Title: Lactobacillus paracasei normalizes muscle hypercontractility in a murine model of postinfective gut dysfunction
Abstract: Background & Aims: The effects of probiotics on gut dysfunction in postinfective irritable bowel syndrome are unknown. We tested whether probiotics influence persistent muscle hypercontractility in mice after recovery from infection with Trichinella spiralis and analyzed the underlying mechanisms. Methods: Mice were gavaged with Lactobacillus paracasei, Lactobacillus johnsonii, Bifidobacterium longum, or Bifidobacterium lactis in spent culture medium from days 10 to 21 after infection. Additional mice received heat-inactivated Lactobacillus paracasei, Lactobacillus paracasei-free spent culture medium, or heat-inactivated Lactobacillus paracasei-free spent culture medium. Lactobacilli enumeration, immunohistochemistry, and cytokine detection (enzyme-linked immunosorbent assay) were performed. Mice were also treated with Lactobacillus paracasei or Lactobacillus paracasei-free spent culture medium from days 18 to 28 after infection. Contractility was measured on days 21 and 28 after infection. Results: Lactobacillus paracasei, but not Lactobacillus johnsonii, Bifidobacterium lactis, or Bifidobacterium longum, attenuated muscle hypercontractility. This was associated with a reduction in the Trichinella spiralis-associated T-helper 2 response and a reduction in transforming growth factor-β1, cyclooxygenase-2, and prostaglandin E2 levels in muscle. Attenuation of muscle hypercontractility by Lactobacillus paracasei-free spent culture medium was abolished after heat treatment. Improvement of muscle hypercontractility at day 28 after infection was also observed after the administration ofLactobacillus paracasei or Lactobacillus paracasei-free spent culture medium from day 18 after infection. Conclusions: Probiotics show strain-dependent attenuation of muscle hypercontractility in an animal model of postinfective irritable bowel syndrome. This likely occurs via both a modulation of the immunologic response to infection and a direct effect of Lactobacillus paracasei or a heat-labile metabolite on postinfective muscle hypercontractility. Lactobacillus paracasei may be useful in the treatment of postinfective irritable bowel syndrome. Background & Aims: The effects of probiotics on gut dysfunction in postinfective irritable bowel syndrome are unknown. We tested whether probiotics influence persistent muscle hypercontractility in mice after recovery from infection with Trichinella spiralis and analyzed the underlying mechanisms. Methods: Mice were gavaged with Lactobacillus paracasei, Lactobacillus johnsonii, Bifidobacterium longum, or Bifidobacterium lactis in spent culture medium from days 10 to 21 after infection. Additional mice received heat-inactivated Lactobacillus paracasei, Lactobacillus paracasei-free spent culture medium, or heat-inactivated Lactobacillus paracasei-free spent culture medium. Lactobacilli enumeration, immunohistochemistry, and cytokine detection (enzyme-linked immunosorbent assay) were performed. Mice were also treated with Lactobacillus paracasei or Lactobacillus paracasei-free spent culture medium from days 18 to 28 after infection. Contractility was measured on days 21 and 28 after infection. Results: Lactobacillus paracasei, but not Lactobacillus johnsonii, Bifidobacterium lactis, or Bifidobacterium longum, attenuated muscle hypercontractility. This was associated with a reduction in the Trichinella spiralis-associated T-helper 2 response and a reduction in transforming growth factor-β1, cyclooxygenase-2, and prostaglandin E2 levels in muscle. Attenuation of muscle hypercontractility by Lactobacillus paracasei-free spent culture medium was abolished after heat treatment. Improvement of muscle hypercontractility at day 28 after infection was also observed after the administration ofLactobacillus paracasei or Lactobacillus paracasei-free spent culture medium from day 18 after infection. Conclusions: Probiotics show strain-dependent attenuation of muscle hypercontractility in an animal model of postinfective irritable bowel syndrome. This likely occurs via both a modulation of the immunologic response to infection and a direct effect of Lactobacillus paracasei or a heat-labile metabolite on postinfective muscle hypercontractility. Lactobacillus paracasei may be useful in the treatment of postinfective irritable bowel syndrome. It is generally accepted that symptoms of irritable bowel syndrome (IBS) originate from gut dysfunction that includes altered motility and sensory perception. IBS may occur in 7%–30% of patients recovering from bacterial gastroenteritis,1Gwee K.A. Graham J.C. McKendrick M.W. Collins S.M. Marshall J.S. Walters S.J. Read N.W. Psychometric scores and persistence of irritable bowel after infectious diarrhoea.Lancet. 1996; 347: 150-153Abstract Full Text PDF PubMed Scopus (479) Google Scholar, 2Neal K.R. Hebden J. Spiller R. Prevalence of gastrointestinal symptoms six months after bacterial gastroenteritis and risk factors for development of the irritable bowel syndrome postal survey of patients.BMJ. 1997; 314: 779-782Crossref PubMed Scopus (535) Google Scholar, 3McKendrick M.W. Read N.W. Prevalence of gastrointestinal symptoms six months after bacterial gastroenteritis and risk factors for development of the irritable bowel syndrome: postal survey of patients. Irritable bowel syndrome-post salmonella infection.J Infect. 1999; 29: 1-33Abstract Full Text PDF Scopus (280) Google Scholar, 4Osterholm M.T. MacDonald K.L. White K.E. Wells J.G. Spika J.S. Potter M.E. Forfang J.C. Sorenson R.M. Milloy P.T. Blake P.A. An outbreak of a newly recognized chronic diarrhea syndrome associated with raw milk consumption.JAMA. 1986; 256: 484-490Crossref PubMed Scopus (91) Google Scholar, 5Parsonnet J. Trock S.C. Bopp C.A. Wood C.J. Addiss D.G. Alai F. Gorelkin L. Hargrett-Bean N. Gunn R.A. Tauxe R.V. Chronic diarrhea associated with drinking untreated water.Ann Intern Med. 1989; 110: 911-985Crossref Scopus (33) Google Scholar and acute bacterial gastroenteritis is the strongest recognized environmental risk factor for the development of IBS.6Rodriguez L.A. Ruigomez A. Increased risk of irritable bowel syndrome after bacterial gastroenteritis cohort study.BMJ. 1999; 318: 565-566Crossref PubMed Google Scholar Patients with postinfective IBS (PI-IBS) have a profile of sensorimotor dysfunction similar to that seen in IBS patients.7Bergin A.J. Donnelly T.C. McKendrick M.W. Read N.W. Changes in anorectal function in persistent bowel disturbance following salmonella gastroenteritis.Eur J Gastroenterol Hepatol. 1993; 5: 617-620Crossref Scopus (55) Google Scholar Patients with PI-IBS show increased intestinal permeability and increased numbers of lymphocytes in rectal biopsy samples.8Spiller R.C. Jenkins D. Thornley J.P. Hebden J. Wright T. Skinner M. Neal K.R. Increased rectal mucosal enteroendocrine cells, T lymphocytes and increased gut permeability following acute Campylobacter enteritis and in post-dysenteric irritable bowel syndrome.Gut. 2000; 47: 801-811Crossref Scopus (1030) Google Scholar These observations, taken in conjunction with animal studies,9Barbara G. De Giorgio R. Deng Y. Vallance B. Blennerhassett P. Collins S.M. Role of immunologic factors and cyclooxygenase 2 in persistent postinfective enteric muscle dysfunction in mice.Gastroenterology. 2001; 120: 1729-1736Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar suggest that immune activation maintains gut dysfunction in the PI state. Because acute gastroenteritis has been shown to disrupt intestinal microbiota,10Fujita K. Kaku M. Ezaki T. Faruse K. Ozawa A. Saidi S.M. Sang W.K. Waiyaki P.G. Physicochemical characteristics and flora of diarrhoeal and recovery faeces in children with acute gastro-enteritis in Kenya.Ann Trop Paediatr. 1990; 10: 339-345PubMed Google Scholar, 11Albert M.J. Bhat P. Rajan D. Maiya P.P. Pereira S.M. Mathan M. Baker S.J. Jejunal microbial flora of southern indian infants in health and with acute gastroenteritis.J Med Microbiol. 1978; 11: 433-440Crossref Scopus (16) Google Scholar it is possible that shifts in commensal bacterial populations may contribute to PI gut dysfunction, either directly by modulating neuromuscular excitability12Husebye E. Hellstrom P.M. Sundler F. Chen J. Midtvedt T. Influence of microbial species on small intestinal myoelectric activity and transit in germ-free rats.Am J Physiol. 2000; 280: G368-G380Google Scholar or indirectly via the immune system.13Shroff K.E. Meslin K. Cebra J.J. Commensal enteric bacteria engender a self-limiting humoral response while permanently colonizing the gut.Infect Immun. 1995; 63: 3904-3913Crossref PubMed Google Scholar, 14Guy-Grand D. Griscelii C. Vassalli P. The mouse gut T lymphocyte, a novel type of T cell Nature, origin, and traffic in mice in normal and graft-versus-host conditions.J Exp Med. 1978; 148: 1661-1677Crossref PubMed Scopus (334) Google Scholar, 15MacDonald T.T. Carter P.B. Requirement for a bacterial flora before mice generate cells capable of mediating the delayed hypersensitivity reaction to sheep red blood cells.J Immunol. 1979; 122: 2426-2429Google Scholar It follows that correction of gut dysfunction by manipulating commensal microbiota offers therapeutic potential in PI-IBS. There have been no published trials of probiotics in PI-IBS; the role of probiotics in IBS thus remains inconclusive.16Niedzielin K. Kordecki H. Birkenfeld B. A controlled, double-blind randomized study on the efficacy of Lactobacillus plantarum 299V in patients with irritable bowel syndrome.Eur J Gastroenterol Hepatol. 2001; 13: 1143-1147Crossref PubMed Scopus (456) Google Scholar, 17O'Sullivan M.A. O'Morain C.A. Bacteria supplementation in the irritable bowel syndrome A randomised double-blind placebo-controlled crossover study.Dig Liver Dis. 2000; 32: 294-301Abstract Full Text PDF PubMed Google Scholar Previous work from our laboratory has shown that Trichinella spiralis infection in NIH Swiss mice produces changes in excitatory neurotransmission and increased contractility of muscle. These abnormalities persist after recovery of infection, thus generating a model of PI gut dysfunction. In this model, the altered postinflammation physiology is initiated by the T-helper 2 (Th2) cytokine response to the infection and is maintained subsequently by cyclooxygenase (COX)-2 and transforming growth factor (TGF)-β production in the neuromuscular layers of the gut.9Barbara G. De Giorgio R. Deng Y. Vallance B. Blennerhassett P. Collins S.M. Role of immunologic factors and cyclooxygenase 2 in persistent postinfective enteric muscle dysfunction in mice.Gastroenterology. 2001; 120: 1729-1736Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar, 18Akiho H. Deng Y. Blennerhassett P. Kanbayashi H. Barbara G. De Giorgio R. Collins S.M. The roles of TGFβ and COX-2 in the maintenance of muscle hypercontractility in a murine model of post infective irritable bowel syndrome.Gastroenterology. 2002; 122 (abstr): S958Google Scholar Thus, modulation of the immune response and its consequences may attenuate the development of the persistent alteration in gut physiology. This study examines the hypothesis that specific strains of probiotic bacteria, administered after an acute intestinal infection, normalize gut neuromuscular dysfunction that persists for 21 to 42 days after infection with T. spiralis in mice. Our results show that Lactobacillus paracasei, but not other tested probiotics, attenuates muscle hypercontractility in this model. Modulation of the underlying immunologic response and mediator generation in the muscularis externa is probably not the sole mechanism for improvement of PI muscle hypercontractility by probiotics. Administration of L. paracasei on days 10 to 21 after infection attenuated muscle hypercontractility by influencing the immune response to infection. A direct effect is also suggested because normalization of PI muscle hypercontractility was also observed when L. paracasei was administered from day 18 after infection, at a time when no discernible mucosal inflammation was observed in the intestine. The effects are strain specific and are seen with spent culture medium (SCM): this suggests that they are mediated by metabolites of bacteria. L. johnsonii NCC533, L. paracasei NCC2461, Bifidobacterium longum NCC2705, and B. lactis NCC362 were obtained from the Nestlé Culture Collection (Lausanne, Switzerland) and grown under anaerobic conditions in DE Man-Rogosa-Sharpe (MRS) broth (bifidobacteria with 0.5% cysteine). After 48 hours at 37°C, the number of bacteria was estimated by measuring the optical density at 600 nm (1 OD600 = 108 bacteria per milliliter). Bacterial cells were pelleted by centrifugation for 15 minutes at 5000g at 4°C, further resuspended at a concentration of 1010/mL in their SCM, and kept in frozen aliquots until use. L. paracasei in SCM was heat-inactivated by autoclaving (heat-inactivated L. paracasei). The SCM was filtered through 0.2 μmol/L to obtain bacteria-free SCM (L. paracasei-free SCM). Female NIH Swiss mice (6–8 weeks old) were purchased from the National Cancer Institute (Bethesda, MD) and kept under specific pathogen-free conditions at McMaster University central animal care facilities. All experiments were approved by the McMaster University Animal Care Committee and the Canadian Council on Animal Care. T. spiralis parasites were obtained from the department of zoology at the University of Toronto, and the colony was maintained through serial infections alternating between male Sprague-Dawley rats and male CD1 mice. The larvae were obtained from infected rodents after infection by using a modification19Vermillion D.L. Collins S.M. Increased responsiveness of jejunal longitudinal muscle in Trichinella-infected rats.Am J Physiol. 1988; 254: G124-G129PubMed Google Scholar of the technique described by Castro and Fairbairn.20Castro G. Fairbairn D. Carbohydrates and lipids in Trichinella spiralis larvae and their utilization.J Parasitol. 1969; 55: 51-58Crossref PubMed Scopus (107) Google Scholar Infections were performed by gavage of 375 T. spiralis larvae per mouse. To examine the effect of probiotics on the PI state, probiotics were administered on day 10 after infection. To ensure that the infection had cleared, we performed worm counts in 3 mice per group before the start of probiotic administration (day 10 after infection) and at days 12 and 14 after infection. The intestine was removed, opened longitudinally, rinsed, and placed in Hanks' balanced salt solution for 3 hours at 37°C. Recovered adult worms were counted under a dissecting microscope. To determine whether probiotic bacteria influence persistent muscular dysfunction, T. spiralis-infected mice were gavaged daily from day 10 to 21 after infection with 100 μL of MRS as control or with 100 μL of 1010 L. paracasei, L. johnsonii, B. longum, or B. lactis per milliliter of SCM. To investigate whether the presence of live bacteria is necessary for the effect on PI muscular dysfunction, additional T. spiralis-infected mice were gavaged from day 10 to 21 after infection with 100 μL of MRS, 1010 L. paracasei per milliliter of SCM (L. paracasei), heat-inactivated L. paracasei, L. paracasei-free SCM, or heat-inactivated L. paracasei-free SCM. To assess the effect of this bacterium on contractility in naive mice, uninfected mice were gavaged with either L. paracasei or MRS at the time points similar to those used in infected mice. To examine whether the effect of probiotics on postinfection muscle hypercontractility required administration during active intestinal inflammation, T. spiralis-infected mice were also gavaged from day 18 to 28 after infection with MRS, L. paracasei, or L. paracasei-free SCM. Mice were killed at days 14, 21, and 28 after infection. Ileal and colonic segments (2 cm) were obtained under sterile conditions. Contents were pooled with 1 mL of 0.9% NaCl/10% glycerol used to wash the lumen. Tissues were ground in 2 mL of 0.9% NaCL/10% glycerol by using a Polytron (Kinematica AG, Switzerland). Samples were stored at −70°C until analysis. On plating on semiselective media,21Guigoz Y. Rochat F. Perruisseau-Carrier G. Rochat I. Schriffin E.J. Effects of oligosaccharide on the faecal flora and non-specific immune system in elderly people.Nutr Res. 2002; 22: 13-25Abstract Full Text Full Text PDF Scopus (180) Google Scholar bacterial populations were estimated by counting the colony-forming units. Lactobacilli, bifidobacteria, and bacteroides were incubated anaerobically (AnaeroGen; Oxoid, Basingstoke, UK) at 37°C for 48 hours. Enterobacteria and enterococci were incubated aerobically at 37°C for 24 hours. Bacterial counts were expressed in log10 colony-forming units per gram of feces or tissue. The presence of L. paracasei NCC2461 was monitored by random amplified polymorphic DNA fingerprinting22Welsh J. McClelland M. Fingerprinting genomes using PCR with arbitrary primers.Nucleic Acids Res. 1990; 18: 7213-7218Crossref PubMed Scopus (4237) Google Scholar, 23Johansson M.L. Quednau M. Molin G. Ahrne S. Random amplified polymorphic DNA (RAPD) for typing Lactobacillus plantarum strains.Lett Appl Microbiol. 1995; 21: 155-159Crossref Scopus (144) Google Scholar with the 2 following oligonucleotides: GGTTGGGTGAGAATTGCACG and CGGCCAGCTGGTCAGCC (Microsynth, Balgach, Switzerland). In vitro muscle contractility was measured as described previously24Vallance B.A. Blennerhassett P. Collins S.M. Increased intestinal muscle contractility and worm expulsion in nematode infected mice.Am J Physiol. 1997; 272: G321-G327PubMed Google Scholar at days 21 and 28 after infection. Briefly, jejunal strips suspended in muscle bath containing oxygenated Krebs solution at 37°C were stretched by tension equivalent to 0.5 g, and contractility of the intestinal segment was recorded after a 40-minute equilibration period by force transducers (FT03C; Grass, Quincy, MA) connected to a polygraph (model 7D; Grass). Data were stored in a computer by using dedicated software (Acquire 5.0; Alfred Bayatti) and were analyzed offline with Grafview 4.1 (Alfred Bayatti). In experiments designed to select probiotic bacteria on the basis of their effect on the PI muscle dysfunction, contractility was assessed by using a dose response to carbachol (10−8 to 10−5 mol/L). Dose response to carbachol was also used to investigate the effect of late administration of probiotics (day 18 after infection) on PI hypercontractility. In experiments conducted to investigate the effect of L. paracasei, L. paracasei-free SCM, or heat-inactivated L. paracasei on PI dysfunction, contractility was assessed by electrical field stimulation (EFS) at nerve (50 V, 10 Hz, 0.5 ms) parameters or pharmacologically by 10−6 mol/L carbachol, 10−5 mol/L 5-hydroxytryptamine, or 50 mmol/L KCl. At the end of the experiments, the length and weight of each tissue were recorded to correct for cross-sectional area, as described previously.24Vallance B.A. Blennerhassett P. Collins S.M. Increased intestinal muscle contractility and worm expulsion in nematode infected mice.Am J Physiol. 1997; 272: G321-G327PubMed Google Scholar The force exerted by the muscle strips was expressed in milligrams per square millimeter. Area under the curve (AUC) was calculated for 1 minute before and 1 minute after stimulation. Tonic contraction was defined as the difference between mean tone before and after stimulation. Maximal tension was defined as the difference between the maximal amplitude of contraction after stimulation and the mean amplitude of phasic contractions before stimulation. For analysis of protein within the longitudinal muscle layer, the entire jejunum was dissected, rinsed in ice-cold sterile phosphate-buffered saline, and cut into 4 sections. The mesentery was carefully removed, and the pieces of intestine were mounted onto a glass rod. The muscle layer was carefully scraped off with a clean cotton swab, snap-frozen, and stored at −70°C until analysis. Successful isolation of muscle was confirmed by histological evaluation. Muscle tissue was placed in 1 mL of lysis buffer containing 10% NP-40, 10 mg/mL phenylmethylsulfonyl fluoride in isopropanol, 1 mg/mL aprotinin, and 1 mg/mL leupeptin. After the tissue was homogenized, the total protein concentration was measured (Bio-Rad protein assay, Hercules, CA), and samples were aliquoted and stored at −70°C for enzyme-linked immunosorbent assay (ELISA) determinations. Interleukin (IL)-4 and IL-13 were measured in a longitudinal myenteric muscle preparation (LMMP) obtained 14 days after infection with commercial kits (Quantikine M Murine, Minneapolis, MN) by following the manufacturer's directions. TGF-β1 and prostaglandin E2 (PGE2) were also measured in LMMP obtained 21 days after infection (Quantikine M Murine). To activate latent TGF-β1 to immunoreactive TGF-β1 detectable by the assay, samples were assayed after acidification with 2.5N acetic acid and 10 mol/L urea and neutralization with 2.7 mol/L NaOH/1 mol/L HEPES. Results from ELISA determinations were adjusted to the protein concentration of the sample and expressed as picograms per milliliter per milligram of total protein. COX-2 detection was performed on paraffin blocks of mouse jejunum obtained 21 days after infection and processed as previously described.25Saukkonen K. Nieminen O. van Rees B. Vilkki S. Harkonen M. Juhola M. Mecklin J.P. Sopponen P. Ristimaki A. Expression of cyclooxygenase-2 in dysplasia of the stomach and in intestinal type gastric adenocarcinoma.Clin Cancer Res. 2001; 7: 1923-1931PubMed Google Scholar The antibody used to identify COX-2 was a specific rabbit polyclonal affinity-purified antibody directed against amino acids 584–598 of the murine COX-2 (Cayman Chemical, Ann Arbor, MI). Negative controls were performed by omitting the primary antibody and by blocking antibody/protein complex formation for COX-2. For the latter, a COX-2 murine blocking peptide (Cayman Chemical) was incubated with the primary antibody before its application on the slides. Tissue sections were analyzed with light microscopy (Leica DM/LS; Mikroskopie & Systeme GmbH, Wetzlar, Germany), and quantification of immunostaining was performed on a computer with dedicated software (NIH Image 1.62). Total RNA was isolated from 1-cm jejunal segments 21 days after infection by using TriPure Isolation reagent (Roche Diagnostic AG, Rotkreuz, Switzerland) according to the manufacturer's instructions. Residual DNA was eliminated with the NucleoSpin RNA II kit (Macherey-Nagel, Oensingen, Switzerland). RNA quantification was performed with the Ribogreen RNA kit (Molecular Probes, Juro AG, Lucerne, Switzerland). RNA quality was controlled by using the RNA 6000 Nano Labchip kit in an Agilent 2100 bioanalyzer (Agilent Technologies SA, Basel, Switzerland), as described in the Reagent Kit Guide. Gene-expression analysis was performed with the murine DNA chips MG-U74Av2 (Affymetrix, High Wycombe, England) as previously described,26Mutch D.M. Berger A. Mansourian R. Rytz A. Roberts M.A. The limit fold change model a practical approach for selecting differentially expressed genes from microarray data.BMC Bioinformatics. 2002; 3: 17-27Crossref PubMed Scopus (147) Google Scholar except that data analysis was performed with the global error assessment method.27Mansourian R. Mutch D.M. Antille N. Aubert J. Fogel P. Le Goff J.M. Moulin J. Petrov A. Rytz A. Voegel J.J. Roberts M.A. The global assessment error (GEA) model for the selection of differentially expressed genes in microarray data.Bioinformatics. 2004; (in press)Google Scholar Quantitative analysis of RANTES (regulated upon activation, normal T cells expressed and secreted) was performed by real-time polymerase chain reaction (PCR). Reverse transcription of total RNA (2 μg) was performed by using oligo (dT15) as primer and avian myeloblastosis virus reverse transcriptase according to the manufacturer's protocol (Catalysis AG, Basel, Switzerland). Real-time PCR was performed in triplicate according to the Applied Biosystems (Foster City, CA) protocol with the GeneAmp 5700 Sequence Detection System. Data were analyzed with Sequence Detector software (Applied Biosystems). According to the comparative threshold cycle (Ct) method,28Livak K.J. Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method.Methods. 2001; 25: 402-408Crossref PubMed Scopus (135908) Google Scholarthe average Ct values for RANTES were normalized with respect to the average Ct values of the housekeeping gene hypoxanthine guanine phosphoribosyl transferase to yield the ΔCt. The average ΔCt value obtained from the uninfected mice group was then subtracted from the average ΔCt value for each other group to give the ΔΔCt (-fold change). The RANTES gene primer (forward, GGAGTATTTCTACACCAGCAGCAA; reverse, CACTTGGCGGTTCCTTCGA)/TaqMan probe (6-carboxy fluorecein-CTTGCAGTCGTGTTTGTC) combination was designed and synthesized by Applied Biosystems (Assays-by-Design) on sequence from the National Center for Biotechnology Information public database specific for the mouse RANTES gene (AF 065947). The hypoxanthine guanine phosphoribosyl transferase primers/TaqMan probe combination was designed and synthesized by Applied Biosystems (Assays-on-Demand; Mm00446968_m1). Data are presented as mean ± SD. Medians and interquartile ranges (IQR) were used for worm count experiments (n = 3 per group; nonparametric distribution). Statistical testing was performed by analysis of variance and global error assessment analysis of variance.27Mansourian R. Mutch D.M. Antille N. Aubert J. Fogel P. Le Goff J.M. Moulin J. Petrov A. Rytz A. Voegel J.J. Roberts M.A. The global assessment error (GEA) model for the selection of differentially expressed genes in microarray data.Bioinformatics. 2004; (in press)Google Scholar None of the tested probiotic strains interfered with parasite eviction. Consistent with previous findings,24Vallance B.A. Blennerhassett P. Collins S.M. Increased intestinal muscle contractility and worm expulsion in nematode infected mice.Am J Physiol. 1997; 272: G321-G327PubMed Google Scholar worm expulsion was complete by day 14 after infection, and no worms were recovered after day 14 in any group that had previously been infected with T. spiralis and treated with probiotics or MRS. Similarly, when probiotics were administered on day 10 after infection, no significant effect was seen in the number of worms recovered at later time points. Median worm recovery on day 10 after infection was 2 (IQR, 9.5) in T. spiralis-MRS, 6.5 (IQR, 4) in L. paracasei-treated animals, and 7 (IQR, 12) in L. paracasei-free SCM-treated mice (all not significant). On day 12 after infection, worm recovery was 0.5 (IQR, 1) in T. spiralis-MRS, 0 (IQR, 2.5) in L. paracasei-treated animals, and 1 (IQR, 3) in L. paracasei-free SCM-treated mice (all not significant). On day 14 after infection, no worms were recovered in any group of mice previously infected with T. spiralis. To investigate whether the administration of probiotic bacteria influences PI hypercontractility, T. spiralis-infected mice were given unfermented MRS as control or the probiotics 1010 L. paracasei, L. johnsonii, B. longum, or B. lactis per milliliter of SCM from day 10 to day 21 after T. spiralis infection. Contractility of whole-muscle strips showed that uninfected mice and T. spiralis-infected mice that had received L. paracasei displayed significantly lower maximal tension than MRS-treated mice (Figure 1A; Table 1). Attenuation of PI hypercontractility was evident after stimulation with carbachol 10−7 mol/L (P = 0.008), 10−6 mol/L (P = 0.01), and 10−5 mol/L (P = 0.05). B. lactis decreased maximal tension only after stimulation with 10−7 mol/L carbachol (P = 0.01). B. longum and L. johnsonii tended to have lower maximal tension after stimulation with 10−7 mol/L carbachol, but this did not achieve statistical significance. L. paracasei and, to a lesser extent, B. lactis tended to decrease the AUC after 10−5 mol/L carbachol stimulation when compared with MRS-treated mice (P = 0.06 and P = 0.1, respectively; Figure 1B; Table 1).Table 1Maximal Tension and Area Under the Curve for Intestinal Strips Obtained 21 Days After InfectionStimulationTsp-MRSUninfectedTsp-LjoTsp-LpaTsp-BloTsp-BlaMaximal tension Cch 10−8 mol/L0.2 ± 0.10.1 ± 0.020.1 ± 0.080.1 ± 0.010.2 ± 0.050.2 ± 0.1 Cch 10−7 mol/L1.0 ± 0.20.3 ± 0.2aP ≤ 0.05 vs. Tsp-MRS;0.6 ± 0.30.3 ± 0.2aP ≤ 0.05 vs. Tsp-MRS;0.6 ± 0.30.5 ± 0.2aP ≤ 0.05 vs. Tsp-MRS; Cch 10−6 mol/L2.0 ± 0.20.9 ± 0.2aP ≤ 0.05 vs. Tsp-MRS;1.8 ± 0.50.7 ± 0.3aP ≤ 0.05 vs. Tsp-MRS;1.4 ± 0.71.4 ± 0.4 Cch 10−5 mol/L1.7 ± 0.70.9 ± 0.1aP ≤ 0.05 vs. Tsp-MRS;1.6 ± 0.50.7 ± 0.3aP ≤ 0.05 vs. Tsp-MRS;1.2 ± 0.91.3 ± 0.2Area under the curve Cch 10−8 mol/L5.6 ± 1.71.9 ± 0.4aP ≤ 0.05 vs. Tsp-MRS;4.5 ± 2.72.8 ± 1.95.2 ± 2.44.8 ± 2.4 Cch 10−7 mol/L7.0 ± 2.14.1 ± 0.9bP = 0.06 vs. Tsp-MRS.5.5 ± 2.94.4 ± 2.38.1 ± 1.96.2 ± 2.9 Cch 10−6 mol/L11.7 ± 4.57.3 ± 1.3aP ≤ 0.05 vs. Tsp-MRS;11.5 ± 5.48.1 ± 3.312.9 ± 2.510.7 ± 5.1 Cch 10−5 mol/L15.9 ± 4.310.4 ± 3.0aP ≤ 0.05 vs. Tsp-MRS;16.9 ± 9.010.7 ± 3.9bP = 0.06 vs. Tsp-MRS.15.0 ± 4.413.0 ± 5.7NOTE. Results are mean ± SD (n = 5).MRS, DE Man-Rogosa-Sharpe broth; Cch, carbachol; Ljo, Lactobacillus johnsonii; Lpa, L. paracasei; Blo, Bifidobacterium longum; Bla, B. lactis; Tsp, Trichinella spiralis.a P ≤ 0.05 vs. Tsp-MRS;b P = 0.06 vs. Tsp-MRS. Open table in a new tab NOTE. Results are mean ± SD (n = 5). MRS, DE Man-Rogosa-Sharpe broth; Cch, carbachol; Ljo, Lactobacillus johnsonii; Lpa, L. paracasei; Blo, Bifidobacterium longum; Bla, B. lactis; Tsp, Trichinella spiralis. Groups of T. spiralis-infected mice were given, from day 10 to day 21 after infection, live L. paracasei in their SCM, heat-inactivated L. paracasei in their SCM, or L. paracas