Comparison of Lactate Transport in Astroglial Cells and Monocarboxylate Transporter 1 (MCT 1) Expressing Xenopus laevis Oocytes

Name: Work Video:
Duration: 3 min 30 s
Stefan Bröer; Basim Rahman; Gioranni Pellegri; Luc Pellerin; Jean‐Luc Martin; Stephan Verleysdonk; Bernd Hamprecht; Pierre J. Magistretti
{'id': 'https://openalex.org/W1984028198', 'doi': 'https://doi.org/10.1074/jbc.272.48.30096', 'title': 'Comparison of Lactate Transport in Astroglial Cells and Monocarboxylate Transporter 1 (MCT 1) Expressing Xenopus laevis Oocytes', 'display_name': 'Comparison of Lactate Transport in Astroglial Cells and Monocarboxylate Transporter 1 (MCT 1) Expressing Xenopus laevis Oocytes', 'publication_year': 1997, 'publication_date': '1997-11-01', 'ids': {'openalex': 'https://openalex.org/W1984028198', 'doi': 'https://doi.org/10.1074/jbc.272.48.30096', 'mag': '1984028198', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/9374487'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.272.48.30096', 'pdf_url': 'http://www.jbc.org/article/S0021925819896898/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S0021925819896898/pdf', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5074021013', 'display_name': 'Stefan Bröer', 'orcid': 'https://orcid.org/0000-0002-8040-1634'}, 'institutions': [{'id': 'https://openalex.org/I8087733', 'display_name': 'University of Tübingen', 'ror': 'https://ror.org/03a1kwz48', 'country_code': 'DE', 'type': 'education', 'lineage': ['https://openalex.org/I8087733']}], 'countries': ['DE'], 'is_corresponding': False, 'raw_author_name': 'Stefan Bröer', 'raw_affiliation_strings': ['Physiologisch-chemisches Institut der Universität, Hoppe-Seyler-Str. 4, D-72076, Tübingen, Germany.'], 'affiliations': [{'raw_affiliation_string': 'Physiologisch-chemisches Institut der Universität, Hoppe-Seyler-Str. 4, D-72076, Tübingen, Germany.', 'institution_ids': ['https://openalex.org/I8087733']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5089247853', 'display_name': 'Basim Rahman', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I8087733', 'display_name': 'University of Tübingen', 'ror': 'https://ror.org/03a1kwz48', 'country_code': 'DE', 'type': 'education', 'lineage': ['https://openalex.org/I8087733']}], 'countries': ['DE'], 'is_corresponding': False, 'raw_author_name': 'Basim Rahman', 'raw_affiliation_strings': ['Physiologisch-chemisches Institut der Universität, Hoppe-Seyler-Str. 4, D-72076, Tübingen, Germany.'], 'affiliations': [{'raw_affiliation_string': 'Physiologisch-chemisches Institut der Universität, Hoppe-Seyler-Str. 4, D-72076, Tübingen, Germany.', 'institution_ids': ['https://openalex.org/I8087733']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5071118046', 'display_name': 'Gioranni Pellegri', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I97565354', 'display_name': 'University of Lausanne', 'ror': 'https://ror.org/019whta54', 'country_code': 'CH', 'type': 'education', 'lineage': ['https://openalex.org/I97565354']}], 'countries': ['CH'], 'is_corresponding': False, 'raw_author_name': 'Gioranni Pellegri', 'raw_affiliation_strings': ['Institut de Physiologie, Faculté de Médecine, Université de Lausanne, Rue du Bugnon 7, CH-1005 Lausanne, Switzerland'], 'affiliations': [{'raw_affiliation_string': 'Institut de Physiologie, Faculté de Médecine, Université de Lausanne, Rue du Bugnon 7, CH-1005 Lausanne, Switzerland', 'institution_ids': ['https://openalex.org/I97565354']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5045897447', 'display_name': 'Luc Pellerin', 'orcid': 'https://orcid.org/0000-0002-1016-1970'}, 'institutions': [{'id': 'https://openalex.org/I97565354', 'display_name': 'University of Lausanne', 'ror': 'https://ror.org/019whta54', 'country_code': 'CH', 'type': 'education', 'lineage': ['https://openalex.org/I97565354']}], 'countries': ['CH'], 'is_corresponding': False, 'raw_author_name': 'Luc Pellerin', 'raw_affiliation_strings': ['Institut de Physiologie, Faculté de Médecine, Université de Lausanne, Rue du Bugnon 7, CH-1005 Lausanne, Switzerland'], 'affiliations': [{'raw_affiliation_string': 'Institut de Physiologie, Faculté de Médecine, Université de Lausanne, Rue du Bugnon 7, CH-1005 Lausanne, Switzerland', 'institution_ids': ['https://openalex.org/I97565354']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5070929942', 'display_name': 'Jean‐Luc Martin', 'orcid': 'https://orcid.org/0000-0002-5082-4687'}, 'institutions': [{'id': 'https://openalex.org/I97565354', 'display_name': 'University of Lausanne', 'ror': 'https://ror.org/019whta54', 'country_code': 'CH', 'type': 'education', 'lineage': ['https://openalex.org/I97565354']}], 'countries': ['CH'], 'is_corresponding': False, 'raw_author_name': 'Jean-Luc Martin', 'raw_affiliation_strings': ['Institut de Physiologie, Faculté de Médecine, Université de Lausanne, Rue du Bugnon 7, CH-1005 Lausanne, Switzerland'], 'affiliations': [{'raw_affiliation_string': 'Institut de Physiologie, Faculté de Médecine, Université de Lausanne, Rue du Bugnon 7, CH-1005 Lausanne, Switzerland', 'institution_ids': ['https://openalex.org/I97565354']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5041145790', 'display_name': 'Stephan Verleysdonk', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I8087733', 'display_name': 'University of Tübingen', 'ror': 'https://ror.org/03a1kwz48', 'country_code': 'DE', 'type': 'education', 'lineage': ['https://openalex.org/I8087733']}], 'countries': ['DE'], 'is_corresponding': False, 'raw_author_name': 'Stephan Verleysdonk', 'raw_affiliation_strings': ['Physiologisch-chemisches Institut der Universität, Hoppe-Seyler-Str. 4, D-72076, Tübingen, Germany.'], 'affiliations': [{'raw_affiliation_string': 'Physiologisch-chemisches Institut der Universität, Hoppe-Seyler-Str. 4, D-72076, Tübingen, Germany.', 'institution_ids': ['https://openalex.org/I8087733']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5020958512', 'display_name': 'Bernd Hamprecht', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I8087733', 'display_name': 'University of Tübingen', 'ror': 'https://ror.org/03a1kwz48', 'country_code': 'DE', 'type': 'education', 'lineage': ['https://openalex.org/I8087733']}], 'countries': ['DE'], 'is_corresponding': False, 'raw_author_name': 'Bernd Hamprecht', 'raw_affiliation_strings': ['Physiologisch-chemisches Institut der Universität, Hoppe-Seyler-Str. 4, D-72076, Tübingen, Germany.'], 'affiliations': [{'raw_affiliation_string': 'Physiologisch-chemisches Institut der Universität, Hoppe-Seyler-Str. 4, D-72076, Tübingen, Germany.', 'institution_ids': ['https://openalex.org/I8087733']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5037451153', 'display_name': 'Pierre J. Magistretti', 'orcid': 'https://orcid.org/0000-0002-6678-320X'}, 'institutions': [{'id': 'https://openalex.org/I97565354', 'display_name': 'University of Lausanne', 'ror': 'https://ror.org/019whta54', 'country_code': 'CH', 'type': 'education', 'lineage': ['https://openalex.org/I97565354']}], 'countries': ['CH'], 'is_corresponding': False, 'raw_author_name': 'Pierre J. Magistretti', 'raw_affiliation_strings': ['Institut de Physiologie, Faculté de Médecine, Université de Lausanne, Rue du Bugnon 7, CH-1005 Lausanne, Switzerland'], 'affiliations': [{'raw_affiliation_string': 'Institut de Physiologie, Faculté de Médecine, Université de Lausanne, Rue du Bugnon 7, CH-1005 Lausanne, Switzerland', 'institution_ids': ['https://openalex.org/I97565354']}]}], 'institution_assertions': [], 'countries_distinct_count': 2, 'institutions_distinct_count': 2, 'corresponding_author_ids': [], 'corresponding_institution_ids': [], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 5.717, 'has_fulltext': True, 'fulltext_origin': 'ngrams', 'cited_by_count': 334, 'citation_normalized_percentile': {'value': 0.933726, 'is_in_top_1_percent': False, 'is_in_top_10_percent': True}, 'cited_by_percentile_year': {'min': 98, 'max': 99}, 'biblio': {'volume': '272', 'issue': '48', 'first_page': '30096', 'last_page': '30102'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T10077', 'display_name': 'Neuroscience and Neuropharmacology Research', 'score': 0.9999, 'subfield': {'id': 'https://openalex.org/subfields/2804', 'display_name': 'Cellular and Molecular Neuroscience'}, 'field': {'id': 'https://openalex.org/fields/28', 'display_name': 'Neuroscience'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, 'topics': [{'id': 'https://openalex.org/T10077', 'display_name': 'Neuroscience and Neuropharmacology Research', 'score': 0.9999, 'subfield': {'id': 'https://openalex.org/subfields/2804', 'display_name': 'Cellular and Molecular Neuroscience'}, 'field': {'id': 'https://openalex.org/fields/28', 'display_name': 'Neuroscience'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T10608', 'display_name': 'Neurogenesis and neuroplasticity mechanisms', 'score': 0.9989, 'subfield': {'id': 'https://openalex.org/subfields/2806', 'display_name': 'Developmental Neuroscience'}, 'field': {'id': 'https://openalex.org/fields/28', 'display_name': 'Neuroscience'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T11266', 'display_name': 'Neuroinflammation and Neurodegeneration Mechanisms', 'score': 0.9971, 'subfield': {'id': 'https://openalex.org/subfields/2808', 'display_name': 'Neurology'}, 'field': {'id': 'https://openalex.org/fields/28', 'display_name': 'Neuroscience'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/monocarboxylate-transporter', 'display_name': 'Monocarboxylate transporter', 'score': 0.7678138}], 'concepts': [{'id': 'https://openalex.org/C2779535977', 'wikidata': 'https://www.wikidata.org/wiki/Q1342298', 'display_name': 'Xenopus', 'level': 3, 'score': 0.7780547}, {'id': 'https://openalex.org/C2781217356', 'wikidata': 'https://www.wikidata.org/wiki/Q83426191', 'display_name': 'Monocarboxylate transporter', 'level': 4, 'score': 0.7678138}, {'id': 'https://openalex.org/C2777542381', 'wikidata': 'https://www.wikidata.org/wiki/Q502961', 'display_name': 'Astrocyte', 'level': 3, 'score': 0.55188835}, {'id': 'https://openalex.org/C55493867', 'wikidata': 'https://www.wikidata.org/wiki/Q7094', 'display_name': 'Biochemistry', 'level': 1, 'score': 0.48317567}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.47250378}, {'id': 'https://openalex.org/C149011108', 'wikidata': 'https://www.wikidata.org/wiki/Q652985', 'display_name': 'Transporter', 'level': 3, 'score': 0.4409067}, {'id': 'https://openalex.org/C153911025', 'wikidata': 'https://www.wikidata.org/wiki/Q7202', 'display_name': 'Molecular biology', 'level': 1, 'score': 0.4404695}, {'id': 'https://openalex.org/C95444343', 'wikidata': 'https://www.wikidata.org/wiki/Q7141', 'display_name': 'Cell biology', 'level': 1, 'score': 0.43500853}, {'id': 'https://openalex.org/C185592680', 'wikidata': 'https://www.wikidata.org/wiki/Q2329', 'display_name': 'Chemistry', 'level': 0, 'score': 0.36065242}, {'id': 'https://openalex.org/C104317684', 'wikidata': 'https://www.wikidata.org/wiki/Q7187', 'display_name': 'Gene', 'level': 2, 'score': 0.12775224}, {'id': 'https://openalex.org/C134018914', 'wikidata': 'https://www.wikidata.org/wiki/Q162606', 'display_name': 'Endocrinology', 'level': 1, 'score': 0.086200655}, {'id': 'https://openalex.org/C529278444', 'wikidata': 'https://www.wikidata.org/wiki/Q47273', 'display_name': 'Central nervous system', 'level': 2, 'score': 0.086012095}], 'mesh': [{'descriptor_ui': 'D001253', 'descriptor_name': 'Astrocytes', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D002352', 'descriptor_name': 'Carrier Proteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D007773', 'descriptor_name': 'Lactates', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D009474', 'descriptor_name': 'Neurons', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D000818', 'descriptor_name': 'Animals', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D001253', 'descriptor_name': 'Astrocytes', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D001692', 'descriptor_name': 'Biological Transport', 'qualifier_ui': 'Q000187', 'qualifier_name': 'drug effects', 'is_major_topic': False}, {'descriptor_ui': 'D001692', 'descriptor_name': 'Biological Transport', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002352', 'descriptor_name': 'Carrier Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002478', 'descriptor_name': 'Cells, Cultured', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D015870', 'descriptor_name': 'Gene Expression', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D007700', 'descriptor_name': 'Kinetics', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D007773', 'descriptor_name': 'Lactates', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D027501', 'descriptor_name': 'Monocarboxylic Acid Transporters', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D009474', 'descriptor_name': 'Neurons', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D009865', 'descriptor_name': 'Oocytes', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011773', 'descriptor_name': 'Pyruvates', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D011773', 'descriptor_name': 'Pyruvates', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D012333', 'descriptor_name': 'RNA, Messenger', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D012333', 'descriptor_name': 'RNA, Messenger', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D051381', 'descriptor_name': 'Rats', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D017208', 'descriptor_name': 'Rats, Wistar', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D014982', 'descriptor_name': 'Xenopus laevis', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}], 'locations_count': 2, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.272.48.30096', 'pdf_url': 'http://www.jbc.org/article/S0021925819896898/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/9374487', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.272.48.30096', 'pdf_url': 'http://www.jbc.org/article/S0021925819896898/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 40, 'referenced_works': ['https://openalex.org/W1259543534', 'https://openalex.org/W1516061897', 'https://openalex.org/W1563482856', 'https://openalex.org/W181243240', 'https://openalex.org/W1901615681', 'https://openalex.org/W1906860528', 'https://openalex.org/W1958525759', 'https://openalex.org/W1973332969', 'https://openalex.org/W1987230338', 'https://openalex.org/W1989528677', 'https://openalex.org/W1991853401', 'https://openalex.org/W1996931194', 'https://openalex.org/W2000206641', 'https://openalex.org/W2001322840', 'https://openalex.org/W2012635677', 'https://openalex.org/W2025514567', 'https://openalex.org/W2026235801', 'https://openalex.org/W2030023308', 'https://openalex.org/W2034004233', 'https://openalex.org/W2035739440', 'https://openalex.org/W2036829402', 'https://openalex.org/W2038271220', 'https://openalex.org/W2038955227', 'https://openalex.org/W2041024806', 'https://openalex.org/W2044463379', 'https://openalex.org/W2048565038', 'https://openalex.org/W2060333964', 'https://openalex.org/W2066936960', 'https://openalex.org/W2071787267', 'https://openalex.org/W2077407785', 'https://openalex.org/W2092635505', 'https://openalex.org/W2099283003', 'https://openalex.org/W2101625991', 'https://openalex.org/W2102311418', 'https://openalex.org/W2106532277', 'https://openalex.org/W2115040195', 'https://openalex.org/W2133740745', 'https://openalex.org/W2139155172', 'https://openalex.org/W2223501705', 'https://openalex.org/W2326199983'], 'related_works': ['https://openalex.org/W4392724173', 'https://openalex.org/W4245788207', 'https://openalex.org/W3038397270', 'https://openalex.org/W2970643603', 'https://openalex.org/W2621868541', 'https://openalex.org/W2170601242', 'https://openalex.org/W2078333270', 'https://openalex.org/W2044577407', 'https://openalex.org/W2028004149', 'https://openalex.org/W1601756727'], 'abstract_inverted_index': {'The': [0, 180, 360, 631, 669, 733, 1156, 1227, 1331, 1400, 1947, 2030, 2099, 2166, 2234, 2303, 2329, 2561, 2909, 3548, 3944, 4091, 4230], 'transport': [1, 19, 35, 72, 138, 145, 159, 181, 199, 215, 252, 318, 325, 339, 361, 617, 633, 664, 670, 773, 807, 1231, 1322, 1332, 1343, 1700, 1706, 2997, 3117, 3142, 3160, 3172, 3476, 3495, 3509, 3634, 3728, 3781, 3827, 3910, 4002, 4101, 4115, 4136, 4170, 4213, 4236, 4261, 4341], 'of': [2, 8, 11, 23, 43, 50, 55, 63, 91, 105, 136, 157, 172, 182, 188, 191, 203, 223, 230, 235, 243, 271, 285, 316, 337, 352, 362, 368, 371, 421, 529, 587, 595, 628, 662, 679, 682, 726, 736, 745, 750, 811, 877, 1010, 1159, 1193, 1259, 1298, 1312, 1321, 1324, 1334, 1440, 1470, 1498, 1533, 1566, 1578, 1620, 1649, 1676, 1694, 1716, 1724, 1727, 1738, 1746, 1760, 1784, 1918, 2045, 2056, 2072, 2181, 2204, 2277, 2333, 2346, 2386, 2415, 2423, 2478, 2483, 2491, 2507, 2526, 2546, 2558, 2578, 2626, 2640, 2675, 2683, 2688, 2705, 2720, 2723, 2730, 2752, 2847, 2856, 2874, 2882, 2888, 2899, 2905, 2911, 2919, 2946, 2958, 2975, 3007, 3013, 3022, 3027, 3052, 3057, 3070, 3098, 3113, 3125, 3140, 3158, 3180, 3252, 3260, 3285, 3293, 3300, 3308, 3351, 3359, 3384, 3392, 3399, 3407, 3429, 3439, 3444, 3451, 3474, 3493, 3498, 3507, 3517, 3523, 3550, 3598, 3612, 3618, 3631, 3647, 3662, 3692, 3714, 3726, 3736, 3751, 3779, 3809, 3825, 3850, 3861, 3871, 3877, 3895, 3904, 3921, 3929, 3936, 3942, 3964, 3985, 4000, 4017, 4024, 4034, 4040, 4057, 4085, 4094, 4155, 4166, 4177, 4219, 4227, 4258, 4290, 4308, 4311, 4318, 4321, 4332, 4335, 4343, 4362, 4375, 4385, 4442], 'lactate': [3, 42, 137, 144, 158, 174, 183, 222, 317, 324, 338, 354, 363, 424, 461, 530, 559, 596, 616, 684, 720, 806, 853, 1230, 1685, 2795, 2852, 2875, 2912, 2920, 2938, 2947, 2976, 3002, 3053, 3073, 3100, 3150, 3159, 3250, 3349, 3475, 3494, 3508, 3633, 3695, 3727, 3780, 3826, 3909, 3938, 3965, 4001, 4100, 4135, 4169, 4181, 4200, 4212, 4228, 4235, 4260, 4291, 4322, 4340, 4367], 'is': [4, 184, 364, 580, 998, 1293, 2791, 2796, 2810, 2818, 3607, 3788, 3976, 4064, 4075], 'an': [5, 185, 365, 468, 555, 1735, 1944, 2872, 3110, 4242], 'essential': [6, 186, 366], 'part': [7, 187, 367], 'the': [9, 89, 95, 117, 121, 170, 189, 269, 275, 297, 301, 350, 369, 419, 518, 585, 591, 737, 756, 827, 1007, 1011, 1044, 1257, 1294, 1305, 1319, 1666, 1705, 1732, 1769, 1791, 2069, 2073, 2110, 2139, 2201, 2205, 2244, 2336, 2343, 2347, 2381, 2387, 2413, 2416, 2547, 2559, 2567, 2579, 2676, 2877, 2880, 2883, 2889, 2897, 2903, 2923, 2956, 2995, 3034, 3099, 3245, 3256, 3304, 3344, 3355, 3403, 3470, 3489, 3551, 3610, 3629, 3638, 3655, 3732, 3764, 3816, 3822, 3839, 3872, 3905, 3956, 3961, 3973, 3986, 4008, 4055, 4058, 4106, 4153, 4163, 4175, 4255, 4316, 4363, 4366, 4373], 'concept': [10, 190, 370], 'metabolic': [12, 192, 372, 557], 'coupling': [13, 193, 373], 'between': [14, 176, 194, 356, 374, 531, 2876], 'neurons': [15, 195, 375, 455, 1303, 1531, 1786, 3525, 3592], 'and': [16, 46, 65, 86, 129, 178, 196, 226, 245, 266, 309, 358, 376, 423, 462, 535, 564, 593, 601, 621, 674, 729, 767, 823, 990, 995, 1006, 1020, 1262, 1288, 1386, 1426, 1443, 1474, 1480, 1514, 1611, 1671, 1683, 1749, 1798, 1830, 1934, 1950, 1959, 2040, 2060, 2065, 2132, 2176, 2191, 2196, 2383, 2404, 2443, 2466, 2520, 2612, 2685, 2716, 2735, 2799, 2879, 2928, 2960, 2966, 3018, 3038, 3129, 3146, 3164, 3432, 3435, 3526, 3560, 3621, 3652, 3739, 3787, 3832, 3858, 3879, 3886, 3972, 4128, 4132, 4140, 4158, 4281], 'glia.': [17, 197], 'Lactate': [18, 198, 4114], 'in': [20, 73, 102, 131, 139, 146, 160, 200, 253, 282, 311, 319, 326, 340, 426, 567, 590, 618, 665, 808, 1000, 1016, 1043, 1053, 1055, 1105, 1108, 1200, 1232, 1314, 1337, 1340, 1574, 1581, 1586, 1661, 1690, 1753, 1843, 1922, 2068, 2200, 2406, 2412, 2486, 2566, 2667, 2738, 2801, 2820, 2853, 2971, 3004, 3102, 3161, 3165, 3233, 3244, 3255, 3271, 3303, 3318, 3332, 3343, 3354, 3370, 3402, 3455, 3477, 3520, 3536, 3544, 3590, 3600, 3624, 3635, 3667, 3729, 3756, 3760, 3782, 3790, 3828, 3900, 3911, 3967, 4003, 4116, 4137, 4152, 4171, 4237, 4248, 4263, 4296, 4300, 4315, 4323, 4346, 4388], 'primary': [21, 103, 111, 201, 283, 291, 809, 1348, 1464, 1782, 2854, 3005, 3055, 3521, 4279], 'cultures': [22, 104, 112, 202, 284, 292, 810, 1465, 1497, 1783, 2855, 3006, 3056, 3522, 3546, 3784, 3969, 4280], 'astroglial': [24, 106, 204, 286, 428, 598, 812, 856, 1299, 1559, 1788, 3153, 3162, 3527, 3537, 3602], 'cells': [25, 148, 205, 328, 429, 534, 569, 813, 857, 879, 1202, 1234, 1535, 1560, 1612, 1651, 1789, 2822, 2859, 2890, 3060, 3154, 3163, 3528, 3538, 3603, 3651, 3738, 3769, 3834, 3865, 3885, 4111, 4139, 4250], 'was': [26, 58, 100, 127, 206, 238, 280, 307, 672, 740, 753, 761, 830, 1023, 1103, 1366, 1380, 1391, 1403, 1609, 1669, 1701, 1741, 1751, 1763, 1779, 1821, 1837, 2035, 2104, 2171, 2279, 2325, 2340, 2400, 2512, 2660, 2692, 2733, 2755, 2766, 2863, 2926, 2933, 2949, 2977, 3029, 3046, 3078, 3118, 3242, 3269, 3295, 3341, 3368, 3394, 3482, 3533, 3641, 3697, 3754, 3759, 3785, 3812, 3835, 3852, 3898, 3931, 3946, 3970, 4029, 4102, 4120, 4186, 4222, 4274, 4355, 4379], 'shown': [27, 207, 453, 2105, 3789, 3977, 4046], 'to': [28, 69, 115, 208, 249, 295, 458, 463, 691, 1563, 1796, 1936, 2106, 2109, 2133, 2468, 2514, 2555, 2575, 2609, 2619, 2760, 2806, 2813, 2865, 2907, 2941, 2984, 3041, 3130, 3488, 3554, 3586, 3699, 4144, 4241, 4245, 4302, 4360], 'be': [29, 209, 636, 687, 817, 859, 2107, 2761, 2866, 3587, 3665, 4294], 'mediated': [30, 210], 'by': [31, 60, 66, 211, 240, 246, 597, 638, 676, 765, 819, 861, 865, 1195, 1368, 1445, 1478, 1512, 1673, 1703, 1709, 1722, 1915, 2037, 2173, 2327, 2373, 2391, 2432, 2494, 2532, 2697, 2718, 2777, 2901, 3054, 3121, 3134, 4123], 'a': [32, 61, 173, 212, 241, 353, 527, 581, 623, 677, 775, 779, 1329, 1564, 1575, 1691, 1754, 1824, 1887, 1962, 1967, 1998, 2054, 2282, 2392, 2421, 2489, 2496, 2668, 2739, 2815, 3067, 3122, 3131, 3249, 3272, 3276, 3298, 3319, 3348, 3371, 3375, 3397, 3540, 3594, 3644, 3676, 3690, 3711, 3747, 3800, 3805, 3844, 3847, 3859, 3868, 3892, 3953, 3979, 4032, 4038, 4048, 4061, 4076, 4082, 4145, 4287, 4339], 'single': [33, 213], 'saturable': [34, 214], 'system': [36, 216], 'with': [37, 143, 217, 323, 562, 778, 1342, 1346, 1617, 1657, 1713, 1743, 1886, 1902, 1943, 2053, 2138, 2187, 2243, 2305, 2402, 2408, 2474, 2523, 2630, 2637, 2680, 2702, 2771, 2891, 2936, 2981, 3062, 3226, 3275, 3282, 3325, 3374, 3381, 3419, 3539, 3593, 3616, 3673, 3763, 3767, 3804, 3918, 3955, 4014, 4087, 4105, 4180, 4357, 4439], 'aK': [38, 218], 'm': [39, 219, 626, 724, 1729, 1850, 3011, 3427, 3749, 3807, 3818], 'value': [40, 49, 220, 229, 627, 752, 829, 3012, 3021, 3473, 3750, 3778, 3808, 3849, 3860], 'for': [41, 94, 120, 154, 169, 221, 274, 300, 334, 349, 526, 719, 755, 1654, 1765, 1911, 2517, 2537, 2747, 2871, 3001, 3230, 3265, 3313, 3329, 3364, 3412, 3558, 3701, 3723, 3854, 3863, 3883, 3908, 4051, 4184, 4224], '7.7': [44, 224, 3014], 'mm': [45, 225, 728, 1598, 1623, 1626, 1629, 1634, 1637, 1642, 1659, 1680, 1861, 1875, 2643, 2646, 2651, 2656, 3017, 3115, 3254, 3302, 3353, 3401, 3431, 3434, 3753, 3811, 4036, 4208, 4221], 'aV': [47, 227, 3019], 'max': [48, 228, 3020, 3437, 3460, 3472, 3777], '250': [51, 231, 3023], 'nmol/(min': [52, 232, 742, 3024, 3441, 3448], '×': [53, 233, 743, 1568, 1847, 1858, 1904, 1924, 3025, 3442, 3449], 'mg': [54, 234, 744, 3026, 3443, 3450], 'protein).': [56, 236], 'Transport': [57, 237, 760, 1192, 2691, 3705], 'inhibited': [59, 239, 637, 764, 818, 860, 3120, 4122, 4134, 4211, 4234], 'variety': [62, 242, 4084], 'monocarboxylates': [64, 244, 3094], 'compounds': [67, 247], 'known': [68, 248], 'inhibit': [70, 250], 'monocarboxylate': [71, 96, 122, 251, 276, 302, 653, 663, 1296, 3141, 4078], 'other': [74, 254, 666, 1110, 1437, 3093, 4259], 'cell': [75, 255, 667], 'types,': [76, 256], 'such': [77, 257, 3143], 'as': [78, 258, 467, 554, 1328, 1476, 1510, 1538, 2447, 3144, 3793, 3843, 3978, 4037, 4047], 'α-cyano-4-hydroxycinnamate': [79, 259, 766, 822, 3145, 4131], 'andp-chloromercurbenzenesulfonate.': [80, 260], 'Using': [81, 261, 3745], 'reverse': [82, 262, 1378, 2038, 2174], 'transcriptase-polymerase': [83, 263], 'chain': [84, 264, 2042, 2178], 'reaction': [85, 265, 2043, 2179, 2816], 'Northern': [87, 267, 3514], 'blotting,': [88, 268], 'presence': [90, 270, 2414, 3257, 3305, 3356, 3404, 3611], 'mRNA': [92, 118, 272, 298, 1102, 3532, 3584, 4387], 'coding': [93, 119, 273, 299, 2070, 2202, 2338], 'transporter': [97, 123, 277, 303, 739, 1297, 1306, 3101], '1': [98, 278, 1633, 1658, 1679, 1725, 1857, 2424, 2492, 2648, 2650, 2653, 2892, 3693, 4035], '(MCT1)': [99, 279], 'demonstrated': [101, 281, 409], 'cells.': [107, 162, 287, 342, 599, 2803, 2884], 'In': [108, 288, 517, 689, 1282, 2843, 3581, 3796, 4053], 'contrast,': [109, 289, 3582], 'neuron-rich': [110, 290], 'were': [113, 293, 871, 991, 1051, 1351, 1413, 1439, 1466, 1503, 1536, 1561, 1602, 1613, 1652, 1720, 1894, 1932, 1953, 2429, 2445, 2472, 2549, 2564, 2634, 2711, 2775, 2969, 2999, 3036, 3107, 3224, 3280, 3323, 3379, 3417, 3453, 3671, 3707, 3743, 3841, 3881, 3916, 4012, 4150, 4269, 4436], 'found': [114, 294, 754, 2864, 4151], 'contain': [116, 296], '2': [124, 304, 1903, 4406], '(MCT2).': [125, 305], 'MCT1': [126, 140, 151, 306, 320, 331, 997, 1048, 1101, 1160, 1261, 1292, 1313, 1325, 1335, 1889, 1949, 1969, 2032, 2075, 2101, 2112, 2141, 2278, 2307, 2334, 2484, 2581, 3286, 3385, 3518, 3531, 3639, 3663, 3720, 3742, 3797, 3829, 3855, 3887, 3912, 3922, 4004, 4018, 4074, 4117, 4141, 4172, 4238, 4312, 4364, 4386], 'cloned': [128, 308, 2341, 3653], 'expressed': [130, 310, 999, 1336, 3535], 'Xenopus': [132, 312, 1315, 2388, 3166], 'laevis': [133, 313, 1316, 2427, 3687, 4285], 'oocytes.': [134, 314, 3668, 3914], 'Comparison': [135, 315], 'expressing': [141, 321, 3168, 3741, 3798, 3830, 3856, 3888, 3913, 4005, 4118, 4142, 4173, 4239], 'oocytes': [142, 322, 1317, 1338, 2628, 2699, 2710, 3167, 3683, 3688, 3740, 3757, 3799, 3831, 3857, 4006, 4119, 4143, 4240, 4299, 4304], 'glial': [147, 161, 327, 341, 533, 1534, 2821, 2858, 3059, 3103, 3632, 3730, 3737, 3768, 3833, 3864, 3884, 4110, 4138, 4249, 4264, 4376], 'revealed': [149, 329, 3529], 'that': [150, 330, 410, 454, 852, 1291, 2794, 3530, 3555, 4246], 'can': [152, 332], 'account': [153, 333, 3722], 'all': [155, 335, 2748, 2972, 3724], 'characteristics': [156, 336, 3725], 'These': [163, 343], 'data': [164, 344, 1344, 3035, 3765, 3774, 3840, 3873, 3957, 3987, 4059, 4107], 'provide': [165, 345], 'further': [166, 346, 451, 4161], 'molecular': [167, 347, 1289], 'support': [168, 348], 'existence': [171, 351], 'shuttle': [175, 355], 'astrocytes': [177, 357, 620, 1502, 2052], 'neurons.': [179, 359], 'glia': [377], '(1Dringen': [378, 471], 'R.': [379, 472, 704, 786], 'Wiesinger': [380, 473, 789], 'H.': [381, 474, 788, 790, 945, 965, 973, 975, 1113, 1121, 1123], 'Hamprecht': [382, 475, 791, 1479, 2291, 2453], 'B.': [383, 476, 792, 838, 1180, 1483, 2292, 2454], 'Neurosci.': [384, 399, 477, 544, 794, 841, 1548], 'Lett.': [385, 478, 842], '1993;': [386, 479, 509, 610, 707], '163:': [387, 480], '5-7Crossref': [388, 481], 'PubMed': [389, 403, 444, 482, 495, 512, 548, 710, 798, 846, 895, 915, 939, 959, 985, 1073, 1095, 1133, 1151, 1174, 1187, 1222, 1250, 1277, 1491, 1525, 1552, 1812, 1992, 2025, 2094, 2127, 2161, 2229, 2268, 2298, 2320, 2366, 2461, 2597, 2838, 3578], 'Scopus': [390, 445, 483, 496, 513, 711, 799, 847, 916, 940, 960, 986, 1096, 1134, 1152, 1175, 1188, 1223, 1251, 1278, 1492, 1526, 1813, 1993, 2026, 2095, 2128, 2162, 2230, 2269, 2299, 2321, 2367, 2462, 2598, 2839], '(108)': [391, 484], 'Google': [392, 404, 447, 485, 498, 515, 549, 577, 613, 713, 801, 849, 896, 918, 942, 962, 988, 1074, 1098, 1136, 1154, 1177, 1190, 1225, 1253, 1280, 1494, 1528, 1553, 1815, 1995, 2028, 2097, 2130, 2164, 2232, 2271, 2301, 2323, 2369, 2464, 2600, 2841, 3579], 'Scholar,': [393, 486, 499, 897, 919, 943, 963, 1075, 1137, 1178], '2Tsacopoulos': [394], 'M.': [395, 542, 604, 2824, 2830], 'Magistretti': [396, 432, 1515, 1518, 1545], 'P.J.': [397, 433, 1519, 1546], 'J.': [398, 543, 608, 702, 886, 928, 1064, 1084, 1147, 1170, 1181, 1211, 1239, 1273, 1547, 2014, 2218, 2257, 2294, 2356, 2834, 3569], '1996;': [400, 1242, 2124], '16:': [401], '877-885Crossref': [402], 'Scholar).': [405, 448, 516, 550, 578, 1155, 1191, 1226, 1281, 1495, 1529, 1554, 1816, 2029, 2098, 2165, 2233, 2272, 2302, 2842, 3580], 'It': [406, 449, 2790, 3606], 'has': [407, 450, 523, 1032, 1197], 'been': [408, 452, 524, 1034, 1039, 1162, 1198], 'glutamate': [411], 'at': [412, 1583, 1604, 1686, 1840, 1908, 1928, 1940, 2063, 2194, 2420, 2488, 2534, 2664, 2768, 2860, 2987, 3075, 3085, 3238, 3248, 3262, 3297, 3310, 3337, 3347, 3361, 3396, 3409, 3463, 3484, 3510, 3933, 3948, 4031, 4203, 4326, 4349], 'concentrations': [413, 1688, 3935, 4189, 4204], 'around': [414], '200': [415, 2721, 4319], 'μm': [416], 'strongly': [417, 771, 824, 3119, 3148, 4121, 4210], 'increases': [418], 'rates': [420], 'glycolysis': [422], 'release': [425, 594, 854], 'cultured': [427, 619, 1302, 1475, 2050], '(3Pellerin': [430], 'L.': [431, 1143, 1166, 1269, 1544, 2116], 'Proc.': [434], 'Natl.': [435], 'Acad.': [436], 'Sci.': [437], 'U.': [438, 501], 'S.': [439, 540, 969, 1117, 2288, 2450], 'A.': [440, 488, 947, 977, 1125, 2290, 2452], '1994;': [441, 909, 1171, 1986, 2088, 2155, 2458], '91:': [442], '10625-10629Crossref': [443], '(2182)': [446], 'are': [456, 1339, 2745, 3095, 3466], 'able': [457], 'take': [459], 'up': [460, 2983], 'use': [464], 'this': [465, 751, 1283, 2808], 'compound': [466], 'energy': [469], 'substrate': [470, 3068], '4Schurr': [487], 'Rigor': [489], 'B.M.': [490], 'Science.': [491], '1988;': [492, 574], '240:': [493], '1326-1328Crossref': [494], '(484)': [497], '5Schneider': [500], 'Poole': [502, 2117], 'R.C.': [503, 2118], 'Halestrap': [504, 1144, 1167, 1237, 1270, 2119, 2312, 2589], 'A.P.': [505, 1145, 1168, 1238, 1271, 2120, 2313, 2590], 'Grafe': [506], 'P.': [507, 2358, 2434], 'Neuroscience.': [508], '53:': [510], '1153-1162Crossref': [511], '(23)': [514], 'mammalian': [519, 878, 2802], 'retina,': [520], 'direct': [521], 'evidence': [522, 1290], 'provided': [525, 2372], 'transfer': [528], 'Müller': [532], 'photoreceptors': [536], '(6Poitry-Yamate': [537], 'C.L.': [538], 'Poitry': [539], 'Tsacopoulos': [541], '1995;': [545, 795, 931, 982, 1087, 1130, 1214, 1549, 2017, 2221, 2260, 2295, 2317, 2594], '15:': [546, 1550], '5179-5191Crossref': [547], 'Besides': [551], 'its': [552, 1029], 'role': [553], 'exchangeable': [556], 'fuel,': [558], 'also': [560, 3096, 3821], 'interferes': [561], 'pH': [563, 770, 828, 1644, 1855, 1863, 2659, 2861, 3076, 3086, 3239, 3338, 3424, 3464, 3485, 3491, 3512, 3823, 3949, 4009, 4327, 4350], 'volume': [565], 'regulation': [566], 'neural': [568], '(7Siesjö': [570], 'B.K.': [571], 'Neurochem.': [572, 705], 'Pathol.': [573], '9:': [575, 2361], '31-88PubMed': [576], 'There': [579], 'considerable': [582], 'debate': [583], 'over': [584], 'types': [586, 3497], 'transporters': [588], 'involved': [589], 'uptake': [592, 1556, 2948, 3003, 3074, 3151, 3292, 3391, 3680, 3696, 3928, 3966, 4023, 4185, 4292, 4317, 4368], 'Nedergaard': [600], 'Goldman': [602, 605], '(8Nedergaard': [603], 'S.A.': [606], 'Am.': [607], 'Physiol.': [609], '265:': [611], 'R282-R289PubMed': [612], 'Scholar)': [614, 714, 802, 850, 989, 1254, 1996, 2131, 2324, 2465], 'characterized': [615, 722, 1229], 'determined': [622, 1752, 2737, 3000, 3030, 3243, 3296, 3342, 3395, 3454, 3462, 3483, 3709, 3755, 3882, 3932, 4030, 4295], 'low': [624, 2967], 'K': [625, 3426, 3748, 3806, 3817], '0.4': [629], 'mm.': [630, 2425], 'carrier-mediated': [632, 717], 'could': [634, 685, 815, 858, 3664, 3721, 4293], 'not': [635, 686, 816, 864, 1033, 2915, 2952, 4195], 'α-cyano-3-hydroxycinnamate': [639, 820], 'or': [640, 821, 1358, 1372, 1396, 1456, 1460, 1787, 1890, 1997, 2480, 2632, 3127, 3258, 3306, 3357, 3405], 'pCMBS,': [641], '1The': [642], 'abbreviations': [643], 'used': [644, 1764, 2565, 2970], 'are:': [645], 'pCMBS,p-chloromercuribenzenesulfonate;': [646], 'HBSS,': [647], "Hank's": [648, 3234, 3333], 'buffered': [649, 3235, 3334], 'salt': [650, 3236, 3335], 'solution;': [651], 'MCT,': [652], 'transporter;': [654], 'bp,': [655, 2198], 'base': [656], 'pair(s).': [657], 'both': [658, 1260, 3496, 3773, 3901], 'being': [659], 'typical': [660], 'inhibitors': [661, 3139, 3261, 3309, 3360, 3408], 'types.': [668], 'process': [671], 'reversible': [673], 'accompanied': [675], 'cotransport': [678, 781], 'protons.': [680], 'Diffusion': [681], 'protonated': [683], 'detected.': [688], 'contrast': [690], 'these': [692, 2992], 'results,': [693], 'Tildon': [694], 'et': [695, 784, 833], 'al.': [696, 834], '(9Tildon': [697], 'J.T.': [698], 'McKenna': [699], 'M.C.': [700], 'Stevenson': [701], 'Couto': [703], 'Res.': [706, 954, 980, 1128, 1521], '18:': [708, 1810], '177-184Crossref': [709], '(90)': [712], 'identified': [715, 872], 'two': [716, 1056, 1109, 1916, 3456], 'processes': [718], 'uptake,': [721, 4201], 'byK': [723], 'values': [725, 2758, 3428, 3438], '0.5': [727, 1636], '11': [730], 'mm,': [731, 3072, 3694, 4192], 'respectively.': [732, 3890], 'maximum': [734, 3962], 'velocity': [735, 3963], 'low-affinity': [738], '170': [741], 'protein),': [746, 3445], 'whereas': [747, 1100, 1301, 4202], 'only': [748, 762, 1295, 3043, 3702, 3815], '10%': [749, 1579, 1592, 2724], 'high': [757, 1898], 'affinity': [758], 'component.': [759], 'partially': [763], 'mersalyl.': [768], 'Acidic': [769], 'increased': [772, 825, 3061], 'activity,': [774, 4369], 'finding': [776], 'consistent': [777], 'lactate/proton': [780, 3896], 'mechanism.': [782], 'Dringen': [783], 'al.(10Dringen': [785], 'Peters': [787], 'Dev.': [793], '17:': [796], '63-69Crossref': [797], '(47)': [800], 'detected': [803, 1052, 1104], 'solely': [804], 'non-saturable': [805], 'which': [814, 873, 2817, 3481, 3670, 3758, 4080, 4370], 'when': [826, 2757], 'lowered.': [831], 'Volk': [832], '(11Volk': [835], 'C.': [836, 899, 1976, 2078, 2145], 'Kempski': [837, 839], 'O.': [840, 1517], '1997;': [843, 956, 1148, 1274], '223:': [844], '121-124Crossref': [845], '(37)': [848], 'showed': [851, 3675], 'from': [855, 1025, 1353, 1359, 1381, 1393, 1405, 1415, 1422, 1431, 1468, 1505, 1781, 1961, 2049, 2184, 2281, 2850, 2917, 3643, 3958, 3989, 4043, 4109, 4276, 4372, 4446], 'quercetin': [862], 'but': [863, 3820], 'α-cyano-4-hydroxycinnamate.': [866], 'Recently': [867], 'three': [868, 1615, 1710, 2700, 3081, 3613], 'different': [869, 1687, 2686, 2695, 3614, 3934, 4088, 4095], 'cDNAs': [870], 'encode': [874], 'H+/monocarboxylate': [875], 'cotransporters': [876], '(12Kim': [880, 1058, 3563], 'C.M.': [881, 1059, 3564], 'Goldstein': [882, 900, 926, 1060, 1082, 1209, 1977, 2012, 2079, 2146, 2216, 2255, 3565], 'J.L.': [883, 901, 927, 1061, 1083, 1210, 1978, 2013, 2080, 2147, 2217, 2256, 3566], 'Brown': [884, 906, 922, 1062, 1078, 1205, 1983, 2008, 2085, 2152, 2212, 2251, 3567], 'M.S.': [885, 907, 923, 1063, 1079, 1206, 1984, 2009, 2086, 2153, 2213, 2252, 3568], 'Biol.': [887, 929, 1065, 1085, 1183, 1212, 1240, 2015, 2219, 2258, 3570], 'Chem.': [888, 930, 1066, 1086, 1213, 1241, 2016, 2220, 2259, 3571], '1992;': [889, 1067, 2360, 3572], '267:': [890, 1068, 3573], '23113-23121Abstract': [891, 1069, 3574], 'Full': [892, 912, 934, 936, 1070, 1090, 1092, 1217, 1219, 1245, 1247, 1989, 2020, 2022, 2091, 2158, 2224, 2226, 2263, 2265, 2363, 3575], 'Text': [893, 913, 935, 937, 1071, 1091, 1093, 1218, 1220, 1246, 1248, 1990, 2021, 2023, 2092, 2159, 2225, 2227, 2264, 2266, 2364, 3576], 'PDF': [894, 914, 938, 1072, 1094, 1221, 1249, 1991, 2024, 2093, 2160, 2228, 2267, 2365, 3577], '13Kim-Garcia': [898, 1975], 'Pathak': [902, 924, 1080, 1207, 1979, 2010, 2081, 2148, 2214, 2253], 'R.K.': [903, 925, 1081, 1208, 1980, 2011, 2082, 2149, 2215, 2254], 'Anderson': [904, 1981, 2083, 2150], 'R.G.W.': [905, 1982, 2084, 2151], 'Cell.': [908, 1985, 2087, 2154], '76:': [910, 1987, 2089, 2156], '865-873Abstract': [911, 1988, 2090, 2157], '(481)': [917, 1994, 2096, 2163], '14Garcia': [920, 1076, 2006], 'C.K.': [921, 1077, 1204, 2007, 2211, 2250], '270:': [932, 1088, 1215, 2018, 2222, 2261], '1843-1849Abstract': [933, 1089, 1216, 2019, 2223, 2262], '(310)': [941, 1097, 1224, 2027, 2231, 2270], '15Yoon': [944], 'Fanelli': [946], 'Grollmann': [948], 'E.F.': [949], 'Philp': [950], 'N.J.': [951], 'Biochem.': [952, 978, 1126, 1146, 1169, 1272, 2293, 2833], 'Biophys.': [953, 979, 1127, 2122, 2315, 2456, 2592], 'Commun.': [955, 981, 1129], '234:': [957, 2836], '90-94Crossref': [958], '(128)': [961], '16Takanaga': [964], 'Tamai': [966, 1114], 'I.': [967, 1115, 2826], 'Inaba': [968, 1116], 'Sai': [970, 1118], 'Y.': [971, 1119], 'Higashida': [972, 1120], 'Yamamoto': [974, 1122], 'Tsuji': [976, 1124], '217:': [983, 1131], '370-377Crossref': [984, 1132], '(103)': [987, 1135], 'designated': [992], 'MCT1,': [993], 'MCT2,': [994], 'MCT3.': [996], 'erythrocytes,': [1001], 'lung,': [1002], 'heart,': [1003, 1017], 'skeletal': [1004], 'muscle,': [1005], 'basolateral': [1008], 'membranes': [1009, 1412], 'intestinal': [1012], 'epithelium;': [1013], 'MCT2': [1014, 1050, 1196, 1263, 1891, 1951, 2000, 2168, 2207, 2236, 2246, 3583], 'predominates': [1015], 'liver,': [1018], 'kidney,': [1019], 'testis.': [1021], 'MCT3': [1022], 'isolated': [1024, 2048, 2183, 2280, 2446, 3642, 4275, 4445], 'retinal': [1026], 'pigment': [1027], 'epithelium,': [1028], 'tissue': [1030], 'distribution': [1031], 'established.': [1035], 'Contrasting': [1036], 'results': [1037, 3416], 'have': [1038, 1161, 3503, 3689], 'reported': [1040, 3557], 'concerning': [1041], 'expression': [1042, 1311, 2349, 3519, 3543, 3599, 3657, 3661, 4374], 'brain;': [1045], 'thus': [1046], 'neither': [1047], 'nor': [1049], 'brain': [1054, 1107], 'studies': [1057], 'Scholar),': [1099], 'rat': [1106, 1558, 2306, 2580, 2857, 3008, 3058, 3478, 3559, 3649, 4277, 4447], 'studies.': [1111], '(16Takanaga': [1112], '17Jackson': [1138], 'V.N.': [1139, 1236, 1265, 2309, 2586], 'Price': [1140, 1266, 2310, 2587], 'N.T.': [1141, 1267, 2311, 2588], 'Carpenter': [1142, 1268], '324:': [1149, 1275], '447-453Crossref': [1150, 1276], '(127)': [1153, 1279], 'physiological': [1157], 'properties': [1158, 1323, 1333, 3630], 'investigated': [1163, 1199], 'extensively': [1164], '(18Carpenter': [1165], '304:': [1172], '751-760Crossref': [1173], '(121)': [1176], '19Deuticke': [1179], 'Membr.': [1182], '1982;': [1184], '70:': [1185], '89-103Crossref': [1186], '(149)': [1189], 'pyruvate': [1194, 2906, 3135, 4167, 4178, 4193, 4217], 'transfected': [1201], '(14Garcia': [1203, 2210, 2249], 'well': [1228, 2792], 'liver': [1233, 2186], '(20Jackson': [1235], '271:': [1243], '861-868Abstract': [1244], '(165)': [1252], 'might': [1255], 'reflect': [1256], 'action': [1258, 4093], '(17Jackson': [1264], 'report': [1284], 'we': [1285], 'present': [1286], 'functional': [1287], 'cells,': [1300, 3104, 3731, 4265], 'express': [1304], 'isoform': [1307], 'MCT2.': [1308], 'High': [1309, 3660], 'level': [1310, 3597], 'allowed': [1318, 2467], 'investigation': [1320], 'using': [1326, 1768, 1790, 1955, 2495, 2780, 2991, 3710, 4390], '[14C]lactate': [1327, 2684, 3294, 3393, 3679, 3746, 3930, 4025], 'substrate.': [1330], 'agreement': [1341, 3762], 'gained': [1345, 3988], 'astroglia-rich': [1347, 3421, 3479, 3783, 3968, 4278], 'cultures.': [1349, 3422, 3626], 'Radiochemicals': [1350], 'purchased': [1352, 1404], 'Amersham': [1354], 'Buchler': [1355], '(Braunschweig,': [1356], 'Germany)': [1357, 1371], 'DuPont': [1360], '(Regensdorf,': [1361], 'Switzerland).': [1362, 1376, 1399], 'Fetal': [1363], 'calf': [1364, 1594], 'serum': [1365, 1595, 1879], 'supplied': [1367, 1444, 2431], 'Boehringer': [1369], '(Mannheim,': [1370], 'Fakola': [1373], 'AG': [1374], '(Basel,': [1375], 'Superscript': [1377], 'transcriptase': [1379], 'Life': [1382, 1394, 1416], 'Technologies,': [1383], 'Eggenstein': [1384], '(Germany)': [1385], "Dulbecco's": [1387, 1588], 'modified': [1388, 1589], "Eagle's": [1389, 1590], 'medium': [1390, 1608, 1668, 2878], 'obtained': [1392, 1414, 2036, 2172, 3418, 3766, 4108], 'Technologies': [1395], 'Sigma': [1397], '(Buchs,': [1398], 'Cap-analogue': [1401], 'm7G(5′)ppp(5′)G': [1402, 2419], 'New': [1406], 'England': [1407], 'Biolabs,': [1408], 'Schwalbach': [1409], '(Germany).': [1410, 1435], 'GeneScreen': [1411, 1833], 'Science': [1417], 'Products,': [1418], 'Regensdorf': [1419], '(Switzerland),': [1420], 'RNasin': [1421], 'Promega,': [1423], 'Mannheim': [1424], '(Germany),': [1425], 'Ultima': [1427], 'Gold': [1428], 'scintillation': [1429, 1747, 1755, 2714, 2731, 2741], 'mixture': [1430, 2548], 'Canberra': [1432], 'Packard,': [1433], 'Frankfurt': [1434], 'All': [1436, 1600], 'chemicals': [1438], 'analytical': [1441], 'grade': [1442], 'E.': [1446], 'Merck,': [1447], 'Darmstadt,': [1448], 'Germany;': [1449, 1452, 1455], 'Roth,': [1450], 'Karlsruhe,': [1451], 'Boehringer,': [1453], 'Mannheim,': [1454], 'Sigma,': [1457], 'Buchs,': [1458], 'Switzerland;': [1459], 'Deisenhofen,': [1461], 'Germany.': [1462], 'Astroglia-rich': [1463], 'prepared': [1467, 1504, 1537], 'brains': [1469], 'neonatal': [1471], 'Wistar': [1472], 'rats': [1473], 'described': [1477, 1511, 1539, 2448], 'Löffler': [1481, 1484], '(21Hamprecht': [1482], 'F.': [1485], 'Meth.': [1486], 'Enzymol.': [1487], '1985;': [1488], '109:': [1489], '341-345Crossref': [1490], '(238)': [1493], 'Primary': [1496], 'mouse': [1499, 2111, 2185, 3420], 'cerebral': [1500], 'cortical': [1501, 1785, 2051, 3524, 3591, 3601], 'Swiss': [1506], 'albino': [1507], 'newborn': [1508], 'mice': [1509], 'Sorg': [1513], '(22Sorg': [1516], 'Brain': [1520], '1991;': [1522], '563:': [1523], '227-233Crossref': [1524], '(210)': [1527], 'Cortical': [1530], 'devoid': [1532], 'previously': [1540, 3556], '(23Stella': [1541], 'N.': [1542], 'Pellerin': [1543], '3307-3317Crossref': [1551], 'For': [1555, 2396, 2502, 2622], 'experiments': [1557, 1601, 2845, 3106, 4268], 'grown': [1562], 'density': [1565], '4': [1567, 2638, 2703], '106': [1569], 'per': [1570], '60-mm': [1571], 'culture': [1572, 3499], 'dish': [1573], 'humidified': [1576], 'atmosphere': [1577], 'CO2': [1580], 'air': [1582], '37': [1584], '°C': [1585, 1842, 1910, 1942, 2516, 2536, 3264, 3312, 3363, 3411], '90%': [1587], 'medium,': [1591], 'fetal': [1593], 'containing': [1596, 1678, 1966, 2335, 2672], '44': [1597], 'NaHCO3.': [1599], 'performed': [1603, 1838, 2767, 3947], '21': [1605, 2988, 3263, 3311, 3362, 3410], '°C.': [1606, 1930, 2989], 'Growth': [1607], 'aspirated,': [1610], 'washed': [1614, 1896, 2635], 'times': [1616, 2696, 2701, 2965, 3082], '3': [1618, 1674, 1714, 1744, 2518, 2524, 2728, 4409], 'ml': [1619, 1675, 1715, 1726, 1745, 2639, 2704, 2729], 'HBSS': [1621, 1677], '(136.6': [1622], 'NaCl,': [1624, 1851, 2644], '5.4': [1625], 'KCl,': [1627, 2647], '4.0': [1628], 'HEPES,': [1630, 2657], '2.7': [1631], 'mmNa2HPO4,': [1632, 2654], 'CaCl2,': [1635], 'MgCl2,': [1638, 2652], '0.44': [1639], 'mmKH2PO4,': [1640], '0.41': [1641], 'MgSO4,': [1643], '7.8).': [1645], 'To': [1646, 1663, 2954, 3090, 3627, 3717, 3771, 3951, 4160, 4253], 'reduce': [1647, 2955], 'metabolism': [1648, 2959], 'lactate,': [1650, 3116], 'preincubated': [1653, 3225, 3324], '5': [1655, 1846, 1874, 2655, 2681, 3231, 3330, 3703, 3792], 'min': [1656, 1920, 2519, 3232, 3331, 3941, 4028, 4325, 4348], 'aminooxyacetate': [1660, 3227, 3326], 'HBSS.': [1662, 1718], 'initiate': [1664, 2942], 'transport,': [1665, 2943], 'preincubation': [1667, 2887, 2924], 'aspirated': [1670], 'replaced': [1672], 'aminooxyacetate,': [1681], '[14C]lactate,': [1682], 'unlabeled': [1684, 2689, 3937], 'resulting': [1689, 1733, 3974], 'specific': [1692], 'activity': [1693], '500': [1695], 'dpm/nmol.': [1696], 'After': [1697, 2540, 2726, 2804], '15': [1698, 1912, 1919, 3266, 3365], 's,': [1699], 'stopped': [1702, 2693], 'aspirating': [1704], 'buffer': [1707, 2678, 3247, 3346], 'followed': [1708, 1914, 2531], 'washing': [1711, 2698], 'cycles': [1712], 'ice-cold': [1717, 2706], 'Cells': [1719, 3322], 'lysed': [1721, 2717], 'addition': [1723, 2719], '0.1': [1728, 1923, 3071, 3114, 3253, 3301, 3352, 3400], 'HCl.': [1730], 'Of': [1731], 'suspension': [1734], 'aliquot': [1736, 1758], 'portion': [1737, 1759], '900': [1739], 'μl': [1740, 1762, 2506, 2525, 2674, 2722], 'mixed': [1742, 2522], 'mixture,': [1748], 'radioactivity': [1750, 2736, 2848, 2900], 'counter.': [1756, 2742], 'An': [1757], '100': [1761], 'protein': [1766, 3177], 'determination': [1767], 'Bio-Rad': [1770], 'Protein': [1771], 'assay': [1772], '(Bio-Rad': [1773], 'Laboratories,': [1774], 'München,': [1775], 'Germany).': [1776, 2501], 'Total': [1777, 1817], 'RNA': [1778, 1818, 1957, 2047, 2410, 2509, 4273, 4337, 4354, 4397], 'extracted': [1780], 'CsCl': [1792], 'centrifugation': [1793], 'procedure': [1794], 'according': [1795, 3040], 'Chirgwin': [1797], 'collaborators': [1799], '(24Chirgwin': [1800], 'J.M.': [1801], 'Przybyla': [1802], 'A.E.': [1803], 'MacDonald': [1804], 'R.J.': [1805], 'Rutter': [1806], 'W.J.': [1807], 'Biochemistry.': [1808], '1979;': [1809], '5294-5299Crossref': [1811], '(18269)': [1814], '(10': [1819], 'μg)': [1820], 'electrophoresed': [1822], 'on': [1823, 2542, 4007, 4098, 4168, 4199], '1.2%': [1825], 'agarose,': [1826], '2m': [1827], 'formaldehyde': [1828], 'gel': [1829], 'transferred': [1831], 'onto': [1832], 'nylon': [1834], 'membrane.': [1835], 'Hybridization': [1836], 'overnight': [1839], '65': [1841, 1909, 1929, 2515], '50%': [1844], 'formamide,': [1845], 'SSC': [1848], '(0.75': [1849], '75': [1852], 'mmsodium': [1853], 'citrate,': [1854], '7.0),': [1856], 'PE': [1859], '(50': [1860], 'Tris-HCl,': [1862], '7.5,': [1864], '0.1%': [1865, 1906, 1926], 'sodium': [1866], 'pyrophosphate,': [1867], '1%': [1868], 'SDS,': [1869], '0.2%': [1870, 1872, 1877], 'polyvinylpyrrolidone,': [1871], 'Ficoll,': [1873], 'EDTA,': [1876], 'bovine': [1878], 'albumin),': [1880], '150': [1881], 'μg/ml': [1882], 'salmon': [1883], 'sperm': [1884], 'DNA': [1885, 2399], '32P-antisense': [1888, 1948], 'riboprobe.': [1892], 'Filters': [1893, 1931], 'then': [1895, 2521], 'under': [1897], 'stringency': [1899], 'conditions,': [1900, 2994], 'first': [1901], 'SSC,': [1905, 1925], 'SDS': [1907, 1927], 'min,': [1913], 'washes': [1917], 'each': [1921, 2503, 2553, 2623], 'dried': [1933], 'apposed': [1935], 'Kodak': [1937], 'AR': [1938], 'film': [1939], '−70': [1941], 'intensifying': [1945], 'screen.': [1946], 'riboprobes': [1952], 'generated': [1954], 'T7': [1956, 2409], 'polymerase': [1958, 2041, 2177, 2411], '[α-32P]UTP': [1960], 'linearized': [1963, 2401], 'pT7Blue(R)T-vector': [1964], '(Novagen)': [1965], '505-bp': [1968, 2031], 'cDNA': [1970, 2001, 2033, 2102, 2113, 2142, 2169, 2208, 2237, 2247, 2275, 2285, 2582, 3640, 3645], 'fragment': [1971, 2002, 2034, 2103, 2170, 2238, 2332], '(nucleotides': [1972, 2003], '1128–1635;': [1973], 'Ref.': [1974, 2005, 2584], '581-bp': [1999, 2167], '979–1559;': [2004], 'transcription': [2039, 2175], 'amplification': [2044, 2180], 'poly(A)': [2046, 2508, 4272, 4297, 4336, 4353, 4377, 4443], 'set': [2055], 'oligonucleotide': [2057, 2188, 2527, 2571, 2604, 2615, 4399, 4403], 'primers': [2058, 2189], '(5′-CAAGTGGATCAGACCTCGG-3′': [2059], '5′-GGAGCTATTCTGCTGCG-3′)': [2061], 'located': [2062, 2193], '1128–1146': [2064], '1619–1635': [2066], 'bp': [2067], 'region': [2071, 2203], 'hamster': [2074, 2140, 2206, 2245, 3561], 'sequence': [2076, 2114, 2143, 2209, 2248, 2339], '(13Kim-Garcia': [2077, 2144], 'amplified': [2100, 2235], 'identical': [2108, 3511], '(25Carpenter': [2115], 'Biochim.': [2121, 2314, 2455, 2591], 'Acta.': [2123, 2316, 2457, 2593], '1279:': [2125], '157-163Crossref': [2126], '(60)': [2129], 'share': [2134], '89%': [2135], 'nucleotide': [2136, 2241], 'identity': [2137, 2242, 2304], 'poly(A)+mRNA': [2182], '5′-GATGGCTTTTGTTGATATG-3′': [2190], '5′-CTCTTTCTCTGTCTGAGGG-3′': [2192], '979–997': [2195], '1541–1559': [2197], 'respectively,': [2199, 3446], 'shared': [2239], '84%': [2240], 'A': [2273, 2885, 4216], '3.3-kilobase': [2274], 'clone': [2276], 'size-selected': [2283], 'C6-BU-1': [2284, 3648], 'library': [2286, 3646], '(26Bröer': [2287], 'Bröer': [2289, 2451], '312:': [2296], '863-870Crossref': [2297], '(63)': [2300], '(27Jackson': [2308], '1238:': [2318, 2595], '193-196Crossref': [2319, 2596], '(67)': [2322, 2599], 'confirmed': [2326], 'sequencing.': [2328], '1.9-kilobase': [2330], 'EcoRI': [2331, 2344], 'complete': [2337], 'into': [2342, 2552, 2713, 3152, 3654, 4060, 4283], 'site': [2345], 'oocyte': [2348, 2554, 3656], 'vector': [2350, 2379, 3658], 'pGEM-He': [2351], '(Ref.': [2352], '28Liman': [2353], 'E.R.': [2354], 'Tytgat': [2355], 'Hess': [2357], 'Neuron.': [2359], '861-871Abstract': [2362], '(993)': [2368], 'Scholar;': [2370], 'kindly': [2371], 'Dr.': [2374, 2433], 'Jost': [2375], 'Ludwig,': [2376], 'Hamburg).': [2377], 'This': [2378], 'contains': [2380], '5′-': [2382], '3′-untranslated': [2384], 'regions': [2385], 'β-globin': [2389], 'interrupted': [2390], 'multiple': [2393], 'cloning': [2394], 'site.': [2395], 'expression,': [2397], 'plasmid': [2398], 'NotI': [2403], 'transcribed': [2405], 'vitro': [2407], 'cap': [2417], 'analog': [2418], 'concentration': [2422, 2490, 3069, 3112, 3251, 3299, 3350, 3398, 4033, 4176, 4218], 'X.': [2426, 3686, 4284], 'females': [2428], 'generously': [2430], 'Hausen': [2435], '(Max-Planck-Institut': [2436], 'für': [2437], 'Entwicklungsbiologie,': [2438], 'Tübingen).': [2439], 'Oocytes': [2440, 3279, 3378, 3669, 3915, 4011], '(stages': [2441], 'V': [2442, 3436, 3471], 'VI)': [2444], '(29Bröer': [2449], '1192:': [2459], '95-100Crossref': [2460], '(29)': [2463], 'recover': [2469], 'overnight.': [2470], 'They': [2471], 'microinjected': [2473], 'either': [2475, 4437], '12.5': [2476, 2481, 3283, 3382, 3919, 4015, 4309], 'nl': [2477, 2482, 2545], 'water': [2479, 2487, 2633], 'cRNA': [2485, 2631, 3287, 3386, 3674, 3923, 4313], 'μg/μl,': [2493], 'microinjection': [2497], 'device': [2498], '(Bachofer,': [2499], 'Reutlingen,': [2500], 'experiment,': [2504], '1.5': [2505], '(2': [2510], 'mg/ml)': [2511, 2530], 'heated': [2513], 'solution': [2528, 3237, 3336], '(0.6': [2529], 'incubation': [2533, 2663, 2964], '42': [2535], '10': [2538], 'min.': [2539, 3315, 3414, 3704, 3716], 'cooling': [2541], 'ice,': [2543], '50': [2544, 4333], 'immediately': [2550], 'injected': [2551, 2629, 3281, 3380, 3672, 3917, 4013, 4282, 4400, 4404, 4438], 'avoid': [2556], 'degradation': [2557], 'cRNA.': [2560, 4019], 'following': [2562], 'oligonucleotides': [2563, 4392], 'experiments:': [2568], '(i)': [2569], 'antisense': [2570, 2603, 2614, 4391], 'MCT3a,': [2572], 'TGCCATAGCCAGGCCATTGGC': [2573], '(corresponding': [2574, 2608, 2618], 'bases': [2576, 2610, 2620], '647–667': [2577], 'sequence;': [2583], '27Jackson': [2585], 'Scholar);': [2601], '(ii)': [2602], 'MCT': [2605], '6a,': [2606], 'CATGATGGATGATATCCATG': [2607], '387–406);': [2611], '(iii)': [2613], 'MCT9a,': [2616], 'TCAGTAAATAAATGAGCTAT': [2617], '2761–2780).': [2621], 'determination,': [2624], 'groups': [2625], '7': [2627], 'twice': [2636, 2770, 3469], 'OR2+': [2641, 2707], '(82.5': [2642], '2.5': [2645, 3314, 3413, 3715, 3940, 4027], 'mmCaCl2,': [2649], 'final': [2658], '7.0)': [2661], 'before': [2662], 'room': [2665], 'temperature': [2666, 2968], '5-ml': [2669], 'polypropylene': [2670], 'tube': [2671], '70': [2673], 'same': [2677, 3246, 3345], 'supplemented': [2679], 'kBq': [2682], 'amounts': [2687], 'lactate.': [2690], 'after': [2694, 3939], 'buffer.': [2708], 'Single': [2709], 'placed': [2712], 'vials': [2715], 'SDS.': [2725], 'lysis,': [2727], 'fluid': [2732], 'added': [2734, 2934], 'liquid': [2740], 'Standard': [2743], 'deviations': [2744], 'given': [2746], 'values.': [2749, 3513], 'Gausses': [2750], 'law': [2751], 'error': [2753], 'propagation': [2754], 'applied': [2756], 'had': [2759], 'subtracted.': [2762], 'Each': [2763], 'experiment': [2764, 3274, 3373, 3945], 'presented': [2765], 'least': [2769], 'similar': [2772, 3505, 4146, 4244], 'results.': [2773], 'Data': [2774, 4042], 'analyzed': [2776], 'non-linear': [2778], 'regression': [2779], 'commercially': [2781], 'available': [2782], 'software': [2783], '(Fig.': [2784, 3031, 3048, 3088, 3604, 3874, 4214, 4329], 'P,': [2785], 'Biosoft,': [2786], 'Cambridge,': [2787], 'United': [2788], 'Kingdom).': [2789], 'recognized': [2793], 'rapidly': [2797, 2811], 'transported': [2798], 'metabolized': [2800], 'oxidation': [2805], 'pyruvate,': [2807, 4127, 4157], 'metabolite': [2809], 'transaminated': [2812], 'alanine,': [2814], 'fast': [2819], '(30Yudkoff': [2823], 'Nissim': [2825], 'Hummeler': [2827], 'K.': [2828], 'Medow': [2829], 'Pleasure': [2831], 'D.': [2832], '1986;': [2835], '185-192Crossref': [2837], '(79)': [2840], 'preliminary': [2844], 'accumulation': [2846, 2898, 2913], 'derived': [2849], 'labeled': [2851, 2937], '7.0': [2862, 4328], 'much': [2867], 'higher': [2868, 3678, 4205], 'than': [2869, 3080, 3084, 3468, 3681, 4206], 'expected': [2870], 'equilibration': [2873], 'cytosol': [2881], '5-min': [2886], 'mmaminooxyacetic': [2893], 'acid': [2894, 2930], 'greatly': [2895], 'reduced': [2896], 'inhibiting': [2902], 'transamination': [2904], 'alanine.': [2908], 'decrease': [2910], 'did': [2914, 4194], 'result': [2916], 'inhibition': [2918, 2945, 4198, 4226], 'transport.': [2921, 4229], 'When': [2922, 3033, 3838, 4271, 4352], 'step': [2925], 'omitted': [2927], 'aminooxyacetic': [2929], '(1': [2931, 3228, 3327], 'mm)': [2932, 2940, 3229, 3328, 4183], 'together': [2935], '(0.1': [2939, 4182], 'no': [2944], 'observed': [2950], '(data': [2951], 'shown).': [2953], 'effects': [2957], 'trans-effects': [2961], 'further,': [2962], 'short': [2963], 'experiments.': [2973, 3458], 'Uptake': [2974, 3051, 3241, 3340], 'almost': [2978], 'linearly': [2979], 'correlated': [2980], 'time': [2982, 3700, 3712], '20': [2985], 's': [2986], 'By': [2990], 'optimized': [2993], 'basic': [2996, 3733], 'parameters': [2998, 3706, 3735, 3907], 'astrocytes.': [3009], 'AK': [3010], '±': [3015, 3182, 3184, 3186, 3188, 3190, 3192, 3194, 3196, 3198, 3200, 3202, 3204, 3206, 3208, 3210, 3212, 3214, 3216, 3218, 3220, 3222, 4412, 4414, 4416, 4418, 4420, 4422, 4424, 4426, 4428, 4430, 4432, 4434], '0.7': [3016, 4220], 'protein)': [3028, 3452], '1).': [3032], 'transformed': [3037], 'plotted': [3039], 'Eadie-Hofstee': [3042, 3983], 'one': [3044], 'component': [3045, 3803], 'visible': [3047], '1,': [3049, 3960], 'inset).': [3050], 'increasing': [3063], 'H+': [3064], 'concentration.': [3065], 'At': [3066, 3109, 3423, 4188], '6.0': [3077], 'more': [3079, 3467, 3636], 'faster': [3083], '8.0': [3087], '2).': [3089], 'determine': [3091], 'if': [3092], 'substrates': [3097, 4086], 'competition': [3105], 'performed.': [3108, 4270], 'extracellular': [3111], '50-fold': [3123], 'excess': [3124], 'α-ketoisocaproate': [3126, 4133], 'acetoacetate': [3128], 'lesser': [3132], 'extent': [3133, 4243], 'anddl-3-hydroxybutyrate': [3136], '(TableI).': [3137], 'Typical': [3138], 'pCMBS': [3147, 4233], 'decreased': [3149], '(Table': [3155, 4112, 4251], 'I).Table': [3156], 'IInhibitors': [3157], 'MCT1InhibitorConcentrationTransport': [3169], 'rateTransport': [3170], 'rateRelative': [3171], 'rate': [3173], 'inCellsOocytesmmnmol·min': [3174], '−1': [3175], '·mg': [3176], '−1pmol/2.5': [3178], 'min/oocyte%': [3179], 'controlNone—6.5': [3181], '0.235.7': [3183], '2.31001004-CIN50.38': [3185], '0.023.3': [3187], '0.369pCMBS11.31': [3189], '0.076.7': [3191], '1.12018Pyruvate55.7': [3193], '0.28.3': [3195], '0.48823501.7': [3197], '0.126α-Ketoisocaproate51.4': [3199], '0.14.8': [3201], '0.12213d,l-3-Hydroxybutyrate56.3': [3203], '0.15.1': [3205], '0.39714502.2': [3207], '0.22.6': [3209], '0.1347None5.1': [3211], '0.435.7': [3213], '2.3100100Acetoacetate54.3': [3215], '0.216.2': [3217], '1.38443501.6': [3219], '0.24.7': [3221], '0.43113Cells': [3223], '7.0.': [3240, 3339, 3486, 3950], 'absence': [3259, 3307, 3358, 3406], 's.': [3267, 3366], 'Acetoacetate': [3268, 3367], 'tested': [3270, 3369], 'separate': [3273, 3277, 3372, 3376], 'control.': [3278, 3377], 'ng': [3284, 3383, 3920, 4016, 4310, 4334, 4441], 'each.': [3288, 3387, 3924], 'Four': [3289, 3388, 3925, 4020], 'days': [3290, 3389, 3926, 4021], 'later': [3291, 3390, 3927, 4022], 'Open': [3316], 'table': [3317], 'new': [3320], 'tab': [3321], 'Similar': [3415], '6.0,': [3425, 3465], '3.5': [3430], '8': [3433], '573': [3440], '576': [3447], 'independent': [3457], 'TheseV': [3459], 'values,': [3461], 'cultures,': [3480], 'Due': [3487], 'strong': [3490], 'dependence': [3492, 3824], 'will': [3500], 'most': [3501], 'likely': [3502], 'quite': [3504], 'capacities': [3506], 'blot': [3515], 'analysis': [3516], 'predominantly': [3534], 'very': [3541, 3836], 'faint': [3542], 'neuronal': [3545, 3625], '(Fig.3).': [3547], 'size': [3549], 'transcript': [3552], 'corresponded': [3553], 'tissues': [3562], 'appeared': [3585], 'highly': [3588], 'abundant': [3589], 'barely': [3595], 'detectable': [3596], '3).': [3605], 'worth': [3608], 'noting': [3609], 'transcripts': [3615], 'sizes': [3617], '2.7,': [3619], '6.3,': [3620], '9.3': [3622], 'kilobases': [3623], 'investigate': [3628, 3718, 4162, 4254], 'detail,': [3637], 'glioma': [3650], 'pGEM-He.': [3659], 'achieved': [3666], '10–20-fold': [3677], 'water-injected': [3682, 4303], '(Fig.4).': [3684], 'Although': [3685], 'diameter': [3691], 'proportional': [3698], 'therefore': [3708, 4103], 'scale': [3713], 'whether': [3719], 'kinetic': [3734, 3802, 3906, 4089], 'compared.': [3744], '5.6': [3752], 'good': [3761], '(Fig.5).': [3770], 'compare': [3772], 'sets': [3775], 'theV': [3776], 'adjusted': [3786, 3971], 'Fig.': [3791, 3959, 4044], 'adashed': [3794], 'line.': [3795, 3981], 'second': [3801], '1.1': [3810], 'visible.': [3813], 'Not': [3814], 'value,': [3819], 'similar.': [3837], 'fitted': [3842], 'titration': [3845], 'curve,': [3846], 'pK': [3848], '6.6': [3851], 'calculated': [3853], '6.9': [3862], '(Fig.6).': [3866], 'From': [3867], 'Hill': [3869, 4062], 'plot': [3870, 4063], '6,inset),': [3875], 'slopes': [3876], '0.74': [3878], '0.72': [3880], 'oocytes,': [3889, 4174, 4286], 'Therefore,': [3891], '1:1': [3893], 'stoichiometry': [3894], 'symport': [3897], 'assumed': [3899], 'systems.Figure': [3902], '5Determination': [3903], 'incubation.': [3943], 'allow': [3952], 'comparison': [3954, 4301], 'curve': [3975], 'dashed': [3980, 4049], 'Inset,': [3982], 'transformation': [3984, 4056], 'oocytes.View': [3990], 'Large': [3991, 4066], 'Image': [3992, 4067], 'Figure': [3993, 4068], 'ViewerDownload': [3994, 4069], 'Hi-res': [3995, 4070], 'image': [3996, 4071], 'Download': [3997, 4072], '(PPT)Figure': [3998], '6Dependence': [3999], 'value.': [4010], 'during': [4026], 'function': [4039], 'pH.': [4041], '2are': [4045], 'line': [4050], 'comparison.': [4052], 'theinset': [4054], 'shown.View': [4065], '(PPT)': [4073], 'nonspecific': [4077], 'transporter,': [4079], 'transports': [4081], 'wide': [4083], 'constants.': [4090], 'inhibitory': [4092, 4164], 'monocarboxylic': [4096], 'acids': [4097], 'MCT1-mediated': [4099], 'compared': [4104], 'I).': [4113, 4252], 'α-cyano-4-hydroxycinnamate,': [4124], 'α-ketoisocaproate,': [4125], 'dl-3-hydroxybutyrate,': [4126, 4156], 'acetoacetate.': [4129, 4159], 'While': [4130], 'extent,': [4147], 'large': [4148], 'discrepancies': [4149], 'case': [4154], 'potency': [4165], 'competing': [4179], 'varied.': [4187], 'below': [4190], '0.2': [4191, 4207], 'exert': [4196], 'significant': [4197], 'it': [4209], '7).': [4215], 'necessary': [4223], 'half-maximal': [4225], 'thiol': [4231], 'reagent': [4232], 'encountered': [4247], 'possible': [4256], 'involvement': [4257], 'pathways': [4262], 'hybrid': [4266], 'depletion': [4267, 4384], '2-fold': [4288], 'induction': [4289], 'RNA-injected': [4298], '(TableII).': [4305], 'Whereas': [4306], 'injection': [4307, 4331], 'resulted': [4314, 4371], 'pmol': [4320, 4345], '30': [4324, 4347, 4440], '4),': [4330], 'induced': [4338], 'capacity': [4342], '17': [4344], '6.0.': [4351], 'coinjected': [4356], 'antisense-oligonucleotides': [4358], 'corresponding': [4359], 'sequences': [4361], 'mRNA,': [4365], 'RNA,': [4378, 4444], 'completely': [4380], 'suppressed': [4381], '(TableII).Table': [4382], 'IIHybrid': [4383], 'poly(A)RNA': [4389], 'directed': [4393], 'against': [4394], 'MCT1Oligonucleotide': [4395], '(1)Poly(A)': [4396], '+': [4398, 4402], '(2)H2O': [4401], '(3)Column': [4405], 'minus': [4407], 'column': [4408], '(4)None': [4410], '(control)37.7': [4411], '4.420.7': [4413], '1.717.0': [4415], '4.7MCT3a24.0': [4417], '1.521.5': [4419], '1.02.5': [4421], '1.8MCT6a19.5': [4423], '1.120.8': [4425], '0.7−1.0': [4427], '2.7MCT9a21.8': [4429], '1.325.6': [4431], '2.6−3.2': [4433], '3.5Oocytes': [4435], 'astrog': [4448]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W1984028198', 'counts_by_year': [{'year': 2024, 'cited_by_count': 6}, {'year': 2023, 'cited_by_count': 13}, {'year': 2022, 'cited_by_count': 9}, {'year': 2021, 'cited_by_count': 12}, {'year': 2020, 'cited_by_count': 14}, {'year': 2019, 'cited_by_count': 10}, {'year': 2018, 'cited_by_count': 9}, {'year': 2017, 'cited_by_count': 9}, {'year': 2016, 'cited_by_count': 11}, {'year': 2015, 'cited_by_count': 12}, {'year': 2014, 'cited_by_count': 7}, {'year': 2013, 'cited_by_count': 10}, {'year': 2012, 'cited_by_count': 10}], 'updated_date': '2025-01-16T08:52:39.568179', 'created_date': '2016-06-24'}
Publication Information

Basic Information

Access and Citation

AI Researcher Chatbot

Primary Location

Authors

Topics

Keywords

Related Works
