, 67, 87, 114, 130, 165, 185, 189, 197, 229, 249, 276, 292, 394, 545, 554, 567, 999, 1126, 1269, 1394, 1716, 1731, 1738, 1809, 1869, 1886, 2095, 2119, 2329, 2361, 2547, 2570, 2706, 2726, 2742, 2751, 2801, 2853, 2865, 2883, 2889, 2931, 2954, 2967, 2976, 2979, 2987, 3066, 3071, 3078, 3084, 3155, 3196, 3254, 3275, 3350, 3382, 3402, 3407, 3415, 3436, 3450, 3508, 3519, 3541, 3560, 3577, 3592, 3599, 3606, 3612, 3627, 3652, 3656, 3748, 3771, 3780, 3834, 3845, 3855, 3904, 3910, 4318, 4328, 4336, 4340, 4405, 4440, 4449, 4473, 4488, 4506, 4623, 4669, 4686, 4693, 4707, 4760, 4794, 4812, 5169], 'essential': [4, 166, 3607], 'amino': [5, 167, 494, 1076, 3608], 'acid': [6, 74, 95, 111, 138, 158, 168, 236, 257, 273, 300, 320, 1077, 1116, 1226, 1711, 1972, 2280, 2503, 2539, 2554, 2582, 2606, 2637, 2651, 2701, 2717, 2929, 3016, 3044, 3097, 3193, 3442, 3454, 3465, 3481, 3529, 3549, 3568, 3609, 3752, 3898, 3979, 3998, 4130, 4145, 4322, 4363, 4409, 4428, 4454, 4478, 4543, 4627, 4665, 4691, 4786, 4816], 'tryptophan': [7, 169, 1003, 2548, 2571, 2642, 3520, 3580, 3587, 3614, 3966, 3972, 4441, 4813], 'is': [8, 22, 123, 170, 184, 285, 2607, 2755, 3108, 3598, 3617, 3624, 3920, 4026, 4167, 4176, 4345, 4364, 4368, 4376, 4444, 4485, 4628, 4754, 4782], 'considered': [9, 171], 'an': [10, 103, 172, 265, 557, 1042, 1629, 1961, 2040, 2353, 3026, 3186, 3516, 3570, 3662, 3745, 3852, 3975, 4456, 4818], 'important': [11, 173, 542, 1122, 4420], 'mechanism': [12, 174, 1222, 4459], 'in': [13, 43, 82, 86, 100, 126, 145, 175, 205, 244, 248, 262, 288, 307, 544, 1007, 1045, 1088, 1099, 1125, 1282, 1303, 1342, 1586, 1631, 1653, 1685, 1737, 1775, 1820, 1842, 1868, 1902, 1928, 1948, 2128, 2218, 2272, 2275, 2355, 2508, 2510, 2533, 2542, 2546, 2657, 2709, 2737, 2775, 2795, 2822, 2925, 2936, 2953, 2986, 3020, 3057, 3083, 3232, 3240, 3253, 3274, 3308, 3320, 3349, 3373, 3385, 3389, 3394, 3401, 3406, 3414, 3423, 3458, 3473, 3489, 3518, 3532, 3540, 3554, 3582, 3649, 3770, 3779, 3833, 3844, 3903, 4135, 4136, 4162, 4387, 4401, 4422, 4433, 4460, 4465, 4487, 4496, 4546, 4599, 4622, 4673, 4692, 4722, 4756, 4805], 'regulating': [14, 176, 3583], 'immunological': [15, 177, 4423], 'and': [16, 45, 78, 129, 178, 207, 240, 291, 480, 499, 515, 940, 1005, 1090, 1107, 1237, 1242, 1256, 1295, 1298, 1313, 1339, 1365, 1466, 1584, 1596, 1619, 1662, 1734, 1773, 1800, 1818, 1826, 1861, 1885, 1905, 1932, 1990, 2070, 2081, 2090, 2093, 2105, 2114, 2117, 2143, 2223, 2242, 2263, 2303, 2404, 2417, 2435, 2515, 2558, 2573, 2622, 2627, 2652, 2754, 2770, 2815, 2820, 2849, 2864, 2943, 3086, 3114, 3226, 3234, 3261, 3277, 3288, 3314, 3325, 3352, 3361, 3392, 3428, 3535, 3558, 3651, 3826, 3841, 3974, 4023, 4035, 4152, 4158, 4325, 4404, 4501, 4607, 4610, 5140, 5153, 5158], 'neurological': [17, 179], 'responses.': [18, 180, 4463], 'The': [19, 32, 181, 194, 2164, 2825, 2874, 3048, 3564, 3586, 3893, 3963, 4126, 4396, 4595, 4751, 5110, 5125], 'kynurenine': [20, 36, 68, 182, 198, 230, 3595, 3628, 3657, 3749, 4752], 'pathway': [21, 37, 69, 183, 199, 231, 2550, 2572, 2644, 2969, 3589, 3629, 3658, 3919, 4443, 4753], 'main': [24, 186, 3600], 'route': [25, 187, 3601], 'for': [26, 66, 156, 188, 228, 318, 576, 607, 639, 886, 944, 1038, 1097, 1113, 1616, 1677, 1705, 1721, 1765, 1791, 1815, 1839, 1940, 1960, 1975, 2084, 2094, 2108, 2118, 2137, 2233, 2300, 2307, 2334, 2337, 2348, 2625, 3050, 3080, 3526, 3573, 3602, 3665, 3762, 3913, 4132, 4155, 4505, 4705, 4821, 5122, 5129, 5137, 5156, 5165], 'non-protein': [28, 190, 3603], 'metabolism': [29, 191, 3604, 3967], 'tryptophan.': [31, 193, 3610], 'intermediates': [33, 195, 984, 2347, 2645, 5100, 5132], 'are': [38, 46, 200, 208, 481, 538, 570, 1109, 2428, 2655, 3907, 4139, 4181, 4468, 4479, 4494, 4544, 4676], 'present': [39, 201, 5134], 'at': [40, 202, 1320, 1613, 1702, 1718, 1787, 1794, 1811, 1836, 1978, 2255, 2267, 2291, 2297, 2781, 3854, 4339], 'micromolar': [41, 203, 4030], 'concentrations': [42, 204, 2317, 4127, 4380], 'blood': [44, 147, 206, 309, 2239, 2250, 3461, 3502, 4382, 4435], 'regulated': [47, 209], 'by': [48, 106, 210, 268, 483, 1223, 1247, 1331, 1628, 1785, 1807, 1879, 1970, 2635, 2640, 2857, 3029, 3095, 3216, 3466, 3626, 3849, 4032, 4186, 4446, 4481, 4663, 4689, 4788], 'inflammatory': [49, 211, 3923, 4033, 4351, 4549, 4600], 'stimuli.': [50, 212], 'Here': [51, 213, 1216], 'we': [52, 134, 214, 296, 1217, 2340, 3448, 3511, 4809], 'show': [53, 135, 215, 297], 'that': [54, 121, 136, 216, 283, 298, 436, 2427, 2654, 2747, 2918, 2961, 2978, 3092, 3146, 3222, 3616, 4170, 4367, 4378, 4414, 4784, 5098], 'GPR35,': [55, 217, 2401, 2616, 2629, 2768, 2805, 3447, 4160, 4801], 'a': [56, 64, 83, 218, 226, 245, 484, 548, 979, 1036, 1220, 1637, 1643, 1744, 2003, 2009, 2064, 2135, 2256, 2342, 2405, 2505, 2520, 2745, 2796, 3100, 3162, 3209, 3490, 3524, 3555, 3758, 3828, 3969, 4000, 4171, 4349, 4365, 4392, 4718, 5119], 'previously': [57, 219, 5101], 'orphan': [58, 220, 536, 991, 1043, 2338], 'G': [59, 92, 221, 254, 324, 333, 364, 1483, 1664, 2412, 2516, 2772, 2818, 2867, 2958, 3546, 4189], 'protein-coupled': [60, 222, 325, 334, 365], 'receptor,': [61, 223], 'functions': [62, 155, 224, 317, 2579, 3439, 4709, 5112], 'as': [63, 225, 1035, 1041, 1105, 1165, 1626, 2134, 2190, 2314, 2649, 3523, 3569, 3661, 3851, 3926, 4604, 4659, 4717, 4817, 5118], 'receptor': [65, 227, 1177, 3106, 3212, 3765, 3915, 4661], 'intermediate': [70, 232, 3517, 3746, 3832], 'kynurenic': [71, 137, 157, 233, 299, 319, 995, 1162, 1225, 1874, 1971, 2581, 2605, 2636, 2700, 2716, 2858, 3043, 3051, 3096, 3441, 3453, 3480, 3514, 3567, 3751, 3897, 3978, 4129, 4144, 4321, 4362, 4408, 4427, 4453, 4477, 4542, 4626, 4664, 4690, 4711, 4785, 4815], 'acid.': [72, 234, 1875, 4712], 'Kynurenic': [73, 94, 110, 235, 256, 272, 1115, 2279, 2502, 2538, 2553, 2928, 3015, 3192, 3464, 3528, 3548, 3997], 'elicits': [75, 237], 'calcium': [76, 238, 1624, 2441, 2894], 'mobilization': [77, 239, 2442, 2895], 'inositol': [79, 241, 2934, 2948, 3087, 3536], 'phosphate': [80, 242, 2935, 2949, 3088, 3537], 'production': [81, 243], 'GPR35-dependent': [84, 246, 3556], 'manner': [85, 247, 3492, 3557], 'presence': [88, 250, 1872, 3542, 3781], 'Gqi/o': [90, 252, 2826, 2877, 2980, 3081, 3544], 'chimeric': [91, 253, 2410, 2771, 3545, 4188], 'proteins.': [93, 255, 500, 3547], 'stimulates': [96, 258], '[35S]guanosine': [97, 259], '5′-O-(3-thiotriphosphate)': [98, 260], 'binding': [99, 261, 3059, 3553], 'GPR35-expressing': [101, 263], 'cells,': [102, 264, 3025, 3304, 3312, 3316, 3322], 'effect': [104, 266, 3027, 3451, 4451], 'abolished': [105, 267, 3028], 'pertussis': [107, 269, 1760, 3032, 3101], 'toxin': [108, 270, 1761, 3033], 'treatment.': [109, 271], 'also': [112, 274, 1575, 2555, 3550, 5161], 'induces': [113, 275], 'internalization': [115, 277, 3107, 3561], 'GPR35.': [117, 279, 1039, 1235, 1913, 3527, 3563, 4822], 'Expression': [118, 280, 1081, 3214], 'analysis': [119, 281, 1082, 1349, 2994, 3215], 'indicates': [120, 282, 2741], 'GPR35': [122, 160, 284, 322, 1073, 1087, 1098, 1244, 1338, 1391, 1465, 1659, 1967, 2055, 2086, 2110, 2125, 2152, 2514, 2562, 2612, 2631, 2711, 2730, 2814, 2856, 2919, 2942, 2962, 2984, 2999, 3007, 3056, 3093, 3144, 3147, 3199, 3225, 3228, 3247, 3270, 3295, 3305, 3365, 3397, 3531, 3574, 3900, 4133, 4400, 4482, 4484, 4598, 4618, 4672, 4698, 4713], 'predominantly': [124, 286, 3230], 'detected': [125, 287, 2952, 3252, 3273, 3307, 3348, 3422], 'immune': [127, 289, 1089, 3233, 3303, 3444, 4358, 4402, 4462, 4757, 4790], 'cells': [128, 290, 1279, 1300, 1328, 1334, 1381, 1581, 1651, 1680, 1717, 1754, 1897, 1917, 1951, 1984, 2241, 2252, 2311, 2393, 2511, 2535, 2765, 2807, 2938, 3002, 3012, 3038, 3137, 3404, 3445, 3475, 4403, 4500, 4503, 4758, 4791, 4799], 'gastrointestinal': [131, 293, 1091, 3235, 3278, 3353, 4509, 4612, 4798], 'tract.': [132, 294], 'Furthermore,': [133, 295, 2715, 4311], 'inhibits': [139, 301], 'lipopolysaccharide-induced': [140, 302], 'tumor': [141, 303, 356, 387], 'necrosis': [142, 304, 357, 388], 'factor-α': [143, 305], 'secretion': [144, 306, 3457, 3472, 3488, 4432], 'peripheral': [146, 308, 1229, 2238, 3255, 3460, 3501, 4434], 'mononuclear': [148, 310, 2240, 2251, 3462], 'cells.': [149, 311, 2927, 3463], 'Our': [150, 312], 'results': [151, 313, 2916, 2973, 3283, 3496], 'suggest': [152, 314, 2917, 3091, 4413], 'unexpected': [153, 315], 'signaling': [154, 316, 2434, 2802, 4185, 5111], 'through': [159, 321, 1232, 1882, 2922, 2966], 'activation.': [161, 323, 4360, 4483, 4699], 'receptors': [326, 444, 537, 3857, 4180, 5128], '(GPCRs)': [327], '3The': [328], 'abbreviations': [329, 360], 'used': [330, 361, 1713, 2133, 2313], 'are:': [331, 362], 'GPCR,': [332, 363], 'receptor;': [335, 366], 'GTPγS,': [336, 367], 'guanosine': [337, 368], '5′-O-(3-thiotriphosphate);': [338, 369], '[Ca2+]i,': [339, 370], 'intracellular': [340, 371, 2356, 3188, 3205], 'Ca2+': [341, 372, 2357, 2433], 'concentration;': [342, 346, 373, 377], 'EC50,': [343, 374], 'medium': [344, 375, 1307, 2521], 'effective': [345, 376, 2522, 4337], 'NMDA,': [347, 378], 'N-methyl-d-aspartate;': [348, 379], 'CHO,': [349, 380], 'Chinese': [350, 381, 1275], 'hamster': [351, 382, 1276], 'ovary;': [352, 383], 'LPS,': [353, 384], 'lipopolysaccharides;': [354, 385], 'TNFα,': [355, 386], 'factor': [358, 389], 'α.3The': [359], 'α.': [390], 'constitute': [391], 'one': [392, 997], 'largest': [395], 'gene': [396], 'families': [397], 'yet': [398], 'identified': [399, 568, 994, 1219, 3513, 4811, 5127], '(1Fredriksson': [400, 521], 'R.': [401, 415, 522, 811, 827, 903, 913, 1054, 1145, 2674, 3685, 3710, 3859, 4206, 4216, 4256, 4292, 5025, 5041], 'Schioth': [402, 420, 523], 'H.B.': [403, 421, 524], 'Mol.': [404, 422, 525], 'Pharmacol.': [405, 423, 526, 1148, 1561, 2489, 3688, 3862], '2005;': [406, 527, 875, 927, 2688, 3724, 4230, 4529, 5089], '67:': [407, 528], '1414-1425Crossref': [408, 529], 'PubMed': [409, 427, 453, 470, 530, 600, 631, 695, 755, 797, 850, 878, 935, 971, 1068, 1139, 1152, 1189, 1211, 1425, 1453, 1510, 1529, 1549, 1569, 2203, 2387, 2457, 2477, 2497, 2594, 2691, 2843, 2910, 3131, 3180, 3641, 3679, 3692, 3727, 3739, 3799, 3821, 3866, 3888, 3943, 3958, 3992, 4020, 4063, 4078, 4098, 4121, 4238, 4270, 4306, 4532, 4567, 4590, 4651, 4746, 4776, 4850, 4909, 4969, 5011, 5064, 5092], 'Scopus': [410, 428, 454, 471, 531, 601, 632, 696, 756, 798, 851, 879, 936, 972, 1018, 1069, 1140, 1153, 1190, 1212, 1426, 1454, 1511, 1530, 1550, 1570, 2204, 2388, 2458, 2478, 2498, 2595, 2692, 2844, 2911, 3181, 3642, 3680, 3693, 3728, 3740, 3800, 3822, 3867, 3889, 3944, 3959, 3993, 4064, 4079, 4099, 4122, 4239, 4271, 4307, 4533, 4568, 4591, 4652, 4747, 4777, 4851, 4910, 4970, 5012, 5065, 5093], '(454)': [411, 532], 'Google': [412, 430, 456, 473, 533, 603, 634, 698, 758, 800, 853, 881, 938, 974, 1020, 1033, 1071, 1142, 1155, 1192, 1214, 1428, 1456, 1513, 1532, 1552, 1572, 2206, 2390, 2460, 2480, 2500, 2597, 2694, 2846, 2913, 3132, 3183, 3644, 3682, 3695, 3730, 3742, 3802, 3824, 3869, 3891, 3946, 3961, 3995, 4021, 4066, 4081, 4101, 4124, 4241, 4273, 4309, 4535, 4570, 4593, 4654, 4749, 4779, 4853, 4912, 4972, 5014, 5067, 5095], 'Scholar,': [413, 457, 699, 759, 801, 854, 1021, 1143, 1193, 1429, 1514, 1533, 1553, 2461, 2481, 3683, 3696, 3731, 3803, 3870, 3947, 4067, 4082, 4102, 4242, 4274, 4571, 4854, 4913, 4973, 5015, 5068], '2Fredriksson': [414], 'Lagerstrom': [416], 'M.C.': [417], 'Lundin': [418], 'L.G.': [419, 1131, 1181, 1203, 2586, 3633, 3671, 3880, 3984, 4088, 4112, 4557, 4581, 4643, 4768], '2003;': [424, 687, 747, 789, 847, 1208, 2200, 3885, 4095, 4262, 4298, 4564, 4648, 4901, 4961, 5003, 5061], '63:': [425], '1256-1272Crossref': [426], '(2086)': [429], 'Scholar).': [431, 474, 534, 975, 1156, 1215, 1457, 2207, 2391, 2501, 2695, 2914, 3133, 3645, 3743, 3892, 3962, 3996, 4125, 4310, 4536, 4594, 4655, 4750, 4780], 'It': [432, 4678, 4781], 'has': [433, 1117, 3659, 3753, 3999, 4619, 4714], 'been': [434, 563, 1118, 1169, 2421, 3754, 4667, 4715], 'estimated': [435], 'half': [437], 'all': [439], 'modern': [440], 'drugs': [441], 'target': [442, 3664], 'these': [443, 1100, 3374, 3474, 4674, 4806, 5114, 5130], '(3Flower': [445], 'D.R.': [446], 'Biochim.': [447], 'Biophys.': [448, 965], 'Acta.': [449], '1999;': [450, 1546, 2474, 2840], '1422:': [451], '207-234Crossref': [452], '(218)': [455], '4Wise': [458], 'A.': [459, 741, 856, 1010, 1023, 1052, 1433, 1506, 2367, 3813, 4012, 4057, 4108, 4577, 4955, 5070], 'Gearing': [460], 'K.': [461, 815, 858, 897, 905, 963, 1609, 4041, 4069, 4200, 4208, 4732, 4738, 4740, 5029, 5072], 'Rees': [462, 1446, 1558, 2380, 2486], 'S.': [463, 681, 735, 766, 774, 813, 829, 841, 862, 870, 919, 1447, 1505, 1559, 2381, 2487, 2666, 3702, 4222, 4248, 4280, 4726, 4895, 4949, 4980, 4988, 5027, 5043, 5055, 5076, 5084], 'Drug': [464, 1134, 1184, 2589, 3636, 3674, 3987, 4771], 'Discov.': [465, 1135, 1185, 2590, 3637, 3675, 3988, 4772], 'Today.': [466, 4528], '2002;': [467, 968, 1136, 1186, 2591, 3638, 3676, 3818, 3989, 4118, 4587, 4773], '7:': [468], '235-246Crossref': [469], '(329)': [472], 'GPCRs': [475, 512, 561, 2426, 2885], 'contain': [476], 'seven': [477], 'transmembrane': [478], 'domains': [479], 'activated': [482, 2556, 2634, 3530, 3921, 4445, 4755, 4789], 'wide': [485], 'variety': [486], 'ligands,': [488], 'including': [489, 573, 2724, 3355], 'light,': [490], 'ions,': [491], 'metabolic': [492, 571, 2549, 2643, 3521, 3588, 3918, 4442, 5099, 5131], 'intermediates,': [493, 572, 2699], 'acids,': [495], 'nucleotides,': [496], 'lipids,': [497], 'peptides,': [498], 'In': [501, 553, 2122, 3160, 3245, 3265, 3329, 3378, 3507, 4425], 'addition': [502], 'to': [503, 518, 540, 985, 989, 1120, 1171, 1714, 1730, 1797, 2008, 2056, 2157, 2214, 2351, 2423, 2432, 2440, 2576, 2580, 2704, 2881, 2886, 2893, 3042, 3065, 3099, 3154, 3203, 3291, 3484, 3591, 3756, 4029, 4183, 4371, 4390, 4470, 4630, 4680, 4803, 5103], '∼250': [504], 'characterized': [505, 1006], 'receptors,': [506], '∼120': [507], 'human': [508, 1250, 1337, 2018, 2085, 2400, 2513, 2615, 2813, 3006, 3055, 3224, 3459], 'genes': [509], 'encode': [510], 'non-olfactory': [511], 'whose': [513], 'ligands': [514, 569, 1112, 2336], 'function': [516], 'remain': [517], 'be': [519, 2705, 3757, 4385, 4615, 4681, 4703, 5104], 'determined': [520, 2319], 'These': [535, 2915, 2972, 3074], 'expected': [539, 3187], 'play': [541, 1121, 4419], 'roles': [543, 1096, 1124, 3648, 4421, 4670], 'regulation': [546, 2660], 'diversity': [549], 'physiological': [551, 1095, 1123], 'functions.': [552, 3585], 'past': [555], 'decade': [556], 'increasing': [558], 'number': [559], 'have': [562, 977, 1168, 1218, 2420, 2577, 3512, 4666, 4810], 'de-orphanized.': [564], 'Many': [565], 'succinate': [574], '(ligand': [575, 606, 885, 943], 'GPR91)': [577], '(5He': [578, 609, 1403, 4828], 'W.': [579, 610, 1404, 4829], 'Miao': [580, 611, 1405, 4830], 'F.J.': [581, 612, 1406, 4831], 'Lin': [582, 613, 1407, 4832], 'D.C.': [583, 614, 1408, 4833], 'Schwandner': [584, 615, 1409, 4834], 'R.T.': [585, 616, 1410, 4835], 'Wang': [586, 617, 1411, 4836], 'Z.': [587, 618, 1012, 1412, 1518, 2446, 2899, 3171, 4837], 'Gao': [588, 619, 1413, 3168, 4838], 'J.': [589, 620, 684, 744, 781, 786, 891, 915, 924, 1024, 1414, 1431, 1608, 2365, 3122, 3794, 3816, 3939, 4015, 4053, 4115, 4194, 4218, 4227, 4246, 4259, 4282, 4295, 4584, 4839, 4898, 4958, 4995, 5000], 'Chen': [590, 621, 912, 1415, 4215, 4245, 4281, 4840], 'J.L.': [591, 622, 646, 1416, 4841, 4860], 'Tian': [592, 623, 1417, 4842], 'H.': [593, 624, 821, 823, 831, 833, 955, 961, 1418, 2670, 3706, 4290, 4728, 4734, 4843, 5035, 5037, 5045, 5047], 'Ling': [594, 625, 1419, 4844], 'L.': [595, 626, 709, 909, 1420, 2686, 3722, 3733, 4212, 4845, 4923], 'Nature.': [596, 627, 846, 1421, 1525, 2453, 2906, 4846, 5060], '2004;': [597, 628, 1149, 1422, 3689, 3736, 3863, 3955, 4743, 4847], '429:': [598, 629, 1423, 4848], '188-193Crossref': [599, 630, 1424, 4849], '(614)': [602, 633, 1427, 4852], 'Scholar),': [604, 635, 882, 939, 1034, 1072, 2598, 2847, 4022], 'α-ketoglutarate': [605], 'GPR99)': [608], 'fatty': [636], 'acids': [637, 942], '(ligands': [638], 'GPR40/41/43/120)': [640], '(6Briscoe': [641], 'C.P.': [642, 4856], 'Tadayyon': [643, 4857], 'M.': [644, 783, 785, 807, 809, 817, 825, 845, 866, 899, 1441, 1445, 2375, 2379, 2662, 3119, 3173, 3698, 3787, 3793, 3811, 4049, 4202, 4858, 4997, 4999, 5021, 5023, 5031, 5039, 5059, 5080], 'Andrews': [645, 4859], 'Benson': [647, 4861], 'W.G.': [648, 4862], 'Chambers': [649, 4863], 'J.K.': [650, 4864], 'Eilert': [651, 706, 4865, 4920], 'M.M.': [652, 707, 4866, 4921], 'Ellis': [653, 4867], 'C.': [654, 764, 911, 3807, 4214, 4244, 4252, 4276, 4286, 4526, 4868, 4978], 'Elshourbagy': [655, 4869], 'N.A.': [656, 4870], 'Goetz': [657, 4871], 'A.S.': [658, 4872], 'Minnick': [659, 4873], 'D.T.': [660, 4874], 'Murdock': [661, 726, 4875, 4940], 'P.R.': [662, 727, 4876, 4941], 'Sauls': [663, 4877], 'Jr.,': [664, 1060, 4878], 'H.R.': [665, 1524, 2452, 2905, 4520, 4879], 'Shabon': [666, 4880], 'U.': [667, 1504, 4881], 'Spinage': [668, 4882], 'L.D.': [669, 4883], 'Strum': [670, 722, 4884, 4936], 'J.C.': [671, 723, 729, 4885, 4937, 4943], 'Szekeres': [672, 732, 4886, 4946], 'P.G.': [673, 733, 4887, 4947], 'Tan': [674, 4888], 'K.B.': [675, 4889], 'Way': [676, 4890], 'J.M.': [677, 4891], 'Ignar': [678, 736, 4892, 4950], 'D.M.': [679, 737, 4893, 4951], 'Wilson': [680, 734, 4894, 4948], 'Muir': [682, 712, 4896, 4926], 'A.I.': [683, 713, 4897, 4927], 'Biol.': [685, 745, 787, 925, 1025, 3123, 4094, 4228, 4260, 4296, 4563, 4899, 4959, 5001], 'Chem.': [686, 746, 788, 926, 1014, 1026, 1205, 3124, 3882, 4229, 4261, 4297, 4645, 4900, 4960, 5002], '278:': [688, 748, 790, 3178, 4263, 4299, 4902, 4962, 5004], '11303-11311Abstract': [689, 4903], 'Full': [690, 692, 750, 752, 792, 794, 930, 932, 1030, 1566, 2494, 3128, 4233, 4235, 4265, 4267, 4301, 4303, 4904, 4906, 4964, 4966, 5006, 5008], 'Text': [691, 693, 751, 753, 793, 795, 931, 933, 1031, 1567, 2495, 3129, 4234, 4236, 4266, 4268, 4302, 4304, 4905, 4907, 4965, 4967, 5007, 5009], 'PDF': [694, 754, 796, 934, 1032, 1568, 2496, 3130, 4237, 4269, 4305, 4908, 4968, 5010], '(875)': [697, 4911], '7Brown': [700, 4914], 'A.J.': [701, 4915], 'Goldsworthy': [702, 4916], 'S.M.': [703, 739, 4917, 4953], 'Barnes': [704, 4918], 'A.A.': [705, 4919], 'Tcheang': [708, 4922], 'Daniels': [710, 4924], 'D.': [711, 917, 1522, 2450, 2903, 4220, 4925], 'Wigglesworth': [714, 4928], 'M.J.': [715, 4010, 4055, 4929], 'Kinghorn': [716, 4930], 'I.': [717, 4931], 'Fraser': [718, 1436, 2370, 4932], 'N.J.': [719, 4933], 'Pike': [720, 4934], 'N.B.': [721, 4935], 'Steplewski': [724, 4938], 'K.M.': [725, 4939], 'Holder': [728, 4942], 'Marshall': [730, 1434, 1556, 2368, 2484, 4944], 'F.H.': [731, 4945], 'Foord': [738, 4952], 'Wise': [740, 4954], 'Dowell': [742, 4956], 'S.J.': [743, 4957], '11312-11319Abstract': [749, 4963], '(1473)': [757, 4971], '8Le': [760, 4974], 'Poul': [761, 4975], 'E.': [762, 957, 1439, 2373, 4278, 4976], 'Loison': [763, 4977], 'Struyf': [765, 4979], 'Springael': [767, 4981], 'J.Y.': [768, 4982], 'Lannoy': [769, 4983], 'V.': [770, 776, 4984, 4990], 'Decobecq': [771, 4985], 'M.E.': [772, 4986], 'Brezillon': [773, 4987], 'Dupriez': [775, 4989], 'Vassart': [777, 4991], 'G.': [778, 872, 1443, 1555, 2377, 2483, 3791, 4992, 5086], 'Van': [779, 4993], 'Damme': [780, 4994], 'Parmentier': [782, 4996], 'Detheux': [784, 4998], '25481-25489Abstract': [791, 5005], '(1032)': [799, 5013], '9Itoh': [802, 5016], 'Y.': [803, 805, 819, 837, 843, 868, 949, 953, 4736, 5017, 5019, 5033, 5051, 5057, 5082], 'Kawamata': [804, 5018], 'Harada': [806, 5020], 'Kobayashi': [808, 5022], 'Fujii': [810, 5024], 'Fukusumi': [812, 5026], 'Ogi': [814, 5028], 'Hosoya': [816, 5030], 'Tanaka': [818, 822, 962, 5032, 5036], 'Uejima': [820, 5034], 'Maruyama': [824, 5038], 'Satoh': [826, 5040], 'Okubo': [828, 5042], 'Kizawa': [830, 5044], 'Komatsu': [832, 5046], 'Matsumura': [834, 5048], 'F.': [835, 1435, 1557, 2369, 2485, 5049], 'Noguchi': [836, 5050], 'Shinohara': [838, 5052], 'T.': [839, 860, 864, 947, 951, 959, 1050, 2195, 3789, 4730, 5053, 5074, 5078], 'Hinuma': [840, 5054], 'Fujisawa': [842, 5056], 'Fujino': [844, 5058], '422:': [848, 5062], '173-176Crossref': [849, 5063], '(1213)': [852, 5066], '10Hirasawa': [855, 5069], 'Tsumaya': [857, 5071], 'Awaji': [859, 5073], 'Katsuma': [861, 5075], 'Adachi': [863, 5077], 'Yamada': [865, 5079], 'Sugimoto': [867, 5081], 'Miyazaki': [869, 5083], 'Tsujimoto': [871, 5085], 'Nat.': [873, 1132, 1182, 2587, 3634, 3672, 3734, 3952, 3985, 4769, 5087], 'Med.': [874, 1207, 3884, 4093, 4562, 4647, 5088], '11:': [876, 5090], '90-94Crossref': [877, 5091], '(1115)': [880, 5094], 'ketone': [883], 'body': [884], 'HM74a)': [887], '(11Taggart': [888, 4191], 'A.K.': [889, 4192], 'Kero': [890, 4193], 'Gan': [892, 4195], 'X.': [893, 3169, 4196], 'Cai': [894, 4197], 'T.Q.': [895, 4198], 'Cheng': [896, 1053, 4199], 'Ippolito': [898, 4201], 'Ren': [900, 4203], 'N.': [901, 1437, 2371, 4204, 4254, 4288], 'Kaplan': [902, 4205], 'Wu': [904, 906, 4207, 4209], 'T.J.': [907, 4210], 'Jin': [908, 4211], 'Liaw': [910, 4213], 'Richman': [914, 4217], 'Connolly': [916, 4219], 'Offermanns': [918, 4221], 'Wright': [920, 4223], 'S.D.': [921, 1537, 2465, 2831, 4224], 'Waters': [922, 4225], 'M.G.': [923, 4226], '280:': [928, 4231], '26649-26652Abstract': [929, 4232], '(404)': [937, 4240], 'bile': [941], 'BG37)': [945], '(12Maruyama': [946], 'Miyamoto': [948], 'Nakamura': [950, 958], 'Tamai': [952], 'Okada': [954], 'Sugiyama': [956], 'Itadani': [960], 'Biochem.': [964, 1449, 1545, 2383, 2473, 2839], 'Res.': [966, 4525], 'Commun.': [967], '298:': [969], '714-719Crossref': [970], '(688)': [973], 'We': [976, 993, 5142, 5160], 'built': [978], 'library': [980], '∼300': [982, 2345, 2697], 'biochemical': [983, 2346, 2698], 'test': [986], 'their': [987, 2349, 2437], 'ability': [988, 2350], 'activate': [990, 2720], 'GPCRs.': [992, 1114], 'acid,': [996, 1163, 2566, 2859, 3515, 3837], 'first': [1000], 'metabolites': [1001, 1103, 2735], 'isolated': [1004], 'mammals': [1008], '(13Ellinger': [1009], "Hoppe-Seyler's": [1011], 'Physiol.': [1013], '1904;': [1015], '43:': [1016], '325-337Crossref': [1017], '(18)': [1019], '14Homer': [1022], '1914;': [1027], '17:': [1028, 1564, 2201, 2492], '509-518Abstract': [1029], 'ligand': [1037, 1982, 3525, 3572, 4174, 4820], 'Cloned': [1040], 'GPCR': [1044, 3112], '1998': [1046], "(15O'Dowd": [1047], 'B.F.': [1048], 'Nguyen': [1049], 'Marchese': [1051], 'Lynch': [1055, 3790], 'K.R.': [1056], 'Heng': [1057], 'H.H.': [1058], 'Kolakowski': [1059], 'L.F.': [1061], 'George': [1062], 'S.R.': [1063, 4086, 4110, 4555, 4579], 'Genomics.': [1064], '1998;': [1065], '47:': [1066], '310-313Crossref': [1067], '(248)': [1070], 'shares': [1074], '30%': [1075], 'identity': [1078], 'with': [1079, 1161, 1323, 1335, 1359, 1384, 1393, 1602, 1621, 1642, 1658, 1673, 1683, 1757, 1907, 1920, 1924, 1934, 1954, 1987, 1992, 1997, 2002, 2027, 2231, 2320, 2397, 2425, 2519, 2617, 2767, 2810, 2941, 2975, 3031, 3077, 3237, 3317, 3339, 3411, 3909, 4548, 4826], 'GPR55.': [1080], 'revealed': [1083, 3145, 3221], 'prominent': [1084], 'expression': [1085, 1271, 2997, 3239, 3271, 3319, 3413, 4398, 4621], 'tissues,': [1092, 3236], 'suggesting': [1093, 2960], 'potential': [1094, 3437, 4719], 'organs.': [1101], 'Tryptophan': [1102, 3917], 'such': [1104, 1164, 2648, 3925, 4603, 4658], 'serotonin': [1106], 'melatonin': [1108], 'well': [1110], 'known': [1111, 4629], 'reported': [1119, 2422, 2880, 3902, 4545, 4716], 'brain': [1127, 4694], '(16Stone': [1128, 1178, 2583, 3630, 3668, 3981, 4765], 'T.W.': [1129, 1179, 1195, 2584, 3631, 3669, 3872, 3982, 4090, 4114, 4258, 4294, 4559, 4583, 4635, 4766], 'Darlington': [1130, 1180, 1202, 2585, 3632, 3670, 3879, 3983, 4087, 4111, 4556, 4580, 4642, 4767], 'Rev.': [1133, 1183, 2588, 3635, 3673, 3953, 3986, 4770], '1:': [1137, 1187, 2592, 3639, 3677, 3990, 4774], '609-620Crossref': [1138, 1188, 2593, 3640, 3678, 3991, 4775], '(617)': [1141, 1191, 2596, 3643, 3681, 3994, 4778], '17Schwarcz': [1144, 3684], 'Curr.': [1146, 3686, 3860], 'Opin.': [1147, 3687, 3861], '4:': [1150, 3690, 3864, 3956], '12-17Crossref': [1151, 3691, 3865], '(213)': [1154, 3694, 3868], 'Most': [1157], 'biological': [1158, 3438, 3584, 4394, 4708], 'effects': [1159, 4475, 4633, 4687], 'associated': [1160], 'neuroprotective': [1166, 3829, 4632], 'activities,': [1167], 'attributed': [1170], 'its': [1172, 3647, 4024], 'antagonism': [1173], 'on': [1174, 1353, 1743, 1891, 1900, 1943, 2039, 2610, 2614, 3000, 3443, 3455, 3899], 'N-methyl-d-aspartate': [1175], '(NMDA)': [1176], '18Stone': [1194, 3871], 'Mackay': [1196, 3873, 4636], 'G.M.': [1197, 1541, 2469, 2835, 3874, 4637], 'Forrest': [1198, 3875, 4638], 'C.M.': [1199, 3876, 4084, 4104, 4553, 4573, 4639], 'Clark': [1200, 3877, 4640], 'C.J.': [1201, 3878, 4641], 'Clin.': [1204, 3881, 4644], 'Lab.': [1206, 3883, 4646], '41:': [1209, 3886, 4649], '852-859Crossref': [1210, 3887, 4650], '(130)': [1213, 3890, 4653], 'novel': [1221, 5135], 'which': [1224, 2419, 4493], 'may': [1227, 2920, 2963, 4334, 4418], 'regulate': [1228], 'cellular': [1230, 1801], 'responses': [1231, 4034], 'activation': [1233, 2854, 2985, 3053, 3094, 3113, 3901, 3964, 4134], 'Cloning': [1236], 'Cell': [1238], 'Culture—Full-length': [1239], 'human,': [1240, 1909, 3140, 4156], 'mouse,': [1241, 1910, 3141, 4157], 'rat': [1243, 1257, 1912, 2559, 2628, 3143, 4159], 'were': [1245, 1266, 1280, 1301, 1318, 1329, 1376, 1382, 1473, 1574, 1582, 1656, 1681, 1728, 1755, 1771, 1805, 1877, 1889, 1898, 1918, 1952, 1985, 2000, 2025, 2061, 2072, 2087, 2111, 2155, 2212, 2229, 2245, 2253, 2265, 2295, 2312, 2318, 2394, 2761, 2808, 3152, 3229, 3272, 3284, 3347, 3421, 3497, 4149], 'cloned': [1246, 2127], 'PCR': [1248, 2048, 3220], 'from': [1249, 1377, 2017, 2247, 2757, 2763, 3023, 3070, 3149, 3200, 4327, 4697], 'universal': [1251], 'cDNA,': [1252, 1255], 'mouse': [1253, 2020, 2109, 2160, 2557, 2626, 3227, 3334], 'spleen': [1254, 1258, 3276, 3351], 'cDNA': [1259, 2126], '(BD': [1260, 1355, 2022], 'Bioscience': [1261], 'Clontech),': [1262], 'respectively.': [1263, 2630], 'Sequence-confirmed': [1264], 'cDNAs': [1265], 'inserted': [1267], 'into': [1268, 3620], 'mammalian': [1270], 'vector': [1272, 1387, 1389, 2130, 3010], 'pcDNA3.1': [1273], '(Invitrogen).': [1274, 1346], 'ovary': [1277], '(CHO)': [1278], 'maintained': [1281], "Dulbecco's": [1283, 1304], 'modified': [1284, 1305], "Eagle's": [1285, 1306], 'medium/nutrient': [1286], 'mixture': [1287, 2406], 'F-12': [1288], '(Cellgro)': [1289], 'containing': [1290, 1308, 1591, 1857], '10%': [1291, 1309, 2181], 'fetal': [1292, 1310], 'bovine': [1293, 1311, 1593, 1699, 1852], 'serum': [1294, 1312, 1594, 1700, 1853, 1927, 4312], 'antibiotics.': [1296, 1314], 'HeLa': [1297], 'HEK293': [1299, 2937], 'grown': [1302], 'All': [1315, 1373], 'cell': [1316, 1732, 2659, 4359], 'lines': [1317], 'cultured': [1319], '37': [1321, 1703, 1979, 2298], '°C': [1322, 1704, 1720, 1796, 2299], '5%': [1324, 1925], 'CO2.': [1325], 'CHO-GPR35': [1326, 3024], 'stable': [1327, 1753], 'generated': [1330, 2762], 'transfecting': [1332], 'CHO': [1333, 2392, 2764, 2806, 2926, 3001], 'N-terminal-FLAG-tagged': [1336, 1908, 3005, 3139], 'subsequently': [1340], 'selected': [1341], '1': [1343, 1603, 1617, 1706, 1781, 1840, 1941, 2283], 'mg/ml': [1344, 2188], 'G418': [1345], 'Flow': [1347, 2992], 'cytometry': [1348, 2993], 'was': [1350, 1634, 1712, 1741, 1834, 1968, 2037, 2132, 2281, 2305, 2531, 2632, 2702, 2879, 2951, 3061, 3250, 3306, 3398, 3482], 'carried': [1351], 'out': [1352], 'FACSCalibur': [1354], 'Biosciences)': [1356, 1676, 1727], 'after': [1357, 1579, 2225, 4323, 4354], 'staining': [1358, 1996, 3135], 'anti-FLAG': [1360, 1935], 'M2': [1361], 'monoclonal': [1362, 1937], 'antibody': [1363, 1371, 1938, 1959], '(Sigma)': [1364, 1939], 'goat': [1366, 1926, 1955], 'anti-mouse': [1367, 1956], 'IgG-fluorescein': [1368], 'isothiocyanate': [1369], 'secondary': [1370, 1958], '(Caltag).': [1372], 'compounds': [1374, 1684], 'tested': [1375, 2341, 2821, 3449], 'Sigma.': [1378], 'Aequorin': [1379], 'Assay—CHO': [1380], 'transfected': [1383, 1657, 1906, 2396, 2766, 2809, 2940], 'either': [1385], 'empty': [1386], 'or': [1388, 1667, 1758, 1871, 1911, 2019, 2150, 2409, 3142, 3931, 4313, 4357], 'expressing': [1390, 1481, 2512, 3004, 3138, 3446, 4800], 'together': [1392, 3076, 4825], 'aequorin': [1395, 1470, 1632, 2362, 2402, 2738, 2776, 2823, 2988, 3072, 3085, 3533, 4163], 'reporter': [1396, 1471], 'plasmid': [1397], 'using': [1398, 2046, 2063, 2074, 2141, 2360, 3286, 3333, 3499], 'Lipofectamine': [1399], '2000': [1400], 'reagent': [1401], '(Invitrogen)': [1402, 2131], '19Stables': [1430], 'Green': [1432, 2366], 'Knight': [1438, 2372], 'Sautel': [1440, 2374], 'Milligan': [1442, 2376], 'Lee': [1444, 2378, 2675, 3711], 'Anal.': [1448, 1544, 2382, 2472, 2838], '1997;': [1450, 2384, 3177], '252:': [1451, 2385], '115-126Crossref': [1452, 2386], '(179)': [1455, 2389], 'For': [1458, 1914], 'each': [1459], '10-cm': [1460], 'dish,': [1461], '5': [1462, 1467, 1827, 1848], 'μg': [1463, 1468, 1478, 1831], 'plasmids': [1472, 1480, 2398, 2774, 2811], 'used.': [1474], 'When': [1475], 'indicated,': [1476], '2': [1477, 2259, 2268], 'small': [1482, 1663, 2411, 2817, 3258], 'proteins': [1484, 1665, 2413, 2819, 3148, 4190], '(Gα16,': [1485, 2414], 'Gqo5,': [1486, 1668, 2416], 'Gqi9,': [1487, 2850], 'and/or': [1488], 'Gqs5)': [1489], '(20Amatruda': [1490], 'T.T.': [1491], 'II': [1492], 'I': [1493, 2029], 'Steele': [1494], 'D.A.': [1495], 'Slepak': [1496], 'V.Z.': [1497], 'Simon': [1498], 'M.I.': [1499], 'Proc.': [1500], 'Natl.': [1501], 'Acad.': [1502], 'Sci.': [1503, 1562, 2490, 4117, 4586, 4742], '1991;': [1507, 3940], '88:': [1508], '5587-5591Crossref': [1509], '(238)': [1512], '21Conklin': [1515], 'B.R.': [1516, 1543, 2444, 2471, 2837, 2897], 'Farfel': [1517, 2445, 2898], 'Lustig': [1519, 2447, 2900], 'K.D.': [1520, 2448, 2901], 'Julius': [1521, 2449, 2902], 'Bourne': [1523, 2451, 2904], '1993;': [1526, 2454, 2907], '363:': [1527, 2455, 2908], '274-276Crossref': [1528, 2456, 2909], '(599)': [1531, 2459, 2912], '22Coward': [1534, 2462], 'P.': [1535, 2463, 2668, 2829, 3704, 4106, 4575], 'Chan': [1536, 2464, 2830], 'Wada': [1538, 2466, 2832], 'H.G.': [1539, 2467, 2833], 'Humphries': [1540, 2468, 2834], 'Conklin': [1542, 2470, 2836], '270:': [1547, 2475, 2841], '242-248Crossref': [1548, 2476, 2842], '(202)': [1551, 2479, 2845], '23Milligan': [1554, 2482], 'Trends': [1560, 2488], '1996;': [1563, 2491], '235-237Abstract': [1565, 2493], '(107)': [1571, 2499], 'Scholar)': [1573, 3184, 3825, 5096], 'included.': [1576], '24': [1577], 'h': [1578, 1767, 1841, 1942, 2284], 'transfection': [1580], 'harvested': [1583], 'resuspended': [1585, 1772, 1819], "Hanks'": [1587, 1686], 'buffered': [1588, 1687], 'salt': [1589, 1688], 'solution': [1590], '0.01%': [1592, 1698], 'albumin': [1595, 1701, 1854], '20': [1597, 1640, 1669, 1708, 1821, 2173], 'mm': [1598, 1691, 1696, 1709, 1777, 1782, 1822, 1828, 1846, 1849, 2171, 2174, 2179], 'HEPES': [1599, 1823], '(Cellgro),': [1600, 1931], 'loaded': [1601], 'μg/ml': [1604], 'coelenterazine': [1605], 'f': [1606], '(P.': [1607], 'Industrievertetungen,': [1610], 'Handel,': [1611], 'Germany)': [1612], 'room': [1614, 1837], 'temperature': [1615, 1838], 'h,': [1618, 1679, 2302], 'stimulated': [1620, 1682, 3017, 3551], 'compounds.': [1622], 'Ligand-induced': [1623, 3105], 'mobilization,': [1625], 'indicated': [1627, 2575], 'increase': [1630, 2354], 'luminescence,': [1633], 'recorded': [1635, 1742], 'over': [1636], 'period': [1638], 's': [1641], 'Microlumat': [1644], 'luminometer': [1645], '(Berthold).': [1646], 'Inositol': [1647], 'Phosphate': [1648], 'Accumulation': [1649], 'Assay—HEK293': [1650], 'seeded': [1652, 1899, 2254, 2266], '96-well': [1654], 'plates': [1655, 1904, 2274], '(100': [1660], 'ng/well)': [1661], '(Gα16': [1666], 'ng/well).': [1670], 'After': [1671, 1945, 1981, 2208], 'labeling': [1672], '[3H]myoinositol': [1674], '(Amersham': [1675, 1726], '16': [1678, 1766], 'solution,': [1689, 2186], '25': [1690, 1830], 'Hepes': [1692], '(pH': [1693, 1779, 1824, 1855, 2176], '7.4),': [1694, 1780], '10': [1695, 1776, 1792, 2178, 2292, 3783], 'LiCl,': [1697], 'h.': [1707, 1723], 'formic': [1710], 'lyse': [1715], '4': [1719, 1722, 1795], 'Ysi-SPA': [1724], 'beads': [1725], 'added': [1729, 2282], 'lysates': [1733], 'incubated': [1735, 1835, 1933, 1953, 2296], 'overnight': [1736], 'dark.': [1739], 'Radioactivity': [1740], 'Topcount': [1745], '96/384': [1746], 'scintillation': [1747, 1893], 'counter': [1748], '(Packard).': [1749], 'GTPγS': [1750], 'Binding': [1751], 'Assay—CHO-GPR35': [1752], 'pretreated': [1756], 'without': [1759], '(Calbiochem,': [1762], '100': [1763], 'ng/ml)': [1764], 'before': [1768, 1995, 2031, 2285], 'harvesting.': [1769], 'Cells': [1770, 2294], 'homogenized': [1774], 'Tris-HCl': [1778], 'EDTA': [1783], 'followed': [1784], 'centrifugation': [1786], '1000': [1788, 2782], '×': [1789, 1813, 2260, 2269], 'g': [1790, 1814], 'min': [1793, 1817, 1977], 'remove': [1798], 'nuclei': [1799], 'debris.': [1802], 'Membrane': [1803], 'fractions': [1804], 'collected': [1806, 2306], 'spinning': [1808], 'supernatant': [1810, 2304], '38,000': [1812], '30': [1816, 1963, 1976], '7.5)': [1825], 'MgCl2.': [1829], 'membranes': [1833], 'assay': [1843, 2324, 2363, 2739, 2989, 3060, 3534, 3539], 'buffer': [1844, 2166], '(20': [1845], 'HEPES,': [1847], 'MgCl2,': [1850], '0.1%': [1851], '7.5))': [1856], '3': [1858, 2226], 'μm': [1859, 2525, 2624, 3769, 3778, 3784, 4154], 'GDP': [1860], '0.1': [1862], 'nm': [1863, 4006], '[35S]GTPγS': [1864, 3018, 3058, 3552], '(PerkinElmer': [1865], 'Life': [1866], 'Sciences)': [1867], 'absence': [1870, 2955, 3772], 'Reactions': [1876], 'terminated': [1878], 'vacuum': [1880], 'filtration': [1881], 'GF/B': [1883], 'filters,': [1884], 'retained': [1887], 'radioactivities': [1888], 'quantified': [1890], 'liquid': [1892], 'counter.': [1894], 'Immunofluorescence': [1895, 3134], 'Staining—HeLa': [1896], 'coverslips': [1901], '6-well': [1903], 'surface': [1915, 2996], 'staining,': [1916], 'fixed': [1919, 1986], '4%': [1921, 1988], 'paraformaldehyde,': [1922], 'blocked': [1923], 'phosphate-buffered': [1929, 1949], 'saline': [1930], 'M1': [1936], 'ice.': [1944], 'extensive': [1946, 2209], 'washing': [1947], 'saline,': [1950], 'IgG-rhodamine': [1957], 'additional': [1962], 'min.': [1964], 'Internalization': [1965], 'induced': [1969, 2930, 3195, 3559], '(300': [1973], 'μm)': [1974], '°C.': [1980], 'stimulation,': [1983], 'paraformaldehyde': [1989], 'permeabilized': [1991], '0.5%': [1993], 'Triton': [1994], 'antibodies.': [1998], 'Images': [1999], 'captured': [2001], 'CCD': [2004], 'digital': [2005], 'camera': [2006], 'connected': [2007], 'Leica': [2010], 'DC500': [2011], 'microscope.': [2012], 'Quantitative': [2013, 2034], 'RT-PCR': [2014], 'Analysis—Total': [2015], 'RNA': [2016, 2060, 2139, 2145, 2153, 3249], 'tissues': [2021, 3242, 3375, 4389], 'Biosciences': [2023], 'Clontech)': [2024], 'treated': [2026], 'DNase': [2028], '(Ambion)': [2030], 'reverse': [2032, 2035, 3218, 3341], 'transcription.': [2033], 'transcriptase-PCR': [2036, 3342], 'performed': [2038], 'ABI': [2041], 'Prism': [2042], '7700': [2043], 'sequence': [2044], 'detector': [2045], 'Taqman': [2047], 'core': [2049, 4761], 'reagents': [2050], '(Applied': [2051, 2067, 2078], 'Biosystems).': [2052, 2068, 2079], 'Ratios': [2053], 'glyceraldehyde-3-phosphate': [2057], 'dehydrogenase': [2058], 'message': [2059], 'calculated': [2062, 2756], 'ΔΔCt': [2065], 'method': [2066], 'Primers': [2069], 'probes': [2071, 2140, 2154, 3289], 'designed': [2073], 'Primer': [2075, 2080, 2104], 'Express': [2076], 'software': [2077], 'probe': [2082, 2106, 3367], 'sequences': [2083, 2107], 'GTGCCCTCCTGGAGACGAT': [2088], '(forward)': [2089, 2113], 'GCAGCAGTTGGCATCTGAGA': [2091], '(reverse)': [2092, 2116], 'probe,': [2096, 2120], '5′-FAM-CGTCGCGCCCTGTACATAACCAGC-BHQ-3′.': [2097], '(FAM,': [2098], '6-carboxyfluorescein;': [2099], 'BHQ,': [2100], 'black': [2101], 'hole': [2102], 'quencher).': [2103], 'ATCACAGGTAAACTCTCAGACACCAACT': [2112], 'CTTGAACGCTTCCTGGAACTCT': [2115], '5′-FAM-TGGATGCCATCTGTTACTACTACATGGCCA-BHQ-3′.': [2121], 'Situ': [2123], 'Hybridization—Mouse': [2124], 'pCMV-SPORT6': [2129], 'template': [2136], 'generating': [2138], 'T7': [2142], 'SP6': [2144], 'polymerase': [2146], '(Promega).': [2147], '[33P]UTP-labeled': [2148], 'antisense': [2149], 'sense': [2151, 3366], 'hybridized': [2156], 'paraformaldehyde-fixed,': [2158], 'paraffin-embedded': [2159], 'tissue': [2161, 3336], 'array': [2162], '(Imgenex).': [2163], 'hybridization': [2165, 3331], 'contained': [2167], '50%': [2168, 2749], 'formamide,': [2169], '300': [2170], 'NaCl,': [2172], 'Tris-Cl': [2175], '8.0),': [2177], 'NaH2PO4,': [2180], 'dextran': [2182], 'sulfate,': [2183], '1×': [2184], "Denhardt's": [2185], '0.5': [2187], 'tRNA': [2189], 'described': [2191], '(24Chuang': [2192], 'P.T.': [2193], 'Kawcak': [2194], 'McMahon': [2196], 'A.P.': [2197], 'Genes': [2198], 'Dev.': [2199], '342-347Crossref': [2202], '(214)': [2205], 'washing,': [2210], 'slides': [2211], 'exposed': [2213], 'x-ray': [2215], 'film,': [2216], 'dipped': [2217], 'emulsion': [2219], 'type': [2220], 'NTB': [2221], '(Kodak),': [2222], 'developed': [2224], 'weeks.': [2227], 'Sections': [2228], 'counterstained': [2230], 'hematoxylin': [2232], 'nuclear': [2234], 'visualization.': [2235], 'Cytokine': [2236], 'Secretion—Human': [2237], 'CD14+': [2243, 3309, 3503], 'monocytes': [2244, 2264, 3504, 4436], 'purchased': [2246], 'Allcells.': [2248], 'Peripheral': [2249], 'density': [2257], '106': [2261], 'cells/ml,': [2262], '105': [2270], 'cells/ml': [2271], '24-well': [2273], 'RPMI': [2276], '1640': [2277], 'medium.': [2278], 'lipopolysaccharides': [2286], '(LPS': [2287], '(Sigma),': [2288], 'final': [2289], 'concentration': [2290, 2358, 2523, 2743, 3911, 4025, 4175, 4319, 4338], 'ng/ml).': [2293], '18': [2301], 'cytokine': [2308, 3456, 4036], 'assay.': [2309, 2777, 2824, 3073], 'Untreated': [2310], 'controls.': [2315], 'TNF-α': [2316], 'Quantikine': [2321], 'enzyme-linked': [2322], 'immunosorbent': [2323], 'kits': [2325], '(R&D': [2326], 'Systems)': [2327], 'following': [2328], "manufacturer's": [2330], 'instructions.': [2331], 'To': [2332, 2799, 3434], 'search': [2333], 'natural': [2335], 'GPCRs,': [2339, 2723], 'collection': [2343], 'evoke': [2352, 4391], '([Ca2+]i)': [2359], '(19Stables': [2364], 'transiently': [2395, 2939], 'encoding': [2399, 2812], 'reporter,': [2403], 'promiscuous': [2408, 2866], 'Gqs5,': [2415], 'Gqi9),': [2418], 'couple': [2424], 'not': [2429, 2639, 2713, 2719, 2732, 2871, 2964, 3009, 3040, 3046, 3297, 3369, 3432, 3469, 3477, 4369], 'normally': [2430], 'linked': [2431], 'shift': [2436], 'signal': [2438, 2887, 2921, 2965, 3115], 'transduction': [2439], '(21Conklin': [2443, 2896], 'evoked': [2504], 'specific': [2506, 2529], 'rise': [2507], '[Ca2+]i': [2509], 'protein': [2517, 2773, 2868, 3164], 'mixture,': [2518], '(EC50)of39': [2524], '(Fig.': [2526, 2536, 2551, 2563, 2602, 2872, 2945, 2970, 2990, 3013, 3034, 3158, 3190, 3207, 3243, 3263, 3280, 3327, 3363, 3376, 3493, 3505, 4437], '1A).': [2527, 2537], 'No': [2528, 2947, 3418], 'response': [2530, 2601, 2753, 2780], 'observed': [2532, 4169], 'control': [2534, 3011, 3037], '(structure': [2540], 'shown': [2541, 3755], 'Fig.': [2543, 3386, 3390, 3395], '1B)isa': [2544], 'metabolite': [2545, 2568, 4366, 4814], '1C).': [2552], 'orthologues': [2560], '2).': [2564, 2603], 'Quinolinic': [2565], 'another': [2567], 'often': [2574, 3109], 'opposing': [2578], 'produced': [2599, 4787], 'no': [2600, 2779], 'Interestingly,': [2604, 4537], 'more': [2608], 'potent': [2609, 2708], 'rodent': [2611], 'than': [2613, 4141, 4381], 'EC50': [2618, 2740, 3049, 3067, 3894], 'values': [2619, 3895, 4148], '11': [2621], '7': [2623, 4153], 'selectively': [2633], 'but': [2638, 3008], 'other': [2641, 2722, 3241, 3621, 4611], '(Table': [2646], '1)': [2647], '3-hydroxyanthranilic': [2650], '3-hydroxykynurenine': [2653], 'implicated': [2656, 4721], 'T': [2658, 3311], '(25Platten': [2661], 'Ho': [2663, 3699], 'P.P.': [2664, 3700], 'Youssef': [2665, 3701], 'Fontoura': [2667, 3703], 'Garren': [2669, 3705], 'Hur': [2671, 3707], 'E.M.': [2672, 3708], 'Gupta': [2673, 3709], 'L.Y.': [2676, 3712], 'Kidd': [2677, 3713], 'B.A.': [2678, 3714], 'Robinson': [2679, 3715], 'W.H.': [2680, 3716], 'Sobel': [2681, 3717], 'R.A.': [2682, 3718], 'Selley': [2683, 3719], 'M.L.': [2684, 3720], 'Steinman': [2685, 3721], 'Science.': [2687, 3176, 3723], '310:': [2689, 3725], '850-855Crossref': [2690, 3726], '(354)': [2693, 3729], 'Of': [2696, 3611], 'found': [2703], 'most': [2707], 'stimulating': [2710], '(data': [2712, 2731, 3045, 3296, 3431, 3476], 'shown).': [2714, 3047, 3298, 3433, 3478], 'did': [2718, 2870, 3039, 3368, 3468], '∼40': [2721], 'GPR55,': [2725], 'closest': [2727], 'homologue': [2728], 'shown).TABLE': [2733], '1Tryptophan': [2734], 'potency': [2736], 'compound': [2746], 'produces': [2748], 'maximum': [2752], 'dose-response': [2758], 'curves.': [2759], 'Data': [2760], 'aequorin,': [2769], 'Inactive,': [2778], 'μm.EC50Human': [2783], 'GPR35Mouse': [2784], 'GPR35Rat': [2785], 'GPR35μmKynurenic': [2786], 'acid39.210.77.4Quinolinic': [2787], 'acidInactiveInactiveInactiveKynurenine>1000>1000>1000Anthranilic': [2788], 'acid>1000InactiveInactive3-HydroxykynurenineInactiveInactiveInactive3-Hydroxyanthranilic': [2789], 'acidInactiveInactiveInactivePicolinic': [2790], 'acidInactiveInactiveInactiveTryptophanInactiveInactiveInactiveXanthurenic': [2791], 'acidInactiveInactiveInactiveSerotoninInactiveInactiveInactiveMelatoninInactiveInactiveInactive': [2792], 'Open': [2793], 'table': [2794], 'new': [2797, 5120], 'tab': [2798], 'dissect': [2800], 'pathways': [2803, 2924], 'individual': [2816], 'chimeras': [2827, 2981, 3082], '(22Coward': [2828], 'Gqo5': [2848, 2944], 'significantly': [2851, 2982], 'potentiated': [2852], 'whereas': [2860], 'Gqs': [2861], 'chimera': [2862, 2878], '(Gqs5)': [2863], 'Gα16': [2869], '3).': [2873, 2991], 'use': [2875], 'allow': [2882], 'Gi/o-coupled': [2884, 4179], 'via': [2888], 'Gq': [2890, 2968, 4184], 'pathway,': [2891, 3522, 3750, 3835], 'leading': [2892, 3590], 'Gi/o': [2923, 3103], 'accumulation': [2932, 3538], '4).': [2946, 2971], 'formation': [2950, 3089], 'co-transfected': [2957], 'proteins,': [2959], 'agree': [2974], 'observation': [2977], 'enhanced': [2983], 'showed': [2995], 'stably': [3003], '5A).': [3014], 'incorporation': [3019], 'membrane': [3021, 3157, 3202], 'preparations': [3022], 'preincubation': [3030], '5B).': [3035], 'CHO-vector': [3036], 'respond': [3041], 'acid-induced': [3052], '36': [3062], 'μm,': [3063], 'similar': [3064], 'value': [3068], 'obtained': [3069, 3285, 3498], 'results,': [3075], 'preference': [3079], 'assays': [3090, 4138], 'couples': [3098], 'toxin-sensitive': [3102], 'pathway.': [3104], 'characteristic': [3110, 3210], 'attenuation': [3116], '(26von': [3117], 'Zastrow': [3118], 'Kobilka': [3120], 'B.K.': [3121], '1994;': [3125], '269:': [3126], '18448-18452Abstract': [3127], 'different': [3150, 3292], 'species': [3151], 'localized': [3153], 'plasma': [3156, 3201, 3971, 4002, 4143, 4314, 4539], '6A).': [3159, 3191], 'contrast,': [3161], 'FLAG-tagged': [3163], 'IKKβ': [3165], '(27Woronicz': [3166], 'J.D.': [3167], 'Cao': [3170], 'Rothe': [3172], 'Goeddel': [3174, 5164], 'D.V.': [3175], '866-869Crossref': [3179], '(1060)': [3182], 'exhibited': [3185], 'localization': [3189], 'stimulation': [3194, 3933], 'translocation': [3197], 'punctate': [3204], 'structures': [3206], '6B),': [3208], 'internalization.': [3213], 'quantitative': [3217, 3340], 'transcriptase-mediated': [3219], 'both': [3223], 'expressed': [3231, 3400], 'limited': [3238, 4620], '7).': [3244], 'humans,': [3246], 'messenger': [3248], 'mainly': [3251], 'leukocytes,': [3256], 'spleen,': [3257], 'intestine,': [3259], 'colon,': [3260, 3360], 'stomach': [3262], '7A).': [3264], 'mice,': [3266], 'high': [3267], 'levels': [3268, 4383, 4410, 4540], 'tract': [3279], '7B).': [3281], 'Similar': [3282, 3495], 'primers': [3287], 'annealing': [3290], 'regions': [3293, 3380], 'Among': [3299], 'various': [3300, 3379], 'subpopulations': [3301], 'monocytes,': [3310], 'neutrophils,': [3313], 'dendritic': [3315], 'lower': [3318, 3412], 'B': [3321], 'eosinophils,': [3323], 'basophils,': [3324], 'platelets': [3326], '7C).': [3328], 'situ': [3330], 'experiments': [3332], 'multiple': [3335], 'arrays': [3337], 'corroborated': [3338], 'data.': [3343], 'Specific': [3344], 'GPR35-positive': [3345], 'signals': [3346, 3372, 3420], 'tract,': [3354], 'duodenum,': [3356], 'jejunum,': [3357], 'ileum,': [3358], 'cecum,': [3359], 'rectum': [3362], '8A).': [3364, 3377], 'generate': [3370], 'significant': [3371, 3419, 4393], 'intestine': [3383], '(duodenum': [3384], '8B,': [3387], 'ileum': [3388], '8C,': [3391], 'colon': [3393], '8D),': [3396], 'primarily': [3399], 'epithelial': [3403], 'located': [3405], 'crypts': [3408, 4490], 'Lieberkühn,': [3410, 4492], 'intestinal': [3416, 4489], 'villi.': [3417], 'lamina': [3424], 'propria,': [3425, 3427], 'muscularis': [3426], 'enteric': [3429], 'neurons': [3430, 3840], 'investigate': [3435], 'itself': [3467], 'stimulate': [3470, 4793], 'TNFα': [3471, 3487, 4431], 'However,': [3479, 4165], 'able': [3483], 'attenuate': [3485], 'LPS-induced': [3486, 4430], 'dose-dependent': [3491], '9A).': [3494], 'purified': [3500], '9B).': [3506], 'current': [3509, 3905], 'study': [3510, 3906, 4824], 'discovery': [3565, 5139], 'endogenous': [3571, 4819], 'further': [3575, 4616, 5108], 'highlighted': [3576], 'importance': [3578], 'synthesis': [3593], '(kynurenine': [3596], 'pathway)': [3597], 'dietary': [3613], 'intake': [3615], 'converted': [3618, 4182], 'biochemically': [3619], 'compounds,': [3622], '∼99%': [3623], 'metabolized': [3625], 'Given': [3646], 'immunity': [3650], 'central': [3653, 3846], 'nervous': [3654, 3847], 'system,': [3655], 'emerged': [3660], 'attractive': [3663], 'drug': [3666, 5138], 'development': [3667], '25Platten': [3697], '28Steinman': [3732], 'Immunol.': [3735, 3954], '5:': [3737, 3941], '575-581Crossref': [3738], '(416)': [3741], 'As': [3744], 'naturally': [3759], 'occurring': [3760], 'antagonist': [3761], 'NMDA': [3763, 3856, 3914, 4660], 'glutamate': [3764], '(IC50': [3766], '∼': [3767, 3776], '8-15': [3768], 'glycine;': [3774], 'IC50': [3775], '230': [3777], 'glycine)': [3785], '(29Kessler': [3786], 'Terramani': [3788], 'Baudry': [3792], 'Neurochem.': [3795], '1989;': [3796], '52:': [3797], '1319-1328Crossref': [3798], '(528)': [3801], '30Pereira': [3804], 'E.F.': [3805], 'Hilmas': [3806], 'Santos': [3808], 'M.D.': [3809], 'Alkondon': [3810], 'Maelicke': [3812], 'Albuquerque': [3814], 'E.X.': [3815], 'Neurobiol.': [3817], '53:': [3819], '479-500Crossref': [3820], '(176)': [3823], 'mediates': [3827], 'effect.': [3830, 4395], 'Another': [3831], 'quinolinic': [3836], 'could': [3838, 4792], 'excite': [3839], 'cause': [3842], 'neurotoxicity': [3843], 'system': [3848], 'acting': [3850], 'agonist': [3853], '(17Schwarcz': [3858], 'comparable': [3908], 'required': [3912, 4131, 4177], 'antagonism.': [3916], 'during': [3922, 4411], 'conditions': [3924], 'viral': [3927], 'invasion,': [3928], 'bacterial': [3929], 'lipopolysaccharide,': [3930], 'interferon-γ': [3932], '(31Taylor': [3934], 'M.W.': [3935], 'Feng': [3936], 'G.S.': [3937], 'FASEB': [3938], '2516-2522Crossref': [3942], '(911)': [3945], '32Mellor': [3948], 'A.L.': [3949, 4512], 'Munn': [3950], 'D.H.': [3951], '762-774Crossref': [3957], '(1815)': [3960], 'causes': [3968], 'reduced': [3970], 'level': [3973, 3980, 4003, 4031, 4146], 'elevation': [3976, 4406], 'basal': [4001, 4142], '∼140': [4005], '(33Swartz': [4007], 'K.J.': [4008], 'During': [4009], 'Freese': [4011], 'Beal': [4013], 'M.F.': [4014], 'Neurosci.': [4016], '1990;': [4017], '10:': [4018], '2965-2973Crossref': [4019], 'substantially': [4027], 'elevated': [4028, 4538], 'release': [4037, 4331], '(34Heyes': [4038], 'M.P.': [4039, 4073], 'Saito': [4040], 'Crowley': [4042], 'J.S.': [4043], 'Davis': [4044], 'L.E.': [4045], 'Demitrack': [4046], 'M.A.': [4047], 'Der': [4048], 'Dilling': [4050], 'L.A.': [4051], 'Elia': [4052], 'Kruesi': [4054], 'Lackner': [4056], 'et': [4058], 'al.Brain.': [4059], '1992;': [4060, 4075], '115:': [4061], '1249-1273Crossref': [4062], '(587)': [4065], '35Saito': [4068], 'Markey': [4070], 'S.P.': [4071], 'Heyes': [4072], 'Neuroscience.': [4074], '51:': [4076], '25-39Crossref': [4077], '(173)': [4080], '36Forrest': [4083], 'Gould': [4085, 4109, 4554, 4578], 'Stone': [4089, 4113, 4558, 4582], 'Adv.': [4091, 4560], 'Exp.': [4092, 4561], '527:': [4096, 4565], '395-400Crossref': [4097, 4566], '(60)': [4100, 4569], '37Forrest': [4103, 4572], 'Youd': [4105, 4574], 'Kennedy': [4107, 4576], 'Biomed.': [4116, 4585], '9:': [4119, 4588], '436-442Crossref': [4120, 4589], '(57)': [4123, 4592], 'vitro': [4137], 'higher': [4140, 4173, 4379], '(EC50': [4147], '∼39,': [4150], '11,': [4151], 'respectively,': [4161], 'assays).': [4164], 'it': [4166, 4375], 'frequently': [4168], 'much': [4172], 'when': [4178, 4348], 'coexpressing': [4187], '38Liu': [4243], 'Sutton': [4247, 4279], 'Roland': [4249, 4283], 'B.': [4250, 4284], 'Kuei': [4251, 4285], 'Farmer': [4253, 4287], 'Sillard': [4255, 4291], 'Lovenberg': [4257, 4293], '50765-50770Abstract': [4264], '(204)': [4272], '39Liu': [4275], 'Eriste': [4277], 'Jornvall': [4289], '50754-50764Abstract': [4300], '(291)': [4308], 'measurements': [4315], 'only': [4316], 'reflect': [4317], 'diffusion': [4324], 'dilution': [4326], 'site': [4329, 4341], 'and,': [4332], 'therefore,': [4333], 'underestimate': [4335], 'action.': [4343], 'This': [4344, 4823], 'particularly': [4346], 'true': [4347], 'local': [4350, 4388], 'reaction': [4352], 'occurs': [4353], 'infection,': [4355], 'injury,': [4356], 'Because': [4361, 4439], 'subject': [4370], 'rapid': [4372], 'subsequent': [4373], 'metabolism,': [4374], 'conceivable': [4377], 'can': [4384], 'achieved': [4386], 'predominant': [4397], 'inflammation': [4412], 'this': [4415], 'receptor-ligand': [4416], 'pair': [4417], 'regulation.': [4424], 'fact,': [4426], 'inhibited': [4429], '9).': [4438], 'pro-inflammatory': [4447], 'stimuli,': [4448], 'anti-inflammatory': [4450, 4474], 'provides': [4455], 'interesting': [4457], 'feedback': [4458], 'modulating': [4461], 'More': [4464], 'depth': [4466], 'studies': [4467], 'needed': [4469], 'address': [4471], 'whether': [4472, 4683], 'mediated': [4480, 4688], 'enriched': [4486], 'rich': [4495], 'actively': [4497], 'proliferating': [4498], 'stem': [4499], 'progenitor': [4502], 'crucial': [4504], 'self-renewal': [4507], 'epithelium': [4510], '(40Hauck': [4511], 'Swanson': [4513], 'K.S.': [4514], 'Kenis': [4515], 'P.J.': [4516], 'Leckband': [4517], 'D.E.': [4518], 'Gaskins': [4519], 'Schook': [4521], 'L.B.': [4522], 'Birth': [4523], 'Defects': [4524], 'Embryo': [4527], '75:': [4530], '58-71Crossref': [4531], '(20)': [4534], 'patients': [4547], 'bowel': [4550, 4601], 'diseases': [4551, 4602], '(36Forrest': [4552], 'involvement': [4596], 'ulcerative': [4605], 'colitis': [4606], 'Crohn': [4608], 'disease': [4609], 'disorders': [4613], 'should': [4614], 'investigated.': [4617], 'brain,': [4624], 'where': [4625], 'exert': [4631], '(18Stone': [4634], 'Although': [4656], 'mechanisms': [4657], 'blockade': [4662], 'recognized,': [4668], 'processes': [4675], 'unknown.': [4677], 'remains': [4679], 'investigated': [4682], 'some': [4684], 'might': [4695], 'result': [4696], 'GPR35-deficient': [4700], 'mice': [4701], 'will': [4702], 'valuable': [4704], 'dissecting': [4706], 'oncogene': [4720], 'gastric': [4723], 'cancer': [4724], '(41Okumura': [4725], 'Baba': [4727], 'Kumada': [4729], 'Nanmoku': [4731], 'Nakajima': [4733], 'Nakane': [4735], 'Hioki': [4737], 'Ikenaka': [4739], 'Cancer': [4741], '95:': [4744], '131-135Crossref': [4745], '(63)': [4748], 'surrounding': [4759], 'solid': [4763], 'tumors': [4764], 'possible': [4783], 'abnormal': [4795], 'growth': [4796], 'contributing': [4802], 'tumorigenesis': [4804], 'tissues.': [4807], 'Thus,': [4808], 'others': [4827], '6Briscoe': [4855], 'suggests': [5097], 'believed': [5102], 'biologically': [5105], 'inactive': [5106], 'merit': [5107], 'investigation.': [5109], 'chemicals': [5115], 'shall': [5116, 5133], 'emerge': [5117], 'area': [5121], 'pharmacological': [5123], 'studies.': [5124], 'newly': [5126], 'opportunities': [5136], 'development.': [5141], 'thank': [5143, 5162], 'Drs.': [5144], 'Russ': [5145], 'Cattley,': [5146], 'Gene': [5147], 'Cutler,': [5148], 'Helene': [5149], 'Baribault,': [5150], 'Peter': [5151], 'Coward,': [5152], 'Phil': [5154], 'Babij': [5155], 'support': [5157], 'discussion.': [5159], 'David': [5163], 'critical': [5166], 'reading': [5167], 'manuscript.': [5170]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W1984584304', 'counts_by_year': [{'year': 2024, 'cited_by_count': 38}, {'year': 2023, 'cited_by_count': 52}, {'year': 2022, 'cited_by_count': 42}, {'year': 2021, 'cited_by_count': 57}, {'year': 2020, 'cited_by_count': 40}, {'year': 2019, 'cited_by_count': 31}, {'year': 2018, 'cited_by_count': 33}, {'year': 2017, 'cited_by_count': 31}, {'year': 2016, 'cited_by_count': 37}, {'year': 2015, 'cited_by_count': 38}, {'year': 2014, 'cited_by_count': 33}, {'year': 2013, 'cited_by_count': 38}, {'year': 2012, 'cited_by_count': 38}], 'updated_date': '2024-12-31T02:09:39.928022', 'created_date': '2016-06-24'}
Publication Information

Basic Information

Access and Citation

AI Researcher Chatbot

Primary Location

Authors

Topics

Keywords

Related Works
