Publication Information

{'id': 'https://openalex.org/W1977425580', 'doi': 'https://doi.org/10.1194/jlr.m037812', 'title': 'CD36 deletion reduces VLDL secretion, modulates liver prostaglandins, and exacerbates hepatic steatosis in ob/ob mice', 'display_name': 'CD36 deletion reduces VLDL secretion, modulates liver prostaglandins, and exacerbates hepatic steatosis in ob/ob mice', 'publication_year': 2013, 'publication_date': '2013-08-21', 'ids': {'openalex': 'https://openalex.org/W1977425580', 'doi': 'https://doi.org/10.1194/jlr.m037812', 'mag': '1977425580', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/23964120', 'pmcid': 'https://www.ncbi.nlm.nih.gov/pmc/articles/3793603'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1194/jlr.m037812', 'pdf_url': 'http://www.jlr.org/content/54/11/2988.full.pdf', 'source': {'id': 'https://openalex.org/S11400418', 'display_name': 'Journal of Lipid Research', 'issn_l': '0022-2275', 'issn': ['0022-2275', '1539-7262'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'doaj', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jlr.org/content/54/11/2988.full.pdf', 'any_repository_has_fulltext': True}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5056093747', 'display_name': 'Fatiha Nassir', 'orcid': 'https://orcid.org/0000-0002-3653-3621'}, 'institutions': [{'id': 'https://openalex.org/I204465549', 'display_name': 'Washington University in St. Louis', 'ror': 'https://ror.org/01yc7t268', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I204465549']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Fatiha Nassir', 'raw_affiliation_strings': ['†Department of Medicine, Washington University School of Medicine, St. Louis, MO 63110;'], 'affiliations': [{'raw_affiliation_string': '†Department of Medicine, Washington University School of Medicine, St. Louis, MO 63110;', 'institution_ids': ['https://openalex.org/I204465549']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5023005618', 'display_name': 'Okunade L. Adewole', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I204465549', 'display_name': 'Washington University in St. Louis', 'ror': 'https://ror.org/01yc7t268', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I204465549']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Okunade L. Adewole', 'raw_affiliation_strings': ['†Department of Medicine, Washington University School of Medicine, St. Louis, MO 63110;'], 'affiliations': [{'raw_affiliation_string': '†Department of Medicine, Washington University School of Medicine, St. Louis, MO 63110;', 'institution_ids': ['https://openalex.org/I204465549']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5072014736', 'display_name': 'Elizabeth M. Brunt', 'orcid': 'https://orcid.org/0000-0003-1862-325X'}, 'institutions': [{'id': 'https://openalex.org/I204465549', 'display_name': 'Washington University in St. Louis', 'ror': 'https://ror.org/01yc7t268', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I204465549']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Elizabeth M. Brunt', 'raw_affiliation_strings': ['‡Department of Pathology and Immunology, Washington University School of Medicine, St. Louis, MO 63110;'], 'affiliations': [{'raw_affiliation_string': '‡Department of Pathology and Immunology, Washington University School of Medicine, St. Louis, MO 63110;', 'institution_ids': ['https://openalex.org/I204465549']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5019567141', 'display_name': 'Nada A. Abumrad', 'orcid': 'https://orcid.org/0000-0002-6475-0877'}, 'institutions': [{'id': 'https://openalex.org/I204465549', 'display_name': 'Washington University in St. Louis', 'ror': 'https://ror.org/01yc7t268', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I204465549']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Nada A. Abumrad', 'raw_affiliation_strings': ['†Department of Medicine, Washington University School of Medicine, St. Louis, MO 63110;'], 'affiliations': [{'raw_affiliation_string': '†Department of Medicine, Washington University School of Medicine, St. Louis, MO 63110;', 'institution_ids': ['https://openalex.org/I204465549']}]}], 'institution_assertions': [], 'countries_distinct_count': 1, 'institutions_distinct_count': 1, 'corresponding_author_ids': [], 'corresponding_institution_ids': [], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 5.378, 'has_fulltext': True, 'fulltext_origin': 'ngrams', 'cited_by_count': 93, 'citation_normalized_percentile': {'value': 0.928952, 'is_in_top_1_percent': False, 'is_in_top_10_percent': True}, 'cited_by_percentile_year': {'min': 97, 'max': 98}, 'biblio': {'volume': '54', 'issue': '11', 'first_page': '2988', 'last_page': '2997'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T12964', 'display_name': 'Diet, Metabolism, and Disease', 'score': 0.9999, 'subfield': {'id': 'https://openalex.org/subfields/2712', 'display_name': 'Endocrinology, Diabetes and Metabolism'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, 'topics': [{'id': 'https://openalex.org/T12964', 'display_name': 'Diet, Metabolism, and Disease', 'score': 0.9999, 'subfield': {'id': 'https://openalex.org/subfields/2712', 'display_name': 'Endocrinology, Diabetes and Metabolism'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, {'id': 'https://openalex.org/T10351', 'display_name': 'Liver Disease Diagnosis and Treatment', 'score': 0.9997, 'subfield': {'id': 'https://openalex.org/subfields/2713', 'display_name': 'Epidemiology'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, {'id': 'https://openalex.org/T11339', 'display_name': 'Metabolism, Diabetes, and Cancer', 'score': 0.9986, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/steatosis', 'display_name': 'Steatosis', 'score': 0.82093036}, {'id': 'https://openalex.org/keywords/cd36', 'display_name': 'CD36', 'score': 0.627192}], 'concepts': [{'id': 'https://openalex.org/C2776175330', 'wikidata': 'https://www.wikidata.org/wiki/Q1365091', 'display_name': 'Steatosis', 'level': 2, 'score': 0.82093036}, {'id': 'https://openalex.org/C126322002', 'wikidata': 'https://www.wikidata.org/wiki/Q11180', 'display_name': 'Internal medicine', 'level': 1, 'score': 0.65655935}, {'id': 'https://openalex.org/C134018914', 'wikidata': 'https://www.wikidata.org/wiki/Q162606', 'display_name': 'Endocrinology', 'level': 1, 'score': 0.64370555}, {'id': 'https://openalex.org/C2779828298', 'wikidata': 'https://www.wikidata.org/wiki/Q4035577', 'display_name': 'CD36', 'level': 3, 'score': 0.627192}, {'id': 'https://openalex.org/C49039625', 'wikidata': 'https://www.wikidata.org/wiki/Q84230', 'display_name': 'Secretion', 'level': 2, 'score': 0.6169469}, {'id': 'https://openalex.org/C185592680', 'wikidata': 'https://www.wikidata.org/wiki/Q2329', 'display_name': 'Chemistry', 'level': 0, 'score': 0.4859382}, {'id': 'https://openalex.org/C8243546', 'wikidata': 'https://www.wikidata.org/wiki/Q419074', 'display_name': 'Very low-density lipoprotein', 'level': 4, 'score': 0.47615504}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.3498628}, {'id': 'https://openalex.org/C2780072125', 'wikidata': 'https://www.wikidata.org/wiki/Q28350', 'display_name': 'Lipoprotein', 'level': 3, 'score': 0.24774152}, {'id': 'https://openalex.org/C71924100', 'wikidata': 'https://www.wikidata.org/wiki/Q11190', 'display_name': 'Medicine', 'level': 0, 'score': 0.242306}, {'id': 'https://openalex.org/C2778163477', 'wikidata': 'https://www.wikidata.org/wiki/Q43656', 'display_name': 'Cholesterol', 'level': 2, 'score': 0.21226156}, {'id': 'https://openalex.org/C170493617', 'wikidata': 'https://www.wikidata.org/wiki/Q208467', 'display_name': 'Receptor', 'level': 2, 'score': 0.094702065}], 'mesh': [{'descriptor_ui': 'D018955', 'descriptor_name': 'CD36 Antigens', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': True}, {'descriptor_ui': 'D018955', 'descriptor_name': 'CD36 Antigens', 'qualifier_ui': 'Q000172', 'qualifier_name': 'deficiency', 'is_major_topic': True}, {'descriptor_ui': 'D005234', 'descriptor_name': 'Fatty Liver', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D055786', 'descriptor_name': 'Gene Knockout Techniques', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': True}, {'descriptor_ui': 'D008079', 'descriptor_name': 'Lipoproteins, VLDL', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D008099', 'descriptor_name': 'Liver', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D011453', 'descriptor_name': 'Prostaglandins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D000818', 'descriptor_name': 'Animals', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D018955', 'descriptor_name': 'CD36 Antigens', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D005234', 'descriptor_name': 'Fatty Liver', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D006801', 'descriptor_name': 'Humans', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008079', 'descriptor_name': 'Lipoproteins, VLDL', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D008099', 'descriptor_name': 'Liver', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D051379', 'descriptor_name': 'Mice', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011453', 'descriptor_name': 'Prostaglandins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}], 'locations_count': 5, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1194/jlr.m037812', 'pdf_url': 'http://www.jlr.org/content/54/11/2988.full.pdf', 'source': {'id': 'https://openalex.org/S11400418', 'display_name': 'Journal of Lipid Research', 'issn_l': '0022-2275', 'issn': ['0022-2275', '1539-7262'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://doaj.org/article/646880587559491d8dd04b8ddd909976', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306401280', 'display_name': 'DOAJ (DOAJ: Directory of Open Access Journals)', 'issn_l': None, 'issn': None, 'is_oa': True, 'is_in_doaj': False, 'is_core': False, 'host_organization': None, 'host_organization_name': None, 'host_organization_lineage': [], 'host_organization_lineage_names': [], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}, {'is_oa': True, 'landing_page_url': 'https://europepmc.org/articles/pmc3793603', 'pdf_url': 'https://europepmc.org/articles/pmc3793603?pdf=render', 'source': {'id': 'https://openalex.org/S4306400806', 'display_name': 'Europe PMC (PubMed Central)', 'issn_l': None, 'issn': None, 'is_oa': True, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1303153112', 'host_organization_name': 'European Bioinformatics Institute', 'host_organization_lineage': ['https://openalex.org/I1303153112'], 'host_organization_lineage_names': ['European Bioinformatics Institute'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': True, 'landing_page_url': 'https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3793603', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S2764455111', 'display_name': 'PubMed Central', 'issn_l': None, 'issn': None, 'is_oa': True, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/23964120', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1194/jlr.m037812', 'pdf_url': 'http://www.jlr.org/content/54/11/2988.full.pdf', 'source': {'id': 'https://openalex.org/S11400418', 'display_name': 'Journal of Lipid Research', 'issn_l': '0022-2275', 'issn': ['0022-2275', '1539-7262'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [{'score': 0.6, 'display_name': 'Good health and well-being', 'id': 'https://metadata.un.org/sdg/3'}], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 60, 'referenced_works': ['https://openalex.org/W1523155649', 'https://openalex.org/W1844075866', 'https://openalex.org/W1901777596', 'https://openalex.org/W1966482757', 'https://openalex.org/W1967488657', 'https://openalex.org/W1968126541', 'https://openalex.org/W1970078468', 'https://openalex.org/W1974974158', 'https://openalex.org/W1985592156', 'https://openalex.org/W1988042264', 'https://openalex.org/W1990720759', 'https://openalex.org/W1991760464', 'https://openalex.org/W1992805591', 'https://openalex.org/W1993281511', 'https://openalex.org/W2001744108', 'https://openalex.org/W2006906877', 'https://openalex.org/W2007809519', 'https://openalex.org/W2008714599', 'https://openalex.org/W2016612191', 'https://openalex.org/W2018455556', 'https://openalex.org/W2019441179', 'https://openalex.org/W2022837209', 'https://openalex.org/W2026831840', 'https://openalex.org/W2032430636', 'https://openalex.org/W2059861743', 'https://openalex.org/W2061678423', 'https://openalex.org/W2065612971', 'https://openalex.org/W2066327741', 'https://openalex.org/W2071766794', 'https://openalex.org/W2075705519', 'https://openalex.org/W2076779593', 'https://openalex.org/W2077755739', 'https://openalex.org/W2080863840', 'https://openalex.org/W2082464271', 'https://openalex.org/W2083681924', 'https://openalex.org/W2089369126', 'https://openalex.org/W2090621246', 'https://openalex.org/W2093089464', 'https://openalex.org/W2096326095', 'https://openalex.org/W2098012175', 'https://openalex.org/W2101077526', 'https://openalex.org/W2103547924', 'https://openalex.org/W2104024176', 'https://openalex.org/W2107387587', 'https://openalex.org/W2114199165', 'https://openalex.org/W2114597116', 'https://openalex.org/W2123708355', 'https://openalex.org/W2124486530', 'https://openalex.org/W2129202635', 'https://openalex.org/W2133703837', 'https://openalex.org/W2134283161', 'https://openalex.org/W2136943950', 'https://openalex.org/W2142666508', 'https://openalex.org/W2148878254', 'https://openalex.org/W2155235961', 'https://openalex.org/W2157619650', 'https://openalex.org/W2183896259', 'https://openalex.org/W277249231', 'https://openalex.org/W4248953039', 'https://openalex.org/W97131072'], 'related_works': ['https://openalex.org/W3029793504', 'https://openalex.org/W2994642861', 'https://openalex.org/W2748952813', 'https://openalex.org/W2606726233', 'https://openalex.org/W2162456146', 'https://openalex.org/W2150663179', 'https://openalex.org/W2022016504', 'https://openalex.org/W200327483', 'https://openalex.org/W1990149642', 'https://openalex.org/W1974468825'], 'abstract_inverted_index': {'Recent': [0, 212, 1345, 3353], 'findings': [1, 169, 213, 381, 1332, 2133], 'described': [2, 214, 2561, 2759], 'the': [3, 13, 20, 29, 34, 87, 95, 101, 106, 155, 194, 215, 225, 232, 241, 246, 299, 307, 313, 318, 367, 406, 453, 703, 718, 777, 922, 960, 1041, 1055, 1066, 1348, 1452, 1564, 1817, 1888, 1893, 1920, 1929, 1934, 1981, 1984, 2074, 2078, 2141, 2259, 2286, 2356, 2400, 2661, 2717, 2940, 3043, 3046, 3078, 3124, 3152, 3230, 3315, 3330, 3407, 3429, 3436, 3523, 3632, 3653, 3694, 3732, 3750, 3756, 3822, 3825, 3846, 3853, 3904, 3923, 4008, 4115, 4195], 'role': [4, 30, 173, 216, 242, 385, 532, 1349, 1878, 1894, 1979, 2137, 4140], 'of': [5, 15, 31, 36, 45, 63, 71, 79, 84, 97, 105, 135, 174, 187, 206, 217, 227, 243, 248, 257, 275, 283, 291, 296, 309, 317, 347, 386, 399, 418, 430, 438, 471, 536, 578, 686, 717, 736, 763, 798, 826, 836, 859, 921, 955, 1044, 1063, 1190, 1218, 1338, 1350, 1483, 1552, 1563, 1568, 1598, 1624, 1701, 1708, 1816, 1834, 1863, 1879, 1895, 1922, 1946, 1983, 2073, 2138, 2143, 2157, 2279, 2290, 2590, 2595, 2676, 2705, 2739, 2770, 2864, 2945, 3045, 3075, 3148, 3188, 3203, 3223, 3261, 3266, 3385, 3391, 3400, 3413, 3428, 3448, 3482, 3530, 3634, 3652, 3693, 3702, 3713, 3776, 3778, 3906, 3933, 3943, 3974, 3981, 4176, 4190, 4282, 4298, 4305], 'CD36-mediated': [6, 218, 1351], 'signaling': [7, 219, 757, 1352, 1529, 1857, 3443, 4149], 'in': [8, 33, 42, 48, 55, 89, 176, 197, 220, 245, 254, 260, 267, 301, 388, 409, 441, 479, 533, 543, 615, 720, 808, 833, 867, 872, 964, 1054, 1069, 1105, 1170, 1220, 1225, 1241, 1248, 1287, 1343, 1353, 1379, 1431, 1474, 1589, 1640, 1675, 1680, 1710, 1733, 1786, 1819, 1882, 1909, 1928, 1933, 1980, 2010, 2051, 2115, 2140, 2495, 2511, 2580, 2630, 2660, 2673, 2690, 2737, 2846, 2854, 2878, 2883, 2899, 2958, 2962, 2967, 3123, 3184, 3193, 3195, 3213, 3229, 3251, 3286, 3302, 3316, 3355, 3389, 3409, 3416, 3473, 3577, 3612, 3617, 3665, 3678, 3724, 3727, 3736, 3772, 3785, 3790, 3871, 3964, 4007, 4042, 4083, 4117, 4141, 4144, 4152, 4170, 4199, 4270, 4329], 'regulating': [9, 177, 221, 389], 'cellular': [10, 222, 1358], 'calcium': [11, 223, 1359, 1371, 1476, 1559, 1591, 1648, 1725, 3445, 3475, 3585], 'and': [12, 24, 50, 76, 125, 131, 142, 150, 161, 203, 208, 224, 236, 262, 288, 337, 343, 354, 362, 373, 415, 420, 432, 448, 468, 484, 510, 555, 568, 576, 607, 637, 645, 732, 738, 765, 785, 806, 810, 843, 864, 869, 934, 959, 994, 997, 1051, 1065, 1100, 1167, 1173, 1208, 1244, 1251, 1282, 1313, 1376, 1426, 1451, 1481, 1527, 1566, 1596, 1730, 1790, 1831, 1865, 1903, 1906, 1913, 1967, 1971, 2048, 2067, 2112, 2147, 2211, 2220, 2255, 2270, 2296, 2304, 2344, 2352, 2361, 2378, 2386, 2429, 2503, 2514, 2541, 2546, 2576, 2592, 2623, 2678, 2699, 2707, 2716, 2772, 2856, 2881, 2917, 2922, 2928, 2947, 2970, 2973, 2996, 2999, 3073, 3116, 3118, 3173, 3190, 3226, 3247, 3263, 3296, 3310, 3327, 3347, 3358, 3365, 3383, 3423, 3425, 3452, 3480, 3527, 3552, 3560, 3660, 3689, 3800, 3850, 3891, 3979, 4014, 4080, 4131, 4194, 4221, 4227, 4237, 4253, 4260, 4263], 'release': [14, 226, 735, 762, 1378, 1567, 1707, 1732, 1833, 1862, 3447], 'various': [16, 228], 'bioactive': [17, 229, 1616], 'molecules,': [18, 230], 'including': [19, 231, 547, 1705], 'prostaglandins,': [21, 233], 'neurotransmitters,': [22, 234], 'cholecystokinin,': [23, 235], 'secretin.': [25, 237], 'Here': [26, 238], 'we': [27, 239, 1891], 'document': [28, 240, 2134], 'CD36': [32, 39, 64, 98, 121, 146, 152, 175, 200, 244, 251, 276, 310, 333, 358, 364, 387, 412, 521, 562, 575, 606, 640, 779, 828, 901, 986, 1002, 1022, 1083, 1127, 1159, 1277, 1308, 1339, 1470, 1525, 1585, 1697, 1881, 1896, 1910, 1923, 2139, 2209, 2271, 2916, 3038, 3067, 3110, 3437, 3442, 3469, 3635, 3864, 3878, 3907, 4217, 4236, 4289], 'secretion': [35, 52, 163, 247, 264, 375, 470, 711, 1342, 1627, 1639, 1674, 1755, 1808, 1884, 2149, 2557, 2578, 3041, 3072, 3117, 3249, 3298, 3348, 3559, 3576, 3611, 3759, 3766, 3812, 3834, 3868, 3894, 3912], 'hepatic': [37, 72, 128, 159, 249, 284, 340, 371, 837, 900, 991, 1021, 1126, 1197, 1245, 1625, 1647, 1880, 1899, 1926, 2001, 2144, 3362, 3584, 3638, 3656, 3679, 3875, 3915, 3975, 4005, 4033, 4142, 4177, 4224, 4322], 'VLDL.': [38, 250], 'deletion': [40, 65, 99, 153, 252, 277, 311, 365, 1003, 1084, 1924, 3865, 3879, 4290], 'resulted': [41, 253], '60%': [43, 255, 2900, 3212], 'suppression': [44, 256], 'VLDL': [46, 51, 132, 178, 209, 258, 263, 344, 390, 421, 1191, 1221, 1284, 1341, 1626, 1638, 1673, 1883, 2148, 2591, 3150, 3206, 3232, 3262, 3345, 3363, 3410, 3558, 3575, 3610, 3758, 3867, 3893, 3911, 4228], 'output': [47, 259, 1189, 1217, 1227, 3147], 'vivo,': [49, 261], 'was': [53, 66, 265, 278, 1560, 2423, 2558, 2628, 2642, 2666, 2720, 2744, 2756, 2885, 3207, 3283, 3770, 3842, 4106, 4267, 4285, 4318, 4326], 'reduced': [54, 266, 469, 3209, 3285, 4258], 'vitro': [56, 268, 2674, 3303], 'using': [57, 269, 2408, 2418, 2441, 2924, 3012], 'incubated': [58, 270, 2387, 2491, 2687, 2730, 2911, 3784], 'liver': [59, 271, 482, 506, 812, 827, 868, 926, 966, 985, 1056, 1123, 1131, 1256, 1949, 2008, 2047, 2111, 2681, 2727, 2820, 3166, 3174, 3305, 3319, 3535, 3548, 3714, 3768, 3814, 3836, 3946, 3994, 4040, 4079, 4201], 'slices.': [60, 272], 'The': [61, 273, 539, 601, 796, 952, 1669, 1962, 2038, 2102, 2635, 3546, 3606, 3676, 4070, 4187, 4278], 'effect': [62, 96, 274, 308, 3529, 3633, 3905], 'mediated': [67, 279, 2778], 'by': [68, 112, 157, 280, 324, 369, 435, 939, 1001, 1082, 1215, 1756, 1809, 1837, 2070, 2285, 2363, 2648, 2668, 2775, 2779, 2849, 3210, 3760, 3767, 3813, 3835, 3845, 3852, 3883, 3895, 4016, 4104, 4288, 4320], 'enhancing': [69, 281, 1205], 'formation': [70, 282, 1565, 1908, 3115, 3454, 3753], 'prostaglandins': [73, 285, 1569, 1671, 3608, 3657], 'D2,': [74, 286], 'F2,': [75, 287], 'E2.': [77, 289], 'Treatment': [78, 290], 'CD36-deficient': [80, 292, 1432, 3154], 'slices': [81, 293, 2489, 2508, 2682, 2728, 3306, 3320, 3335, 3769, 3782, 3815, 3837], 'with': [82, 294, 907, 989, 1028, 1120, 1130, 1163, 1253, 1279, 1283, 1618, 2322, 2388, 2399, 2499, 2530, 2619, 2731, 2825, 2844, 2851, 2893, 2906, 2912, 2993, 3217, 3290, 3304, 3314, 3334, 3435, 3671, 4146, 4275, 4333], 'inhibitors': [83, 295, 3777, 3796, 3805, 3826], 'cyclooxygenases': [85, 297], 'reversed': [86, 298, 2069], 'reduction': [88, 300], 'triglyceride': [90, 129, 160, 302, 341, 372, 439, 2752, 2774, 3175, 3326, 3989], 'secretion.': [91, 133, 303, 345, 3411, 4229], 'We': [92, 304, 1917, 3140, 3630, 3746, 3898, 3921], 'also': [93, 305, 1918, 3145, 3300, 3704], 'examined': [94, 306, 1892, 3141, 3748], 'on': [100, 147, 312, 359, 782, 1196, 1340, 1783, 1795, 1898, 1925, 2258, 2330, 2375, 2748, 2986, 3533, 3637, 3832], 'obesity-associated': [102, 314], 'spontaneous': [103, 315], 'steatosis': [104, 156, 316, 368, 425, 447, 1169, 1927, 1982, 3916, 4006, 4116, 4143, 4178], 'ob/ob': [107, 118, 136, 319, 330, 348, 873, 1930, 1963, 1985, 2256, 3926, 4009, 4153, 4214, 4245, 4276, 4306], 'mouse': [108, 320, 1380, 1734, 1931, 1964, 1986, 4010], 'that': [109, 321, 528, 1193, 1621, 2150, 3397, 3863, 4325], 'is': [110, 322, 426, 433, 522, 541, 563, 707, 780, 829, 1161, 1212, 1472, 1587, 1965, 2041, 2068, 2105, 2777, 3111, 3342, 3471, 4011, 4073], 'driven': [111, 323], 'enhanced': [113, 325, 990, 4017], 'de': [114, 326, 456, 461, 3976], 'novo': [115, 327, 457, 462, 3977], 'lipogenesis.': [116, 328], 'Homozygous': [117, 329, 4213], 'mice': [119, 137, 331, 349, 1433, 2257, 2266, 2318, 2527, 2616, 3155, 3196, 3219, 3292, 3323, 3338, 3393, 3673, 3818, 4145, 4215, 4231, 4246, 4272, 4284, 4300, 4307], 'lacking': [120, 332, 4216], '(ob-CD36−/−)': [122, 334, 4218], 'were': [123, 138, 335, 350, 2262, 2274, 2283, 2298, 2309, 2319, 2328, 2339, 2359, 2384, 2397, 2490, 2509, 2516, 2528, 2537, 2617, 2686, 2709, 2729, 2800, 2814, 2840, 2869, 2891, 2910, 2952, 2956, 2991, 3010, 3031, 3180, 3299, 3387, 3554, 3662, 3783, 4219, 4257, 4301], 'generated': [124, 336, 4220], 'studied': [126, 338, 4222], 'for': [127, 339, 565, 690, 709, 733, 2043, 2107, 2161, 2207, 2268, 2346, 2492, 2518, 2548, 2585, 2653, 2722, 2797, 2858, 2871, 2887, 2919, 3113, 3256, 3344, 3716, 3798, 3802, 3959, 4075, 4223, 4234], 'accumulation': [130, 342, 437, 1053, 4226], 'Livers': [134, 346], 'steatotic': [139, 351], 'as': [140, 352, 684, 840, 2560, 2758, 3215, 3288, 3332, 3420, 3669, 3963, 4273, 4331], 'expected': [141, 353], 'had': [143, 355, 3827, 4239], '5-fold': [144, 356, 3851], 'more': [145, 357, 3829], 'Kupffer': [148, 360, 786, 3742, 3884], 'cells': [149, 361, 787, 1713, 1839, 3743], 'hepatocytes.': [151, 363, 442, 3897], 'exacerbated': [154, 366, 1081], 'impairing': [158, 370], 'apoB': [162, 207, 374, 419, 1281, 1904, 2556, 2679, 2725, 3191, 3297, 3328], 'through': [164, 376], 'increasing': [165, 377], 'prostaglandin': [166, 378, 1484, 1599, 3483, 3531], 'levels.': [167, 379, 2875, 3877], 'These': [168, 380, 1331], 'suggest': [170, 382, 1333], 'an': [171, 383, 530, 1676, 1977, 2301, 2581, 3252, 3398, 3613], 'unappreciated': [172, 384], 'secretion,': [179, 391, 2680, 2726], 'which': [180, 392, 1048, 3841, 3886, 4317], 'might': [181, 393, 1200, 2151, 3144], 'have': [182, 394, 983, 2152, 3156], 'relevance': [183, 395, 2153], 'to': [184, 396, 446, 613, 904, 1025, 1103, 1188, 1204, 1289, 1316, 1530, 1555, 1557, 1646, 1695, 2005, 2154, 2264, 2380, 2425, 2572, 2598, 2711, 2842, 2867, 2915, 3167, 3182, 3200, 3243, 3269, 3406, 3556, 3583, 3682, 3755, 3808, 3901, 3909, 3987, 4037, 4109, 4114, 4172, 4294, 4303], 'some': [185, 397, 2155], 'forms': [186, 398, 2156], 'fatty': [188, 400, 481, 505, 602, 652, 681, 759, 861, 956, 965, 1094, 1122, 1156, 1255, 1792, 1859, 1948, 1972, 2007, 2046, 2110, 2158, 3945, 3985, 3993, 4039, 4078, 4101, 4133, 4191, 4200, 4314], 'liver.': [189, 401, 1973, 2159, 3153, 3524], 'They': [190, 402], 'provide': [191, 403], 'insight': [192, 404], 'into': [193, 405, 452, 3042, 3329], 'association': [195, 407], 'reported': [196, 408, 3555, 4107], 'humans': [198, 410, 1119], 'between': [199, 411], 'protein': [201, 413, 540, 1311, 1421, 1471, 1586, 2753, 3357, 3426, 3470, 3691], 'expression': [202, 414, 797, 825, 902, 987, 1023, 1312, 3379, 3882], 'serum': [204, 416, 1280, 2549, 2646], 'levels': [205, 417, 1526, 2146, 2327, 2813, 3427, 3640, 3692, 3726], 'particle': [210, 422, 1285], 'number.': [211, 423], 'Hepatic': [424, 2811], 'a': [427, 523, 655, 980, 1045, 1317, 1334, 1699, 2135, 2312, 2586, 3013, 3157, 3257, 3721, 3928, 4111, 4137], 'common': [428], 'complication': [429], 'obesity': [431, 842, 1970, 3934], 'characterized': [434, 1214, 4015], 'excess': [436], '(TG)': [440], 'Multiple': [443], 'pathways': [444, 535], 'contribute': [445, 1315, 3405], 'include': [449, 1622], 'FA': [450, 458, 466, 537, 566, 643, 992, 1198, 1206, 1354, 2353, 3430], 'influx': [451], 'liver,': [454, 778], 'increased': [455, 984, 1168, 1216, 3843, 4100], 'synthesis': [459, 3990], 'or': [460, 918, 942, 3505, 3744, 3774, 3789, 4154], 'lipogenesis': [463, 3978], '(DNL),': [464], 'decreased': [465], 'oxidation,': [467], 'VLDLs': [472], '(1Anstee': [473], 'Q.M.': [474], 'Goldin': [475], 'R.D.': [476], 'Mouse': [477], 'models': [478, 835, 1945, 3942, 4175], 'non-alcoholic': [480, 1171, 3992], 'disease': [483, 1124, 2009, 4041], 'steatohepatitis': [485, 1172], 'research.Int.': [486], 'J.': [487, 767, 849, 945, 1147, 1300, 1867, 1952, 3512, 3537, 3949, 4157, 4180], 'Exp.': [488], 'Pathol.': [489], '2006;': [490, 1686, 3127, 3623], '87:': [491], '1-16Crossref': [492], 'PubMed': [493, 516, 588, 628, 669, 697, 727, 771, 819, 878, 913, 973, 1034, 1075, 1113, 1180, 1266, 1326, 1394, 1446, 1496, 1544, 1611, 1658, 1748, 1801, 1826, 1871, 1957, 2062, 2126, 2609, 2790, 3085, 3135, 3280, 3372, 3495, 3541, 3595, 3954, 4000, 4094, 4165, 4208], 'Scopus': [494, 517, 589, 629, 670, 698, 728, 772, 820, 879, 914, 974, 1035, 1076, 1114, 1181, 1267, 1327, 1395, 1447, 1497, 1545, 1612, 1689, 1749, 1802, 1827, 1872, 1958, 2063, 2127, 2791, 3086, 3136, 3373, 3496, 3542, 3626, 3955, 4001, 4095, 4166, 4209], '(572)': [495], 'Google': [496, 519, 591, 631, 672, 700, 730, 774, 822, 881, 916, 976, 1037, 1078, 1116, 1183, 1269, 1329, 1397, 1449, 1499, 1547, 1614, 1659, 1691, 1751, 1804, 1829, 1874, 1960, 2018, 2065, 2129, 2610, 2793, 3088, 3138, 3281, 3375, 3498, 3544, 3596, 3628, 3957, 4003, 4050, 4097, 4168, 4211], 'Scholar,': [497, 592, 673, 882, 1398, 1500, 1660, 2019, 3089, 3597, 4051], '2Cohen': [498], 'J.C.': [499], 'Horton': [500, 2036, 2100, 4068], 'J.D.': [501, 1631, 2037, 2101, 3568, 4069], 'Hobbs': [502], 'H.H.': [503], 'Human': [504], 'disease:': [507], 'old': [508], 'questions': [509], 'new': [511], 'insights.Science.': [512], '2011;': [513, 970, 1177, 1323, 1488, 1536, 1603, 3487, 4205], '332:': [514], '1519-1523Crossref': [515], '(1572)': [518], 'Scholar).': [520, 632, 701, 775, 823, 977, 1038, 1117, 1270, 1330, 1548, 1692, 1875, 1961, 2611, 2794, 3139, 3376, 3499, 3545, 3629, 4098, 4212], 'class': [524, 801], 'B': [525], 'scavenger': [526, 799], 'receptor': [527, 800, 928, 932, 937, 963, 2470, 4198], 'plays': [529, 1976, 4136], 'important': [531, 564, 708, 1550, 1978, 3112], 'several': [534], 'utilization.': [538], 'expressed': [542, 781], 'many': [544], 'cell': [545], 'types,': [546], 'lingual': [548, 608], 'taste': [549, 559, 577, 1711], 'bud': [550, 560, 1712], 'cells,': [551, 561, 3885], 'enterocytes,': [552], 'adipocytes,': [553], 'myocytes,': [554], 'immune': [556], 'cells.': [557], 'On': [558, 3821], 'recognition': [567], 'fat': [569, 614, 1132], 'perception': [570], '(3Degrace-Passilly': [571], 'P.': [572, 574, 1153, 1365, 1514, 1664, 1719, 3064, 3109, 3601, 3970], 'Besnard': [573, 1364, 1718], 'fat.Curr.': [579], 'Opin.': [580], 'Clin.': [581, 1108, 3080], 'Nutr.': [582], 'Metab.': [583, 660, 2053, 2117, 2781, 3367, 3996, 4085], 'Care.': [584], '2012;': [585, 620, 724, 1438, 1823, 1954, 2054, 2118, 3951, 4086], '15:': [586, 2055, 2119, 4087], '107-111Crossref': [587], '(44)': [590], '4Pepino': [593], 'M.Y.': [594], 'Love-Gregory': [595], 'L.': [596, 789, 1058, 1292, 1506, 1764, 2765], 'Klein': [597, 1238, 1301], 'S.': [598, 741, 1139, 1239, 1302, 1662, 1841, 2570, 3095, 3241, 3599, 4123], 'Abumrad': [599, 649, 754, 1091, 1305, 1468, 1519, 1583, 1773, 1854, 3065, 3106, 3467], 'N.A.': [600, 650, 713, 755, 1092, 1306, 1367, 1469, 1520, 1584, 1721, 1774, 1812, 1855, 3066, 3107, 3468], 'acid': [603, 653, 682, 862, 957, 1095, 1157, 1369, 1723, 1778, 1793, 2164, 3450, 4102, 4134, 4192], 'translocase': [604, 1158, 1779], 'gene': [605, 3378], 'lipase': [609], 'influence': [610, 1337, 3892], 'oral': [611], 'sensitivity': [612], 'obese': [616, 1249], 'subjects.J.': [617], 'Lipid': [618, 1650, 2601, 2703, 3272, 3587], 'Res.': [619, 815, 1651, 2602, 3273, 3588], '53:': [621], '561-566Abstract': [622], 'Full': [623, 625, 664, 666, 1261, 1263, 1389, 1391, 1441, 1443, 1491, 1493, 1539, 1541, 1606, 1608, 1655, 1743, 1745, 2057, 2059, 2121, 2123, 2606, 2785, 2787, 3130, 3132, 3277, 3490, 3492, 3592, 4089, 4091], 'Text': [624, 626, 665, 667, 1262, 1264, 1390, 1392, 1442, 1444, 1492, 1494, 1540, 1542, 1607, 1609, 1656, 1744, 1746, 2058, 2060, 2122, 2124, 2607, 2786, 2788, 3131, 3133, 3278, 3491, 3493, 3593, 4090, 4092], 'PDF': [627, 668, 1265, 1393, 1445, 1495, 1543, 1610, 1657, 1747, 2061, 2125, 2608, 2789, 3134, 3279, 3494, 3594, 4093], '(213)': [630], 'In': [633, 702, 776, 1118, 1693, 1887, 2554], 'skeletal': [634], 'muscle,': [635], 'heart,': [636], 'adipose': [638, 870, 1242], 'tissue,': [639], 'facilitates': [641], 'tissue': [642, 871, 1243, 2684, 2706], 'uptake': [644, 993, 1096, 3122, 4103, 4135], 'utilization': [646], '(5Su': [647], 'X.': [648, 1149, 1414, 1465, 1580, 2025, 2089, 2564, 2761, 3235, 3464, 4057], 'Cellular': [651, 3520], 'uptake:': [654], 'pathway': [656, 1455, 2040, 2104, 4072], 'under': [657, 3503, 3917], 'construction.Trends': [658], 'Endocrinol.': [659], '2009;': [661], '20:': [662, 1324], '72-77Abstract': [663], '(264)': [671], '6Glatz': [674], 'J.F.': [675], 'Luiken': [676], 'J.J.': [677], 'Bonen': [678, 1089], 'A.': [679, 1090, 1361, 1363, 1715, 1717, 1772], 'Membrane': [680], 'transporters': [683, 863], 'regulators': [685], 'lipid': [687, 721, 1246, 1523, 1820, 2002, 2821, 3071, 3359, 3417, 4034], 'metabolism:': [688, 1428], 'implications': [689], 'metabolic': [691, 1101, 3528, 3919], 'disease.Physiol.': [692], 'Rev.': [693, 723, 1071, 1822], '2010;': [694, 1072, 2782, 3369, 4162], '90:': [695, 1073], '367-417Crossref': [696], '(517)': [699], 'small': [704, 3048], 'intestine,': [705], 'it': [706, 3143, 3740], 'chylomicron': [710, 1532, 1807, 3114], '(7Abumrad': [712, 1811], 'Davidson': [714, 1813, 3057], 'N.O.': [715, 1814, 3058], 'Role': [716, 1815], 'gut': [719, 761, 1818, 1835, 1861], 'homeostasis.Physiol.': [722, 1821], '92:': [725, 1824], '1061-1085Crossref': [726, 1825], '(243)': [729, 1828], 'Scholar)': [731, 917, 1450, 2066, 2130], 'FA-induced': [734, 1753, 1832], 'secretin': [737, 764, 1864], 'cholecystokinin': [739], '(8Sundaresan': [740, 1840], 'Shahid': [742, 1842], 'R.': [743, 747, 1294, 1776, 1843, 1847], 'Riehl': [744, 1844], 'T.E.': [745, 1845], 'Chandra': [746, 1846], 'Nassir': [748, 1507, 1848, 3055, 3092], 'F.': [749, 1233, 1508, 1849, 2566, 3056, 3093, 3237, 3968, 4121], 'Stenson': [750, 1850], 'W.F.': [751, 1851], 'Liddle': [752, 1852], 'R.A.': [753, 847, 1853], 'CD36-dependent': [756, 1856], 'mediates': [758, 1791, 1858], 'acid-induced': [760, 1860], 'cholecystokinin.FASEB': [766, 1866], '2013;': [768, 1868, 2015, 4047], '27:': [769, 1869], '1191-1202Crossref': [770, 1870], '(75)': [773, 1803, 1873], 'endothelial,': [783], 'parenchymal,': [784], '(9Malerod': [788], 'Juvet': [790], 'K.': [791, 1412, 2029, 2093, 4061], 'Gjoen': [792], 'T.': [793, 795, 1086, 1145, 1296, 1943, 3940], 'Berg': [794], 'B,': [802], 'type': [803], 'I': [804], '(SR-BI)': [805], 'caveolin-1': [807], 'parenchymal': [809, 3534], 'nonparenchymal': [811], 'cells.Cell': [813], 'Tissue': [814, 2876], '2002;': [816, 1110], '307:': [817], '173-180Crossref': [818], '(58)': [821], 'Basal': [824], 'low': [830], 'but': [831, 1185, 4150], 'increases': [832, 1224], 'experimental': [834, 4174], 'steatosis,': [838], 'such': [839, 3419], 'genetic': [841, 1274], 'high-fat': [844, 981], 'feeding': [845], '(10Memon': [846], 'Fuller': [848], 'Moser': [850], 'A.H.': [851], 'Smith': [852], 'P.J.': [853], 'Grunfeld': [854], 'C.': [855, 4125], 'Feingold': [856], 'K.R.': [857], 'Regulation': [858], 'putative': [860], 'Acyl-CoA': [865], 'synthetase': [866], 'mice.Diabetes.': [874], '1999;': [875], '48:': [876], '121-127Crossref': [877], '(81)': [880], '11Koonen': [883], 'D.P.': [884, 1005], 'Jacobs': [885, 1006], 'R.L.': [886, 1007], 'Febbraio': [887, 948, 1008, 4183], 'M.': [888, 949, 1009, 1143, 2027, 2091, 3054, 3350, 3972, 4059, 4184], 'Young': [889, 1010], 'M.E.': [890, 1011, 1135], 'Soltys': [891, 1012], 'C.L.': [892, 1013], 'Ong': [893, 1014], 'H.': [894, 1015, 1504, 1760, 1766, 4127], 'Vance': [895, 1016], 'D.E.': [896, 1017], 'Dyck': [897, 1018], 'J.R.': [898, 1019, 1461, 1576, 3460], 'Increased': [899, 1020], 'contributes': [903, 1024, 2004, 3754, 4036], 'dyslipidemia': [905, 1026], 'associated': [906, 988, 1027, 1162, 1276], 'diet-induced': [908, 1029], 'obesity.Diabetes.': [909, 1030], '2007;': [910, 1031], '56:': [911, 1032], '2863-2871Crossref': [912, 1033], '(342)': [915, 1036], 'following': [919], 'activation': [920, 2072], 'prosteatotic': [923, 1042], 'transcription': [924], 'factors': [925, 3360], 'X': [927, 931], '(LXR),': [929], 'pregnane': [930], '(PXR),': [933], 'aryl': [935, 961, 4196], 'hydrocarbon': [936, 962, 4197], '(AHR)': [938], 'xenobiotics,': [940], 'bacteria,': [941], 'cytokines': [943], '(12He': [944, 4179], 'Lee': [946, 3102, 4181], 'J.H.': [947, 4182], 'Xie': [950, 2024, 2088, 4056, 4185], 'W.': [951, 1406, 1770, 4186], 'emerging': [953, 4188], 'roles': [954, 4189], 'translocase/CD36': [958, 4193], 'disease.Exp.': [967, 4202], 'Biol.': [968, 1384, 1436, 1486, 1534, 1601, 1738, 3485, 4203], 'Med.': [969, 4204], '236:': [971, 4206], '1116-1121Crossref': [972, 4207], '(88)': [975, 4210], 'Mice': [978, 2273, 2795], 'fed': [979], 'diet': [982, 1104], 'TG': [995, 1052, 1209, 1219, 1900, 1902, 2347, 2550, 2677, 2718, 3563, 3765, 3811, 3833, 4225, 4250, 4323], 'accumulation,': [996, 3418], 'these': [998, 3860], 'are': [999, 1080], 'prevented': [1000], '(11Koonen': [1004], 'Interestingly,': [1039], 'however,': [1040, 3165], 'effects': [1043, 1062, 1620, 1794, 3831], 'high-fructose': [1046], 'diet,': [1047], 'enhances': [1049, 3880], 'DNL': [1050, 1975, 4018], '(13Tappy': [1057], 'Lê': [1059], 'K-A.': [1060], 'Metabolic': [1061], 'fructose': [1064], 'worldwide': [1067], 'increase': [1068, 3561, 3677, 3723, 3733, 3888], 'obesity.Physiol.': [1070], '23-46Crossref': [1074], '(862)': [1077], 'Scholar),': [1079, 1184, 1615, 1752, 1805, 1830, 3282, 3958, 4004, 4169], '(14Hajri': [1085], 'Han': [1087], 'X.X.': [1088], 'Defective': [1093], 'modulates': [1097], 'insulin': [1098, 1164, 1754, 1796, 2194, 2297, 2500, 4264], 'responsiveness': [1099], 'responses': [1102], 'CD36-null': [1106], 'mice.J.': [1107, 2013, 4045], 'Invest.': [1109, 3081], '109:': [1111], '1381-1389Crossref': [1112], '(237)': [1115], 'nonalcoholic': [1121, 1254, 1947, 2006, 3944, 4038], '(NAFLD),': [1125], 'positively': [1128], 'correlates': [1129], 'content': [1133, 2551, 2659, 3176, 3564, 3686, 4324], '(15Miquilena-Colina': [1134], 'Lima-Cabello': [1136], 'E.': [1137, 1229, 1762], 'Sanchez-Campos': [1138], 'Garcia-Mediavilla': [1140], 'M.V.': [1141], 'Fernandez-Bermejo': [1142], 'Lozano-Rodriguez': [1144], 'Vargas-Castrillon': [1146], 'Buque': [1148], 'Ochoa': [1150, 1665, 3602], 'B.': [1151, 1666, 3603], 'Aspichueta': [1152, 1663, 3600], 'et': [1154, 1419, 1521], 'al.Hepatic': [1155], 'upregulation': [1160], 'resistance,': [1165], 'hyperinsulinaemia': [1166], 'chronic': [1174], 'hepatitis': [1175], 'C.Gut.': [1176], '60:': [1178], '1394-1402Crossref': [1179], '(286)': [1182], 'its': [1186, 1194, 1561, 3725], 'relationship': [1187], 'suggests': [1192], 'impact': [1195, 1921, 3914], 'metabolism': [1199, 1355, 2003, 4035], 'not': [1201, 3163, 3381, 3404, 3433, 4108, 4151], 'be': [1202, 4110], 'limited': [1203], 'flux': [1207], 'accumulation.': [1210], 'NAFLD': [1211, 3966], 'typically': [1213], 'without': [1222, 3707], 'parallel': [1223], 'VLDL-apoB': [1226], '(16Fabbrini': [1228], 'Mohammed': [1230], 'B.S.': [1231], 'Magkos': [1232], 'Korenblat': [1234], 'K.M.': [1235], 'Patterson': [1236], 'B.W.': [1237], 'Alterations': [1240], 'kinetics': [1247], 'men': [1250], 'women': [1252], 'disease.Gastroenterology.': [1257], '2008;': [1258, 1386, 1740], '134:': [1259], '424-431Abstract': [1260], '(403)': [1268], 'However,': [1271, 3377, 4310], 'our': [1272, 2132], 'recent': [1273], 'studies': [1275], 'level': [1278], 'number': [1286, 1700], 'addition': [1288, 1694], 'VLDL-TG': [1290, 3189], '(17Love-Gregory': [1291], 'Sherva': [1293], 'Schappe': [1295], 'Qi': [1297], 'J.S.': [1298], 'McCrea': [1299], 'Connelly': [1303], 'M.A.': [1304], 'Common': [1307], 'SNPs': [1309], 'reduce': [1310, 3557, 3910], 'may': [1314, 3119], 'protective': [1318], 'atherogenic': [1319], 'profile.Hum.': [1320], 'Mol.': [1321], 'Genet.': [1322], '193-201Crossref': [1325], '(116)': [1328], 'potentially': [1335], 'significant': [1336, 3033], 'humans.': [1344], 'data': [1346, 3861], 'documented': [1347, 3862], 'via': [1356, 3873], 'affecting': [1357, 3361], '(18El-Yassimi': [1360, 1714], 'Hichami': [1362, 1716], 'Khan': [1366, 1720], 'Linoleic': [1368, 1722], 'induces': [1370, 1724], 'signaling,': [1372, 1726, 2241], 'Src': [1373, 1727], 'kinase': [1374, 1728], 'phosphorylation,': [1375, 1729], 'neurotransmitter': [1377, 1731], 'CD36-positive': [1381, 1735], 'gustatory': [1382, 1736], 'cells.J.': [1383, 1737], 'Chem.': [1385, 1437, 1487, 1535, 1602, 1739, 3486], '283:': [1387, 1741], '12949-12959Abstract': [1388, 1742], '(153)': [1396, 1750], '19Pietka': [1399], 'T.A.': [1400], 'Sulkin': [1401], 'M.S.': [1402, 2033, 2097, 4065], 'Kuda': [1403], 'O.': [1404, 1457, 1572, 3456], 'Wang': [1405, 2764], 'Zhou': [1407, 4122], 'D.': [1408, 3062, 3103], 'Yamada': [1409], 'K.A.': [1410, 1768], 'Yang': [1411, 3096], 'Su': [1413, 1464, 1579, 3463], 'Gross': [1415, 1466, 1581, 3465], 'R.W.': [1416, 1467, 1582, 3466], 'Nerbonne': [1417], 'J.M.': [1418], 'al.CD36': [1420], 'influences': [1422, 1698], 'myocardial': [1423], 'Ca2+': [1424], 'homeostasis': [1425], 'phospholipid': [1427], 'conduction': [1429], 'anomalies': [1430], 'during': [1434, 3991], 'fasting.J.': [1435], '287:': [1439], '38901-38912Abstract': [1440], '(28)': [1448], 'MAPK': [1453], 'ERK1/2': [1454], '(20Kuda': [1456, 1571, 3455], 'Jenkins': [1458, 1573, 3457], 'C.M.': [1459, 1574, 3099, 3458], 'Skinner': [1460, 1575, 3459], 'Moon': [1462, 1577, 3461], 'S.H.': [1463, 1578, 3462], 'involved': [1473, 1588, 3415, 3472], 'store-operated': [1475, 1590, 3474], 'flux,': [1477, 1592, 3476], 'phospholipase': [1478, 1593, 3477], 'A2': [1479, 1594, 3478], 'activation,': [1480, 1595, 3479], 'production': [1482, 1597, 3481, 3890], 'E2.J.': [1485, 1600, 3484], '286:': [1489, 1537, 1604, 3488], '17785-17795Abstract': [1490, 1605, 3489], '(69)': [1498, 1613, 3497], '21Tran': [1501], 'T.T.T.': [1502], 'Poirier': [1503], 'Clément': [1505], 'Pelsers': [1509], 'M.M.A.L.': [1510], 'Petit': [1511], 'V.': [1512, 2031, 2095, 4063], 'Degrace': [1513], 'Monnot': [1515], 'M-C.': [1516], 'Glatz': [1517], 'J.F.C.': [1518], 'al.Luminal': [1522], 'regulates': [1524, 3444], 'downstream': [1528], 'stimulate': [1531], 'synthesis.J.': [1533], '25201-25210Abstract': [1538], '(97)': [1546], 'An': [1549], 'consequence': [1551], "CD36's": [1553], 'ability': [1554], 'signal': [1556], 'intracellular': [1558], 'regulation': [1562, 2142, 2769], '(PG)': [1570], 'compounds': [1617], 'pleiotropic': [1619], 'inhibition': [1623], '(22Björnsson': [1628, 3565], 'O.G.': [1629, 3566], 'Sparks': [1630, 1632, 3567, 3569], 'C.E.': [1633, 3570], 'Gibbons': [1634, 3571], 'G.F.': [1635, 3572], 'Prostaglandins': [1636, 3573], 'suppress': [1637, 1672, 3574, 3609], 'primary': [1641, 1681, 2389, 2913, 3578, 3618], 'rat': [1642, 1682, 3579, 3619], 'hepatocyte': [1643, 3509, 3562, 3580, 3737], 'cultures:': [1644, 3581], 'relationships': [1645, 3582], 'metabolism.J.': [1649, 3586], '1992;': [1652, 3589], '33:': [1653, 3590], '1017-1027Abstract': [1654, 3591], '23Pérez': [1661, 3598], 'Chico': [1667, 3604], 'Y.': [1668, 1939, 1941, 2763, 3605, 3936, 3938], '2-series': [1670, 3607], 'inflammatory': [1677, 3614], 'condition-dependent': [1678, 3615], 'manner': [1679, 3616], 'hepatocytes..Biochim.': [1683, 3620], 'Biophys.': [1684, 3621], 'Acta.': [1685, 3622], '176:': [1687, 3624], '160-171Crossref': [1688, 3625], '(36)': [1690, 3627], 'PG,': [1696], 'other': [1702, 3823, 4173], 'secretory': [1703], 'events,': [1704], 'FA-triggered': [1706], 'neurotransmitters': [1709], 'pancreatic': [1757, 1788], 'islets': [1758], '(24Noushmehr': [1759], "D'Amico": [1761], 'Farilla': [1763], 'Hui': [1765], 'Wawrowsky': [1767], 'Mlynarski': [1769], 'Doria': [1771], 'Perfetti': [1775], 'Fatty': [1777], '(FAT/CD36)': [1780], 'Is': [1781], 'localized': [1782], 'insulin-containing': [1784], 'granules': [1785], 'human': [1787, 3965], 'β-cells': [1789], 'secretion.Diabetes.': [1797], '2005;': [1798, 3082], '54:': [1799], '472-481Crossref': [1800], 'fat-induced': [1806], 'enterocytes': [1810], 'peptides': [1836], 'enteroendocrine': [1838], 'A': [1876], 'possible': [1877], 'remains': [1885], 'unexplored.': [1886], 'present': [1889], 'study,': [1890], 'deficiency': [1897, 3039, 3068, 3636, 3908], 'stores,': [1901], 'output,': [1905], 'PG': [1907, 2145, 2812, 2829, 2874, 3453, 3501, 3549, 3639, 3680, 3752, 3779, 3876, 3889], 'knockout': [1911], '(CD36−/−)': [1912], 'wild-type': [1914], '(WT)': [1915], 'mice.': [1916, 3186, 3312, 3764, 4277], 'determined': [1919, 2559, 2667, 2815, 3192, 3228, 3301], 'deficient': [1932], 'satiety': [1935], 'factor': [1936], 'leptin': [1937, 2269, 4148, 4238], '(25Takahashi': [1938, 3935], 'Soejima': [1940, 3937], 'Fukusato': [1942, 3939], 'Animal': [1944, 2287, 3941], 'disease/nonalcoholic': [1950, 3947], 'steatohepatitis.World': [1951, 3948], 'Gastroenterol.': [1953, 3950], '18:': [1955, 3952], '2300-2308Crossref': [1956, 3953], '(394)': [1959, 3956], 'hyperphagic': [1966, 3925], 'spontaneously': [1968], 'develops': [1969], 'Enhanced': [1974], '(26Perfield': [1987, 4019], '2nd,': [1988, 4020], 'J.W.': [1989, 4021], 'Ortinau': [1990, 4022], 'L.C.': [1991, 4023], 'Pickering': [1992, 4024], 'R.T.': [1993, 4025], 'Ruebel': [1994, 4026], 'M.L.': [1995, 4027], 'Meers': [1996, 4028], 'G.M.': [1997, 4029], 'Rector': [1998, 4030], 'R.S.': [1999, 4031], 'Altered': [2000, 4032], 'leptin-deficient': [2011, 3924, 4043], 'Ob/Ob': [2012, 4044], 'Obes.': [2014, 4046], ':': [2016, 4048], '296537PubMed': [2017, 4049], '27Moon': [2020, 4052], 'Y.A.': [2021, 2085, 4053], 'Liang': [2022, 2086, 4054], 'G.': [2023, 2087, 4055], 'Frank-Kamenetsky': [2026, 2090, 4058], 'Fitzgerald': [2028, 2092, 4060], 'Koteliansky': [2030, 2094, 4062], 'Brown': [2032, 2096, 4064], 'Goldstein': [2034, 2098, 4066], 'J.L.': [2035, 2099, 4067], 'Scap/SREBP': [2039, 2103, 4071], 'essential': [2042, 2106, 4074], 'developing': [2044, 2108, 4076], 'diabetic': [2045, 2109, 4077], 'carbohydrate-induced': [2049, 2113, 4081], 'hypertriglyceridemia': [2050, 2114, 4082], 'animals.Cell': [2052, 2116, 4084], '240-246Abstract': [2056, 2120, 4088], '(233)': [2064, 2128, 4096], 'inhibiting': [2071], 'master': [2075], 'lipogenic': [2076], 'regulators,': [2077], 'sterol': [2079], 'regulatory': [2080], 'element-binding': [2081], 'proteins': [2082], '(SREBPs)': [2083], '(27Moon': [2084], 'Overall,': [2131], 'novel': [2136], 'Sources': [2160, 2206], 'materials:': [2162], '[3H]Oleic': [2163], '(OA)': [2165], '(American': [2166], 'Radiolabeled': [2167], 'Chemicals),': [2168], '[35S]protein': [2169, 2732], 'labeling': [2170, 2733], 'mix': [2171, 2734], '(PerkinElmer,': [2172, 2196], 'Downers': [2173], 'Grove,': [2174], 'IL),': [2175], 'Triton': [2176, 2531, 2620, 3198], 'WR-1339': [2177], '(Tyloxapol),': [2178], 'Sc-236,': [2179], 'Sc-560': [2180], '(Sigma,': [2181], 'St.': [2182, 2203], 'Louis,': [2183], 'MO),': [2184], 'silica': [2185], 'Gel': [2186], '60': [2187], 'plates': [2188], '(Fisher': [2189], 'Scientific,': [2190], 'Pittsburg,': [2191], 'PA),': [2192], 'alphaLISA®': [2193], 'Kit': [2195], 'Waltham,': [2197], 'MA),': [2198, 2236, 2243], 'Immunobilon': [2199], 'FL': [2200, 2382], 'membranes': [2201], '(Millipore,': [2202], 'Charles,': [2204], 'MO).': [2205], 'antibodies:': [2208], '(R': [2210], 'D': [2212], 'Systems,': [2213], 'Inc.,': [2214], 'Minneapolis,': [2215], 'MN),': [2216], 'CD68,': [2217], 'perilipins': [2218], '1': [2219, 2238], '3': [2221, 2542, 2816, 3641], '(PLIN1,': [2222], 'PLIN3),': [2223], 'β-actin': [2224], '(Santa': [2225], 'Cruz': [2226], 'Biotechnology,': [2227], 'Santa': [2228], 'Cruz,': [2229], 'CA),': [2230, 2249], 'Ran,': [2231], 'PLIN': [2232], '5': [2233, 2613, 2700, 2798], '(Abcam,': [2234], 'Cambridge,': [2235], 'cyclooxygenase': [2237, 3696, 3795], '(COX-1)': [2239], '(Cell': [2240], 'Boston,': [2242], 'COX-2': [2244, 3703, 3854], '(BD': [2245], 'Transduction,': [2246], 'San': [2247], 'Jose,': [2248], 'PLIN2': [2250], '(Antibodies-online.com,': [2251], 'Atlanta,': [2252, 2523], 'GA).': [2253, 2524], 'CD36−/−': [2254, 3214, 3287, 3311, 3322, 3392, 3668, 3730, 3763, 3839], 'C57BL/6J': [2260], 'background': [2261], 'bred': [2263], 'generate': [2265], 'double-knockout': [2267], '(ob-CD36−/−).': [2272], 'used': [2275, 2454, 2870, 2953, 3027, 3930], 'at': [2276, 2393, 2539, 2650, 2656, 3034, 3869], '4–6': [2277], 'months': [2278], 'age.': [2280], 'All': [2281], 'protocols': [2282], 'approved': [2284], 'Study': [2288], 'Committee': [2289], 'Washington': [2291], 'University.': [2292], 'Serum': [2293, 4249], 'TG,': [2294], 'glucose,': [2295], 'measured': [2299, 2329], 'after': [2300, 2311, 2544, 3643], 'overnight': [2302], 'fast,': [2303], 'glucose': [2305, 2326, 2497, 4254, 4280], 'tolerance': [2306, 4281], 'tests': [2307], '(GTT)': [2308], 'performed': [2310], '6': [2313], 'h': [2314, 2392, 2494, 2543, 2614, 2625, 2655, 2799, 2817, 2921, 3642], 'fast.': [2315], 'For': [2316, 2355, 2672, 2724, 2902, 2942], 'GTT,': [2317], 'intraperitoneally': [2320], 'injected': [2321, 2529, 2618], '2': [2323, 2391, 2624, 2920], 'g/kg': [2324], 'glucose;': [2325], 'tail': [2331], 'vein': [2332], 'blood': [2333, 2627], '(OneTouch;': [2334], 'LifeScan,': [2335], 'Milpitas,': [2336], 'CA).': [2337, 2371, 2451], 'Lipids': [2338], 'extracted': [2340, 2417], '(chloroform:methanol': [2341], '2:1,': [2342], 'v/v)': [2343], 'analyzed': [2345, 2547], '(Wako': [2348, 2552], 'Chemicals,': [2349], 'Richmond,': [2350], 'VA)': [2351], 'composition.': [2354], 'latter,': [2357], 'extracts': [2358, 2704, 2822], 'methyl-esterified': [2360], 'quantified': [2362], 'gas-liquid': [2364], 'chromatography': [2365], '(HP': [2366], '5890;': [2367], 'Hewlett-Packard,': [2368], 'Palo': [2369], 'Alto,': [2370], 'Liver': [2372, 2413, 2488, 2507, 3500, 3781, 4160, 4293], 'proteins,': [2373], 'separated': [2374], '4–20%': [2376], 'SDS-PAGE': [2377], 'transferred': [2379], 'immunobilon': [2381], 'membranes,': [2383], 'blocked': [2385], 'antibodies': [2390, 2914, 2934, 2951], 'room': [2394], 'temperature.': [2395], 'Proteins': [2396], 'visualized': [2398, 2923], 'Odyssey': [2401], 'Imaging': [2402], 'System': [2403], '(LI-COR': [2404], 'Odyssey,': [2405], 'Lincoln,': [2406], 'NE)': [2407], 'near-infrared': [2409], 'labeled': [2410], 'secondary': [2411, 2950], 'antibodies.': [2412], 'RNA': [2414], '(2': [2415, 2505], 'μg)': [2416], 'TRIzol': [2419], '(Invitrogen,': [2420], 'Carlsbad,': [2421], 'CA)': [2422], 'subjected': [2424, 2710, 2841], 'cDNA': [2426], 'Reverse': [2427], 'Transcription': [2428], 'RT': [2430], 'quantitative': [2431], 'PCR': [2432, 2445], '(ABI': [2433], 'Prim': [2434], '7000': [2435], 'Sequence': [2436], 'Detection': [2437], 'System,': [2438], 'Applied': [2439], 'Biosystems)': [2440], 'Power': [2442], 'SYBR': [2443], 'Green': [2444], 'Mix': [2446], '(Applied': [2447], 'Biosystems,': [2448], 'Foster': [2449], 'City,': [2450], 'Real-time': [2452], 'primers': [2453], 'were:': [2455], 'CD36:': [2456], 'forward,': [2457, 2463, 2472, 2479, 2484], 'GATGACGTG': [2458], 'GCAAAGAACAG;': [2459], 'reverse,': [2460, 2466, 2474, 2481, 2486], 'CAGTGAAGGCTCAAAGATGG.': [2461], '18S:': [2462], 'GTAACCCGT': [2464], 'TGAACCCCATT;': [2465], 'CCATCCAATCGGTAGTAGCG.': [2467], 'Peroxisome': [2468], 'proliferator-activated': [2469], '(PPAR)γ:': [2471], 'TTGACCCAGAGCATGGTGC;': [2473], 'GAAGTTGGTGGGCCAGAATG.': [2475], 'Diglyceride': [2476], 'acyltransferase': [2477], '(DGAT)1:': [2478], 'TCCGCCTCTGGGCATTC;': [2480], 'GAATCGGCCCACAATCCA.': [2482], 'DGAT2:': [2483], 'AGAACCGCAAAGGCTTTGTG;': [2485], 'AGGAATAAGTGGGAACCAGATCAG.': [2487], '4': [2493, 2654], 'high': [2496], 'DMEM': [2498, 2691], '(150': [2501], 'nM)': [2502], '14C-acetic-acid': [2504], 'µCi/ml).': [2506], 'washed': [2510], 'cold': [2512], 'PBS,': [2513], 'homogenates': [2515], 'counted': [2517, 2721], 'radioactivity': [2519], '(Betafluor,': [2520], 'National': [2521], 'Diagnostics,': [2522], 'Overnight': [2525], 'fasted': [2526, 2615, 2796], 'WR': [2532, 2621], '1339': [2533], '(Tyloxapol).': [2534], 'Blood': [2535], 'samples': [2536], 'collected': [2538, 2629], 'baseline': [2540], 'injection': [2545], 'Chemicals).': [2553], 'vivo': [2555, 3194, 3317], 'previously': [2562], '(28Li': [2563, 3234], 'Catalina': [2565, 3236], 'Grundy': [2567, 3238], 'S.M.': [2568, 3239], 'Patel': [2569, 3240], 'Method': [2571, 3242], 'measure': [2573, 3244], 'apolipoprotein': [2574, 3245], 'B-48': [2575, 3246], 'B-100': [2577, 3248], 'rates': [2579, 3250], 'individual': [2582, 3253], 'mouse:': [2583, 3254], 'evidence': [2584, 3255], 'very': [2587, 3258], 'rapid': [2588, 3259], 'turnover': [2589, 3260], 'preferential': [2593, 3264], 'removal': [2594, 3265], 'B-48-': [2596, 3267], 'relative': [2597, 2873, 3268], 'B-100-containing': [2599, 3270], 'lipoproteins.J.': [2600, 3271], '1996;': [2603, 3274], '37:': [2604, 3275], '210-220Abstract': [2605, 3276], 'Briefly,': [2612, 2819], '1339,': [2622], 'later': [2626], 'tubes': [2631], 'containing': [2632, 2692, 3792], 'protease': [2633], 'inhibitors.': [2634], 'lipoprotein': [2636], 'fraction': [2637, 2665, 2719, 3233], '(d': [2638], '<': [2639, 2663], '1.063': [2640, 2664], 'g/ml)': [2641], 'isolated': [2643, 3231], 'from': [2644, 3077, 3151, 3308, 3321, 3336, 3667, 3729, 3762, 3816, 3838], 'equal': [2645], 'volumes': [2647], 'ultracentrifugation': [2649], '100,000': [2651], 'rpm': [2652], '10°C.': [2657], 'ApoB': [2658], 'd': [2662], 'Western': [2669], 'blot': [2670], 'analysis.': [2671], 'determination': [2675], '(equivalent': [2683], 'weights)': [2685], '(3': [2688, 2735], 'h)': [2689, 2736], '800': [2693, 2740], 'µM': [2694, 2741, 3794], 'OA': [2695], '(OA:BSA': [2696], '=': [2697], '2)': [2698], 'µCi/ml': [2701], '3[H]oleate.': [2702], 'media': [2708], 'TLC': [2712], '(hexane:diethylether:acetic': [2713], 'acid,': [2714], '75:25:1),': [2715], 'radioactivity.': [2723], 'presence': [2738, 3773], 'OA.': [2742], '[35S]apoB': [2743], 'immunoprecipitated': [2745], 'before': [2746], 'separation': [2747], '4–12%': [2749], 'SDS-gels.': [2750], 'Microsomal': [2751], '(MTTP)': [2754], 'activity': [2755, 3384], 'assayed': [2757, 3771], '(29Pan': [2760], 'Zhang': [2762], 'Hussain': [2766], 'M.M.': [2767], 'Diurnal': [2768], 'MTP': [2771], 'plasma': [2773, 3982, 3988], 'CLOCK': [2776], 'SHP.Cell': [2780], '12:': [2783], '174-186Abstract': [2784], '(147)': [2792], 'administered': [2801], 'intragastrically': [2802], '1/1': [2803], 'olive': [2804], 'oil/corn': [2805], 'oil': [2806, 3645], '(16.5': [2807, 3647], 'µl/g': [2808, 3648], 'body': [2809, 3160, 3168, 3649, 4242, 4295], 'weight).': [2810, 3650], 'later.': [2818], '(chloroform/methanol,': [2823], '2:1)': [2824], 'added': [2826], '(20': [2827], 'ng)': [2828], 'standards': [2830], '(PGF2α-d4,': [2831], 'PGE2-d4,': [2832], 'PGD2-d4)': [2833], '(Cayman': [2834], 'Chemical': [2835], 'Co.,': [2836], 'Ann': [2837], 'Arbor,': [2838], 'MI)': [2839], 'oximation': [2843], 'O-methoxyamine-HCL': [2845], 'NaOAc,': [2847], 'followed': [2848], 'derivatization': [2850], 'pentafluorobenxyl': [2852], 'bromide': [2853], 'acetonitrile': [2855], 'BSTFA/TMCS': [2857], 'gas': [2859], 'chromatography-mass': [2860], 'spectroscopy': [2861], '(GC-MS).': [2862], 'Areas': [2863], 'native': [2865], 'compound': [2866], 'standard': [2868], 'computing': [2872], 'fixed': [2877], '10%': [2879], 'formalin': [2880], 'embedded': [2882, 2974], 'paraffin': [2884], 'stained': [2886, 2892, 2939, 2992], 'CD36.': [2888], 'Frozen': [2889], 'sections': [2890, 2904, 3715], 'Oil': [2894], 'Red': [2895], 'O': [2896], '(ORO)': [2897], '(0.3%': [2898], 'isopropanol).': [2901], 'immunofluorescence,': [2903], 'permeabilized': [2905], '0.5%': [2907], 'Triton-X': [2908], '100': [2909], 'CD68': [2918], 'fluorescein-': [2925], '(CD36,': [2926], 'green)': [2927], 'rhodamine-': [2929], '(CD68,': [2930], 'red)': [2931], '(1/200)': [2932], 'conjugated': [2933], '(Jackson': [2935], 'ImmunoResearch).': [2936], 'DAPI': [2937], '(blue)': [2938], 'nuclei.': [2941], 'fluorescence': [2943], 'immunostaining': [2944], 'COX-1': [2946, 3698, 3717, 3799, 3847, 3881], 'COX-2,': [2948], 'Alexa-conjugated': [2949], '(Invitrogen).': [2954], 'Tissues': [2955], 'immersion-fixed': [2957], "Karnovsky's": [2959], 'fixative,': [2960], 'postfixed': [2961], '1%': [2963], 'osmium': [2964], 'tetroxide,': [2965], 'dehydrated': [2966], 'graded': [2968], 'ethanol': [2969], 'propylene': [2971], 'oxide': [2972], '(Embed': [2975], '812,': [2976], 'Electron': [2977], 'Microscopy': [2978, 3021], 'Sciences,': [2979], 'Hatfield,': [2980], 'PA).': [2981], 'Sections': [2982], '(90': [2983], 'nm': [2984], 'thick)': [2985], '200': [2987], 'mesh': [2988], 'copper': [2989], 'grids': [2990], 'uranyl': [2994], 'acetate': [2995], 'lead': [2997], 'citrate': [2998], 'viewed': [3000], '(JEOL': [3001], 'model': [3002, 3932, 4119], '1200EX': [3003], 'electron': [3004], 'microscope,': [3005], 'Tokyo,': [3006], 'Japan).': [3007], 'Digital': [3008], 'images': [3009], 'acquired': [3011], 'high-definition': [3014], 'CCD,': [3015], '1.3': [3016], 'megapixel': [3017], 'TEM': [3018], 'camera': [3019], '(Advanced': [3020], 'Techniques,': [3022], 'Danvers,': [3023], 'MA).': [3024], 'Statistical': [3025], 'analyses': [3026], 'Student': [3028], 't-test.': [3029], 'Differences': [3030], 'considered': [3032], 'P': [3035], '≤': [3036], '0.05.': [3037], 'reduces': [3040, 3866], 'lymph': [3044], 'TG-rich': [3047, 3149], 'intestinal': [3049, 3070], 'chylomicrons': [3050, 3076], '(30Drover': [3051], 'V.A.': [3052], 'Ajmal': [3053], 'Nauli': [3059], 'A.M.': [3060, 3091], 'Sahoo': [3061], 'Tso': [3063, 3108], 'impairs': [3069], 'clearance': [3074, 3202], 'blood.J.': [3079], '115:': [3083], '1290-1297Crossref': [3084], '(191)': [3087], '31Nauli': [3090], 'Zheng': [3094], 'Q.': [3097], 'Lo': [3098], 'Vonlehmden': [3100], 'S.B.': [3101], 'Jandacek': [3104], 'R.J.': [3105], 'mediate': [3120], 'cholesterol': [3121], 'proximal': [3125], 'intestine.Gastroenterology.': [3126], '131:': [3128], '1197-1207Abstract': [3129], '(146)': [3137], 'whether': [3142, 3749, 3903], 'alter': [3146], '20%': [3158], 'smaller': [3159], 'weight': [3161, 3169, 4243, 4296], '(data': [3162, 3380], 'shown);': [3164], 'ratio': [3170], '(Fig.': [3171, 3177, 3220, 3293, 3339, 3394, 3674, 3687, 3699, 3710, 3718, 3819, 3857, 4247, 4251, 4255, 4265, 4291, 4308, 4315], '1A)': [3172], '1B,': [3178], 'C)': [3179], 'similar': [3181], 'those': [3183, 4304], 'WT': [3185, 3218, 3291, 3309, 3337, 3672, 3817], 'Secretion': [3187, 3222], 'given': [3197], 'WR1339': [3199], 'block': [3201], 'newly': [3204], 'secreted': [3205, 3324], 'found': [3208], 'about': [3211], 'compared': [3216, 3289, 3333, 3670, 4274, 4332], '1D).': [3221, 3294], 'both': [3224, 4235], 'apoB100': [3225], 'apoB48,': [3227], 'clearly': [3284], 'Triglyceride': [3295], 'obtained': [3307], 'Consistent': [3313], 'data,': [3318], 'less': [3325], 'medium': [3331, 3787, 3791], '1E).': [3340], 'MTTP': [3341, 3386, 3401], 'critical': [3343], 'assembly': [3346, 3364], '(32Sundaram': [3349], 'Yao': [3351], 'Z.': [3352], 'progress': [3354], 'understanding': [3356], 'secretion.Nutr.': [3366], '(Lond.).': [3368], '7:': [3370], '35Crossref': [3371], '(120)': [3374], 'shown)': [3382], 'normal': [3388, 3504], 'livers': [3390, 3666, 3728, 3761, 4312], '1F),': [3395], 'indicating': [3396, 3739], 'impairment': [3399], 'function': [3402, 3510], 'did': [3403, 3432], 'defect': [3408], 'Expression': [3412], 'genes': [3414], 'DGAT1,': [3421], 'DGAT2,': [3422], 'PPARγ,': [3424], 'synthase': [3431], 'change': [3434], 'genotype': [3438], '(supplementary': [3439], 'Fig.': [3440], 'I).': [3441], 'activated': [3446], 'arachidonic': [3449], '(AA)': [3451], 'produced': [3502], 'pathological': [3506], 'conditions': [3507], 'modulate': [3508], '(33Kuiper': [3511], 'Zijlstra': [3513], 'F.J.': [3514], 'Kamps': [3515], 'J.A.': [3516], 'Van': [3517], 'Berkel': [3518], 'T.J.': [3519], 'communication': [3521], 'inside': [3522], 'Binding,': [3525], 'conversion': [3526], 'D2': [3532], 'cells.Biochem.': [3536], '1989;': [3538], '262:': [3539], '195-201Crossref': [3540], '(33)': [3543], 'major': [3547, 3655, 4112], '(PGD2,': [3550], 'PGF2,': [3551], 'PGE2)': [3553, 3661], 'investigated': [3631], 'intragastric': [3644], 'administration': [3646], 'Levels': [3651, 3701], 'three': [3654], '(PGF2,': [3658], 'PGD2,': [3659], 'significantly': [3663], 'higher': [3664, 3684, 3690, 3706, 4328], '2A).': [3675], 'appeared': [3681, 4313], 'reflect': [3683], 'AA': [3685], '2B)': [3688], 'key': [3695, 4138], 'enzyme': [3697], '2C).': [3700], 'trended': [3705], 'reaching': [3708], 'significance': [3709], '2D).': [3711], 'Staining': [3712], '2E)': [3719], 'showed': [3720], 'clear': [3722], 'mice;': [3731], 'primarily': [3734], 'occurred': [3735], 'sinusoids,': [3738], 'involves': [3741], 'macrophages.': [3745], 'next': [3747, 3899], 'altered': [3751], 'impaired': [3757, 4279], 'absence': [3775], 'synthesis.': [3780], 'control': [3786], '(CT)': [3788], '10': [3793], '(SC-560': [3797], 'SC-236': [3801, 3856], 'COX-2).': [3803], 'Both': [3804], 'modestly': [3806], '(1.4-': [3807], '1.7-fold)': [3809], 'augmented': [3810], '2F).': [3820, 3858], 'hand,': [3824], 'much': [3828], 'pronounced': [3830], 'mice,': [3840], '8-fold': [3844], 'inhibitor': [3848, 3855], 'SC-560': [3849], 'Together,': [3859], 'least': [3870], 'part': [3872], 'altering': [3874], 'would': [3887], 'neighboring': [3896], 'sought': [3900], 'determine': [3902], 'could': [3913], 'certain': [3918], 'conditions.': [3920], 'chose': [3922], 'mouse,': [3927], 'commonly': [3929], 'animal': [3931], 'two': [3960], 'reasons.': [3961], 'First,': [3962], '(34Diraison': [3967], 'Moulin': [3969], 'Beylot': [3971], 'Contribution': [3973], 'reesterification': [3980], 'non': [3983], 'esterified': [3984], 'acids': [3986], 'disease.Diabetes': [3995], '2003;': [3997], '29:': [3998], '478-485Crossref': [3999], '(307)': [4002], 'obesity-associated,': [4012], 'spontaneous,': [4013], 'Second,': [4099], 'hepatocytes': [4105], 'contributor': [4113], 'this': [4118], '(35Ge': [4120], 'Hu': [4124], 'Lobdell': [4126], 'Berk': [4128], 'P.D.': [4129], 'Insulin-': [4130], 'leptin-regulated': [4132], 'causal': [4139], 'intact': [4147], 'db/db': [4155], 'mice.Am.': [4156], 'Physiol.': [4158, 4161], 'Gastrointest.': [4159], '299:': [4163], 'G855-G866Crossref': [4164], '(49)': [4167], 'contrast': [4171], 'ob-CD36−/−': [4230, 4271, 4299, 4311, 4330], 'knocked': [4232], 'out': [4233], '∼30%': [4240], 'lower': [4241, 4269], 'than': [4244], '3A).': [4248], '3B)': [4252], '3C)': [4256], '(30%': [4259], '40%,': [4261], 'respectively),': [4262], '3D)': [4266], '6-fold': [4268], 'ob-ob': [4283], 'dramatically': [4286], 'improved': [4287], '3E).': [4292], 'ratios': [4297], 'comparable': [4302], '3F).': [4309], '3G),': [4316], 'confirmed': [4319], 'measuring': [4321], '∼1.7-fold': [4327], 'o': [4334]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W1977425580', 'counts_by_year': [{'year': 2024, 'cited_by_count': 9}, {'year': 2023, 'cited_by_count': 11}, {'year': 2022, 'cited_by_count': 13}, {'year': 2021, 'cited_by_count': 9}, {'year': 2020, 'cited_by_count': 7}, {'year': 2019, 'cited_by_count': 6}, {'year': 2018, 'cited_by_count': 5}, {'year': 2017, 'cited_by_count': 5}, {'year': 2016, 'cited_by_count': 8}, {'year': 2015, 'cited_by_count': 9}, {'year': 2014, 'cited_by_count': 10}], 'updated_date': '2025-01-14T00:57:50.361339', 'created_date': '2016-06-24'}