hVps34 Is a Nutrient-regulated Lipid Kinase Required for Activation of p70 S6 Kinase

Name: Work Video:
Duration: 3 min 30 s
Maya Byfield; James T. Murray; Jonathan Backer
{'id': 'https://openalex.org/W1968513003', 'doi': 'https://doi.org/10.1074/jbc.m507201200', 'title': 'hVps34 Is a Nutrient-regulated Lipid Kinase Required for Activation of p70 S6 Kinase', 'display_name': 'hVps34 Is a Nutrient-regulated Lipid Kinase Required for Activation of p70 S6 Kinase', 'publication_year': 2005, 'publication_date': '2005-07-28', 'ids': {'openalex': 'https://openalex.org/W1968513003', 'doi': 'https://doi.org/10.1074/jbc.m507201200', 'mag': '1968513003', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/16049009'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m507201200', 'pdf_url': 'http://www.jbc.org/article/S0021925820791672/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S0021925820791672/pdf', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5036536024', 'display_name': 'Maya Byfield', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I129975664', 'display_name': 'Albert Einstein College of Medicine', 'ror': 'https://ror.org/05cf8a891', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I129975664', 'https://openalex.org/I4210112371']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Maya P. Byfield', 'raw_affiliation_strings': ['*Department of Molecular Pharmacology, Albert Einstein College of Medicine, Bronx, New York 10461, USA'], 'affiliations': [{'raw_affiliation_string': '*Department of Molecular Pharmacology, Albert Einstein College of Medicine, Bronx, New York 10461, USA', 'institution_ids': ['https://openalex.org/I129975664']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5075304242', 'display_name': 'James T. Murray', 'orcid': 'https://orcid.org/0000-0002-6928-2347'}, 'institutions': [{'id': 'https://openalex.org/I4210110201', 'display_name': 'MRC Protein Phosphorylation and Ubiquitylation Unit', 'ror': 'https://ror.org/01zg1tt02', 'country_code': 'GB', 'type': 'facility', 'lineage': ['https://openalex.org/I177639307', 'https://openalex.org/I4210087105', 'https://openalex.org/I4210110201', 'https://openalex.org/I90344618']}, {'id': 'https://openalex.org/I177639307', 'display_name': 'University of Dundee', 'ror': 'https://ror.org/03h2bxq36', 'country_code': 'GB', 'type': 'education', 'lineage': ['https://openalex.org/I177639307']}], 'countries': ['GB'], 'is_corresponding': False, 'raw_author_name': 'James T. Murray', 'raw_affiliation_strings': ['The MRC Protein Phosphorylation Unit, University of Dundee, Dundee DD1 5EH, United Kingdom'], 'affiliations': [{'raw_affiliation_string': 'The MRC Protein Phosphorylation Unit, University of Dundee, Dundee DD1 5EH, United Kingdom', 'institution_ids': ['https://openalex.org/I4210110201', 'https://openalex.org/I177639307']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5032267904', 'display_name': 'Jonathan Backer', 'orcid': 'https://orcid.org/0000-0002-0360-5692'}, 'institutions': [{'id': 'https://openalex.org/I129975664', 'display_name': 'Albert Einstein College of Medicine', 'ror': 'https://ror.org/05cf8a891', 'country_code': 'US', 'type': 'education', 'lineage': ['https://openalex.org/I129975664', 'https://openalex.org/I4210112371']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Jonathan M. Backer', 'raw_affiliation_strings': ['**Department of Molecular Pharmacology, Albert Einstein College of Medicine, Bronx, New York 10461'], 'affiliations': [{'raw_affiliation_string': '**Department of Molecular Pharmacology, Albert Einstein College of Medicine, Bronx, New York 10461', 'institution_ids': ['https://openalex.org/I129975664']}]}], 'institution_assertions': [], 'countries_distinct_count': 2, 'institutions_distinct_count': 3, 'corresponding_author_ids': [], 'corresponding_institution_ids': [], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 16.231, 'has_fulltext': False, 'cited_by_count': 519, 'citation_normalized_percentile': {'value': 0.99998, 'is_in_top_1_percent': True, 'is_in_top_10_percent': True}, 'cited_by_percentile_year': {'min': 99, 'max': 100}, 'biblio': {'volume': '280', 'issue': '38', 'first_page': '33076', 'last_page': '33082'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T10952', 'display_name': 'PI3K/AKT/mTOR signaling in cancer', 'score': 0.9998, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, 'topics': [{'id': 'https://openalex.org/T10952', 'display_name': 'PI3K/AKT/mTOR signaling in cancer', 'score': 0.9998, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T11339', 'display_name': 'Metabolism, Diabetes, and Cancer', 'score': 0.9992, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T11041', 'display_name': 'Ubiquitin and proteasome pathways', 'score': 0.9976, 'subfield': {'id': 'https://openalex.org/subfields/1312', 'display_name': 'Molecular Biology'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/cyclin-dependent-kinase-9', 'display_name': 'Cyclin-dependent kinase 9', 'score': 0.47648475}, {'id': 'https://openalex.org/keywords/ask1', 'display_name': 'ASK1', 'score': 0.4730712}, {'id': 'https://openalex.org/keywords/map2k7', 'display_name': 'MAP2K7', 'score': 0.429836}], 'concepts': [{'id': 'https://openalex.org/C104202773', 'wikidata': 'https://www.wikidata.org/wiki/Q18031289', 'display_name': 'P70-S6 Kinase 1', 'level': 4, 'score': 0.67260414}, {'id': 'https://openalex.org/C137361374', 'wikidata': 'https://www.wikidata.org/wiki/Q6714442', 'display_name': 'MAP kinase kinase kinase', 'level': 4, 'score': 0.5141897}, {'id': 'https://openalex.org/C184235292', 'wikidata': 'https://www.wikidata.org/wiki/Q421851', 'display_name': 'Kinase', 'level': 2, 'score': 0.503323}, {'id': 'https://openalex.org/C59143045', 'wikidata': 'https://www.wikidata.org/wiki/Q15314942', 'display_name': 'Cyclin-dependent kinase 9', 'level': 5, 'score': 0.47648475}, {'id': 'https://openalex.org/C82495950', 'wikidata': 'https://www.wikidata.org/wiki/Q14911732', 'display_name': 'Cyclin-dependent kinase 2', 'level': 4, 'score': 0.47400984}, {'id': 'https://openalex.org/C124160383', 'wikidata': 'https://www.wikidata.org/wiki/Q14914383', 'display_name': 'ASK1', 'level': 5, 'score': 0.4730712}, {'id': 'https://openalex.org/C90934575', 'wikidata': 'https://www.wikidata.org/wiki/Q6593810', 'display_name': 'Mitogen-activated protein kinase kinase', 'level': 4, 'score': 0.47280684}, {'id': 'https://openalex.org/C159479382', 'wikidata': 'https://www.wikidata.org/wiki/Q18030801', 'display_name': 'MAP2K7', 'level': 5, 'score': 0.429836}, {'id': 'https://openalex.org/C185592680', 'wikidata': 'https://www.wikidata.org/wiki/Q2329', 'display_name': 'Chemistry', 'level': 0, 'score': 0.38590473}, {'id': 'https://openalex.org/C95444343', 'wikidata': 'https://www.wikidata.org/wiki/Q7141', 'display_name': 'Cell biology', 'level': 1, 'score': 0.36955345}, {'id': 'https://openalex.org/C97029542', 'wikidata': 'https://www.wikidata.org/wiki/Q281417', 'display_name': 'Protein kinase A', 'level': 3, 'score': 0.28296918}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.24503192}, {'id': 'https://openalex.org/C11960822', 'wikidata': 'https://www.wikidata.org/wiki/Q242736', 'display_name': 'Phosphorylation', 'level': 2, 'score': 0.20727831}, {'id': 'https://openalex.org/C75217442', 'wikidata': 'https://www.wikidata.org/wiki/Q423650', 'display_name': 'Protein kinase B', 'level': 3, 'score': 0.15068915}], 'mesh': [{'descriptor_ui': 'D019869', 'descriptor_name': 'Phosphatidylinositol 3-Kinases', 'qualifier_ui': 'Q000502', 'qualifier_name': 'physiology', 'is_major_topic': True}, {'descriptor_ui': 'D038762', 'descriptor_name': 'Ribosomal Protein S6 Kinases, 70-kDa', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': True}, {'descriptor_ui': 'D055372', 'descriptor_name': 'AMP-Activated Protein Kinases', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D000818', 'descriptor_name': 'Animals', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D016466', 'descriptor_name': 'CHO Cells', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D002460', 'descriptor_name': 'Cell Line', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D045744', 'descriptor_name': 'Cell Line, Tumor', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D049109', 'descriptor_name': 'Cell Proliferation', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D006224', 'descriptor_name': 'Cricetinae', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D004789', 'descriptor_name': 'Enzyme Activation', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D005947', 'descriptor_name': 'Glucose', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D005947', 'descriptor_name': 'Glucose', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D049452', 'descriptor_name': 'Green Fluorescent Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D049452', 'descriptor_name': 'Green Fluorescent Proteins', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D006367', 'descriptor_name': 'HeLa Cells', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D006801', 'descriptor_name': 'Humans', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D007328', 'descriptor_name': 'Insulin', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D007328', 'descriptor_name': 'Insulin', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D008954', 'descriptor_name': 'Models, Biological', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D009097', 'descriptor_name': 'Multienzyme Complexes', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D009097', 'descriptor_name': 'Multienzyme Complexes', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D019869', 'descriptor_name': 'Phosphatidylinositol 3-Kinases', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D019869', 'descriptor_name': 'Phosphatidylinositol 3-Kinases', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D010766', 'descriptor_name': 'Phosphorylation', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D010957', 'descriptor_name': 'Plasmids', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D010957', 'descriptor_name': 'Plasmids', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D014176', 'descriptor_name': 'Protein Biosynthesis', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011487', 'descriptor_name': 'Protein Conformation', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011494', 'descriptor_name': 'Protein Kinases', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D011494', 'descriptor_name': 'Protein Kinases', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D017434', 'descriptor_name': 'Protein Structure, Tertiary', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D017346', 'descriptor_name': 'Protein-Serine-Threonine Kinases', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D017346', 'descriptor_name': 'Protein-Serine-Threonine Kinases', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D034741', 'descriptor_name': 'RNA, Small Interfering', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D034741', 'descriptor_name': 'RNA, Small Interfering', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D038762', 'descriptor_name': 'Ribosomal Protein S6 Kinases, 70-kDa', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D015398', 'descriptor_name': 'Signal Transduction', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D058570', 'descriptor_name': 'TOR Serine-Threonine Kinases', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D014162', 'descriptor_name': 'Transfection', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}], 'locations_count': 2, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m507201200', 'pdf_url': 'http://www.jbc.org/article/S0021925820791672/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/16049009', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m507201200', 'pdf_url': 'http://www.jbc.org/article/S0021925820791672/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [{'score': 0.51, 'display_name': 'Zero hunger', 'id': 'https://metadata.un.org/sdg/2'}], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 66, 'referenced_works': ['https://openalex.org/W1499220263', 'https://openalex.org/W1538471627', 'https://openalex.org/W1576634198', 'https://openalex.org/W1585385265', 'https://openalex.org/W163818535', 'https://openalex.org/W1780295430', 'https://openalex.org/W1923816168', 'https://openalex.org/W1963723155', 'https://openalex.org/W1967085696', 'https://openalex.org/W1971556742', 'https://openalex.org/W1978625554', 'https://openalex.org/W1984736455', 'https://openalex.org/W1989658063', 'https://openalex.org/W1989964807', 'https://openalex.org/W1998143976', 'https://openalex.org/W2001568034', 'https://openalex.org/W2006559495', 'https://openalex.org/W2007559235', 'https://openalex.org/W2007898433', 'https://openalex.org/W2008728162', 'https://openalex.org/W2010422684', 'https://openalex.org/W2010898959', 'https://openalex.org/W2011282245', 'https://openalex.org/W2011872098', 'https://openalex.org/W2015271251', 'https://openalex.org/W2020036405', 'https://openalex.org/W2022163051', 'https://openalex.org/W2022669008', 'https://openalex.org/W2023012828', 'https://openalex.org/W2023819606', 'https://openalex.org/W2029282032', 'https://openalex.org/W2036254130', 'https://openalex.org/W2044467623', 'https://openalex.org/W2050281512', 'https://openalex.org/W2053158202', 'https://openalex.org/W2054998824', 'https://openalex.org/W2065221771', 'https://openalex.org/W2065887259', 'https://openalex.org/W2065978566', 'https://openalex.org/W2066800765', 'https://openalex.org/W2072253274', 'https://openalex.org/W2074929978', 'https://openalex.org/W2076352446', 'https://openalex.org/W2076926699', 'https://openalex.org/W2082379606', 'https://openalex.org/W2082796078', 'https://openalex.org/W2082853003', 'https://openalex.org/W2083919459', 'https://openalex.org/W2089632625', 'https://openalex.org/W2096890729', 'https://openalex.org/W2097645517', 'https://openalex.org/W2104383425', 'https://openalex.org/W2104467943', 'https://openalex.org/W2109263914', 'https://openalex.org/W2115886998', 'https://openalex.org/W2124140485', 'https://openalex.org/W2128644712', 'https://openalex.org/W2139424276', 'https://openalex.org/W2140809728', 'https://openalex.org/W2144059623', 'https://openalex.org/W2147594695', 'https://openalex.org/W2148836534', 'https://openalex.org/W2149785020', 'https://openalex.org/W2152289580', 'https://openalex.org/W2152600551', 'https://openalex.org/W2163382569'], 'related_works': ['https://openalex.org/W4246587942', 'https://openalex.org/W2162824132', 'https://openalex.org/W2122407726', 'https://openalex.org/W2053151896', 'https://openalex.org/W2035743526', 'https://openalex.org/W2034580062', 'https://openalex.org/W2031154171', 'https://openalex.org/W2024360304', 'https://openalex.org/W2020142500', 'https://openalex.org/W1996063901'], 'abstract_inverted_index': {'Mammalian': [0, 260, 1764], 'cells': [1, 261, 1877, 2041, 2130, 2183, 2359, 2370, 2378, 2570, 2585, 2630, 2638, 2790, 2792, 2861, 2963, 3301, 3342, 3350, 3367, 3373, 3400, 3467, 3474, 3572, 3761, 3804, 3920, 3933, 4076, 4186, 4284, 4331, 4372, 4399], 'respond': [2, 262], 'to': [3, 151, 194, 217, 256, 263, 411, 454, 477, 516, 620, 785, 1004, 1098, 1281, 1352, 1562, 1761, 2124, 2473, 2492, 2535, 2677, 2693, 2847, 2855, 2902, 3019, 3109, 3289, 3361, 3383, 3425, 3512, 3525, 3538, 3648, 3747, 3906, 4176, 4300, 4360], 'nutrient': [4, 98, 264, 358, 777, 1980, 2111, 2829, 4361], 'deprivation': [5, 265, 4110, 4183, 4362], 'by': [6, 18, 41, 48, 58, 118, 158, 180, 203, 266, 278, 301, 308, 318, 378, 418, 440, 463, 643, 675, 756, 794, 932, 1288, 1357, 1471, 1480, 1957, 2075, 2091, 2098, 2540, 2737, 2747, 2955, 3030, 3077, 3281, 3521, 3650, 3781, 3797, 3857, 3940, 3946, 4030, 4107, 4129, 4181, 4277, 4295, 4356, 4396], 'inhibiting': [7, 267], 'energy': [8, 268], 'consuming': [9, 269], 'processes,': [10, 21, 270, 281], 'such': [11, 22, 44, 271, 282, 304], 'as': [12, 23, 45, 153, 222, 272, 283, 305, 413, 482, 654, 656, 786, 2143, 2445, 2497, 2582, 2595, 2611, 2641, 2810, 2975, 3028, 3743, 3779], 'proliferation': [13, 273, 617], 'and': [14, 17, 47, 91, 111, 160, 253, 258, 274, 277, 307, 351, 371, 420, 513, 518, 616, 624, 645, 661, 666, 722, 729, 765, 782, 1008, 1344, 1482, 1975, 2097, 2113, 2122, 2126, 2131, 2221, 2251, 2266, 2268, 2281, 2292, 2398, 2401, 2404, 2407, 2424, 2428, 2442, 2488, 2597, 2720, 2752, 2778, 2797, 3023, 3323, 3326, 3495, 3508, 3754, 3837, 3911, 3964, 4013, 4133, 4187, 4207], 'protein': [15, 275, 534, 577, 612, 1534, 2876, 3960, 3973], 'synthesis,': [16, 276, 613], 'stimulating': [19, 279], 'catabolic': [20, 280], 'autophagy.': [24, 284], 'p70': [25, 285, 520, 529, 572, 2343, 2564], 'S6': [26, 286, 521, 530, 573, 2253, 2344, 2565, 2606, 3296], 'kinase': [27, 108, 248, 287, 368, 508, 522, 2345, 2603, 2607, 2877], '(S6K1)': [28, 288, 523], 'plays': [29, 67, 289, 327], 'a': [30, 68, 93, 126, 245, 290, 328, 353, 386, 505, 648, 718, 776, 1283, 1564, 2025, 2105, 2188, 2678, 2758, 2779, 2811, 2848, 2976, 3047, 3114, 3402, 3417, 3437, 3459, 3731, 4014], 'central': [31, 291], 'role': [32, 71, 292, 331, 1355, 1520, 1565, 2026, 2107, 2825, 3736, 4324], 'during': [33, 293, 1359, 3086, 3558, 3739, 4025, 4303], 'nutritional': [34, 294, 622, 1762, 1960], 'regulation': [35, 74, 295, 334, 1362, 1468, 1976, 2952, 3740, 4056, 4168], 'of': [36, 51, 75, 96, 102, 114, 120, 125, 141, 147, 162, 169, 205, 220, 227, 232, 296, 311, 335, 356, 362, 374, 380, 385, 401, 407, 422, 429, 465, 480, 487, 492, 539, 582, 641, 669, 727, 731, 775, 792, 935, 1006, 1010, 1091, 1363, 1469, 1526, 1531, 1977, 1992, 2030, 2069, 2083, 2100, 2117, 2213, 2416, 2469, 2527, 2537, 2558, 2593, 2681, 2705, 2787, 2813, 2826, 2835, 2844, 2869, 2907, 2939, 2953, 2970, 3014, 3021, 3025, 3033, 3041, 3053, 3075, 3089, 3116, 3293, 3316, 3330, 3337, 3371, 3388, 3408, 3434, 3462, 3504, 3561, 3568, 3653, 3737, 3741, 3749, 3752, 3756, 3800, 3814, 3820, 3827, 3842, 3849, 3866, 3922, 3938, 3958, 4028, 4032, 4057, 4115, 4125, 4215, 4224, 4286, 4293, 4310, 4318, 4325, 4371, 4383, 4387, 4398], 'translation.': [37, 297], 'S6K1': [38, 115, 298, 375, 642, 670, 681, 733, 1470, 2908, 2916, 2954, 2959, 3076, 3277, 3291, 3338, 3393, 3409, 3435, 3450, 3463, 3481, 3513, 3846, 3853, 4126], 'is': [39, 55, 92, 116, 144, 155, 178, 200, 244, 299, 315, 352, 376, 404, 415, 438, 460, 504, 673, 715, 754, 930, 1286, 1733, 1757, 1871, 1944, 2033, 2064, 2072, 2089, 2486, 2949, 2973, 3071, 3429, 3564, 3847, 3854, 4022, 4127, 4179, 4274, 4353, 4385, 4394], 'activated': [40, 300, 4024, 4180], 'growth': [42, 302, 766, 1000], 'factors': [43, 303], 'insulin,': [46, 159, 306, 419, 2076, 2956], 'mammalian': [49, 309, 537, 580, 1556, 1876, 1983, 3642, 3965, 4185], 'target': [50, 310, 538, 581], 'rapamycin': [52, 312], '(mTOR),': [53, 313], 'which': [54, 209, 314, 469, 677, 1756, 2032, 2485, 2543, 2913, 3470, 3522, 3563, 3860, 4178, 4208, 4375, 4402], 'itself': [56, 316, 1953], 'regulated': [57, 317, 674, 755, 1287, 1956, 2074, 3856, 4276, 4355], 'amino': [59, 181, 251, 319, 441, 511, 762, 1289, 1342, 1360, 2092, 2120, 3509, 3858, 3903, 3923, 3941, 4033, 4108, 4131, 4288, 4304], 'acids.': [60, 320], 'The': [61, 321, 1524, 1555, 2329, 3506], 'Class': [62, 83, 322, 343, 1452, 1457, 3654], 'IA': [63, 323], 'phosphatidylinositol': [64, 324, 560, 563, 603, 606, 3656], '(PI)': [65, 325], '3-kinase': [66, 326, 1460], 'well': [69, 329, 655], 'recognized': [70, 330], 'in': [72, 173, 212, 332, 433, 472, 618, 717, 1015, 1467, 1477, 1521, 1566, 1759, 1770, 1875, 1946, 1979, 1982, 2027, 2039, 2110, 2114, 2495, 2555, 2588, 2685, 2700, 2817, 2828, 2851, 2859, 2878, 2905, 2961, 3050, 3101, 3113, 3283, 3311, 3341, 3349, 3365, 3405, 3436, 3465, 3473, 3532, 3542, 3570, 3802, 3901, 3918, 3931, 3955, 4061, 4071, 4174, 4184, 4283, 4327, 4347], 'the': [73, 82, 97, 105, 132, 148, 191, 206, 230, 333, 342, 357, 365, 392, 408, 451, 466, 490, 657, 662, 732, 773, 790, 933, 1011, 1088, 1094, 1354, 1451, 1456, 1529, 1949, 1958, 1967, 1973, 2036, 2115, 2132, 2393, 2414, 2470, 2475, 2483, 2524, 2589, 2701, 2798, 2814, 2823, 2873, 2879, 3015, 3031, 3067, 3082, 3294, 3312, 3444, 3454, 3476, 3519, 3554, 3565, 3651, 3735, 3840, 3850, 3864, 3902, 3956, 3971, 4026, 4055, 4113, 4216, 4322, 4338, 4357], 'S6K1.': [76, 195, 259, 336, 455, 519, 2070, 2127, 2839, 2944, 3505, 3907], 'We': [77, 337, 2059, 3357, 3535, 3551, 3894, 4098], 'now': [78, 338, 2060], 'present': [79, 339, 716, 1968], 'evidence': [80, 340], 'that': [81, 130, 187, 242, 249, 341, 390, 447, 502, 509, 651, 788, 1285, 1942, 1951, 1990, 2062, 2536, 2936, 3010, 3066, 3096, 3334, 3492, 4018, 4100, 4301, 4351], 'III': [84, 344, 1458], 'PI': [85, 345, 659, 1454, 1459], '3-kinase,': [86, 346, 1455], 'hVps34,': [87, 347, 3377], 'also': [88, 201, 348, 461, 1767, 3358, 3855, 4275, 4376], 'regulates': [89, 349, 611], 'S6K1,': [90, 110, 152, 350, 370, 412, 528, 571, 1353, 2031, 2439, 3090, 3526, 3742], 'critical': [94, 354], 'component': [95, 355], 'sensing': [99, 359, 778, 1981], 'apparatus.': [100, 360], 'Overexpression': [101, 361], 'hVps34': [103, 133, 143, 163, 177, 199, 215, 228, 243, 363, 393, 403, 423, 437, 459, 475, 488, 503, 1461, 1558, 1943, 1952, 1978, 1993, 2022, 2063, 2071, 2088, 2109, 2387, 2447, 2450, 2481, 2528, 2550, 2827, 2836, 2871, 2940, 2948, 3068, 3085, 3099, 3363, 3389, 3398, 3428, 3494, 3523, 3530, 3544, 3557, 3738, 3801, 3821, 3843, 3898, 3913, 3939, 3959, 3967, 4021, 4060, 4069, 4103, 4117, 4273, 4281, 4294, 4342, 4352, 4384, 4392], 'or': [104, 136, 171, 183, 364, 396, 431, 443, 682, 2085, 2094, 2568, 2576, 2580, 2591, 2703, 2741, 2770, 2872, 2941, 3307, 3314, 3453, 3767, 4219, 4290], 'associated': [106, 366, 1533, 2874], 'hVps15': [107, 367, 2875, 2942], 'activates': [109, 369, 2943, 4377], 'insulin': [112, 149, 372, 409, 644, 2028, 2067, 2133, 2594, 2708, 2864, 3051, 3087, 3319, 3335, 3432, 3547], 'stimulation': [113, 373, 626, 1002, 2068, 3052, 3461, 3548], 'blocked': [117, 377, 2721, 3340, 4128], 'microinjection': [119, 379], 'inhibitory': [121, 381, 3768, 4222], 'anti-hVps34': [122, 382, 2431, 2454, 3308, 3345, 3769], 'antibodies,': [123, 383, 2542, 3346], 'overexpression': [124, 384, 2834, 2843, 2868], 'FYVE': [127, 387], 'domain': [128, 388, 3017], 'construct': [129, 389, 2331, 2972, 3478], 'sequesters': [131, 391], 'product': [134, 394], 'PI(3)P,': [135, 395, 559, 602, 3070, 3498], 'small': [137, 223, 397, 483, 551, 594], 'interfering': [138, 224, 398, 484, 552, 595], 'RNA-mediated': [139, 399], 'knock-down': [140, 226, 400, 486, 3799, 3819], 'hVps34.': [142, 402, 4319], 'not': [145, 156, 405, 416, 1463, 1963, 2073, 2545, 3044, 3061, 3348, 3379, 3422, 3486, 4119, 4314], 'part': [146, 406, 4175], 'input': [150, 410, 3905], 'it': [154, 188, 414, 448, 2079, 3744], 'stimulated': [157, 417, 1758, 2862], 'inhibition': [161, 421, 1991, 3755, 3844, 3937, 4317, 4382], 'has': [164, 424, 1365, 1462, 1559, 1766, 1962, 2294], 'no': [165, 425, 3773, 3823], 'effect': [166, 426, 3824, 3841], 'on': [167, 190, 427, 450, 1986, 2633, 2757, 3775, 3825, 3845, 4389], 'phosphorylation': [168, 231, 428, 491, 724, 730, 1009, 1086, 2082, 2906, 3292, 3407, 3792, 3813, 3826, 4214, 4223], 'Akt': [170, 430, 1007, 2084, 2318, 3777, 3791], 'TSC2': [172, 432, 3815], 'insulin-stimulated': [174, 434, 1995, 2040, 2081, 2818, 2962, 3406, 3502, 3533, 3559, 3571, 3776, 3790, 3812], 'cells.': [175, 214, 435, 474, 1984, 2820, 3534], 'However,': [176, 436, 2087, 3007, 3758], 'inhibited': [179, 202, 439, 462, 931, 2090, 3917, 4106, 4346], 'acid': [182, 252, 442, 512, 1361, 2093, 3942, 4109, 4132, 4305], 'glucose': [184, 254, 444, 514, 2095, 2123, 4134, 4182, 4296], 'starvation,': [185, 445, 2096], 'suggesting': [186, 446, 4350], 'lies': [189, 449], 'nutrient-regulated': [192, 246, 452, 506, 1947], 'pathway': [193, 453, 650, 3728], 'Consistent': [196, 456], 'with': [197, 457, 780, 2381, 2392, 2430, 2437, 2453, 2466, 2573, 2577, 2668, 2716, 2722, 2732, 2742, 2863, 2915, 3304, 3344, 3352, 3374, 3416, 3449, 3764, 3784, 3970, 4337, 4373, 4400], 'this,': [198, 458], 'activation': [204, 464, 734, 934, 1005, 1100, 1346, 2029, 2099, 2917, 3074, 3088, 3278, 3336, 3433, 3503, 3560, 3751, 4124], 'AMP-activated': [207, 467, 533, 576], 'kinase,': [208, 468, 1535], 'inhibits': [210, 229, 470, 489, 683, 1087, 4209], 'mTOR/S6K1': [211, 471, 4210], 'glucose-starved': [213, 473, 927], 'appears': [216, 476], 'lie': [218, 478], 'upstream': [219, 479, 760], 'mTOR,': [221, 481, 536, 579, 676, 1282, 4390], 'RNA': [225, 485, 2395], 'another': [233, 493], 'mTOR': [234, 257, 494, 517, 653, 752, 795, 929, 1350, 1364, 2125, 3867, 4123, 4225], 'substrate,': [235, 495], 'eIF4E-binding': [236, 496, 566, 609], 'protein-1': [237, 497], '(4EBP1).': [238, 498], 'Our': [239, 499], 'data': [240, 500, 1940, 2103, 2934, 3064, 3490], 'suggest': [241, 501, 1941, 2104, 3065], 'lipid': [247, 507], 'integrates': [250, 510], 'inputs': [255, 515, 3511], '2The': [524], 'abbreviations': [525, 568], 'used': [526, 569, 2472, 3092, 3108, 3359], 'are:': [527, 570], 'kinase;': [531, 535, 574, 578], 'AMPK,': [532, 575, 4177], 'rapamycin;': [540, 583], 'TSC1/2,': [541, 584], 'tuberous': [542, 585], 'sclerosis': [543, 586], 'complex': [544, 587, 649, 779, 1013], '1/2;': [545, 588], 'PI,': [546, 589], 'phosphatidylinositol;': [547, 590], 'HA,': [548, 591], 'hemagglutinin;': [549, 592], 'siRNA,': [550, 593, 3381], 'RNA;': [553, 596], 'eGFP,': [554, 597, 2579, 3045, 3469], 'enhanced': [555, 598], 'green': [556, 599], 'fluorescent': [557, 600], 'protein;': [558, 601], '3-phosphate;': [561, 604], 'PI(3,4,5)P3,': [562, 605, 3750], '3,4,5-trisphosphate;': [564, 607], '4EBP1,': [565, 608], 'protein-1.2The': [567], 'protein-1.': [610], 'cell': [614, 2138, 3440, 4065], 'size,': [615], 'response': [619, 1760, 4359], 'cellular': [621, 1959], 'status': [623], 'hormonal': [625], '(1Kozma': [627, 3868], 'S.C.': [628, 1193, 3869], 'Thomas': [629, 1115, 1198, 1382, 2048, 2615, 2920, 3870], 'G.': [630, 1116, 1199, 1383, 1836, 1840, 1908, 1924, 2049, 2616, 2921, 3871], 'Bioessays.': [631, 3872], '2002;': [632, 816, 881, 913, 1122, 1149, 1228, 1245, 1389, 1416, 1722, 1815, 2309, 3269, 3873, 4153], '24:': [633, 3874], '65-71Crossref': [634, 3875], 'PubMed': [635, 694, 747, 824, 856, 889, 921, 950, 974, 994, 1036, 1056, 1080, 1125, 1152, 1175, 1210, 1231, 1248, 1273, 1310, 1335, 1392, 1419, 1445, 1494, 1512, 1550, 1587, 1616, 1647, 1666, 1685, 1706, 1725, 1751, 1793, 1818, 1850, 1866, 1898, 1933, 2014, 2054, 2162, 2177, 2244, 2312, 2516, 2626, 2660, 2896, 2928, 3002, 3134, 3163, 3194, 3213, 3232, 3253, 3272, 3592, 3612, 3636, 3690, 3722, 3876, 3889, 3990, 4008, 4048, 4161, 4202, 4245, 4265], 'Scopus': [636, 695, 748, 825, 857, 890, 922, 951, 975, 995, 1037, 1057, 1081, 1126, 1153, 1176, 1211, 1232, 1249, 1274, 1311, 1336, 1393, 1420, 1446, 1495, 1513, 1551, 1588, 1617, 1648, 1667, 1686, 1707, 1726, 1752, 1794, 1819, 1867, 1899, 1934, 2015, 2055, 2163, 2178, 2245, 2313, 2517, 2661, 2897, 2929, 3003, 3135, 3164, 3195, 3214, 3233, 3254, 3273, 3593, 3613, 3637, 3691, 3723, 3877, 3890, 3991, 4009, 4049, 4162, 4203, 4246, 4266], '(256)': [637, 3878], 'Google': [638, 697, 712, 750, 827, 859, 892, 924, 953, 977, 997, 1039, 1059, 1083, 1128, 1155, 1178, 1213, 1234, 1251, 1276, 1313, 1338, 1395, 1422, 1448, 1497, 1515, 1553, 1590, 1619, 1650, 1669, 1688, 1709, 1728, 1754, 1796, 1821, 1851, 1869, 1901, 1936, 2017, 2057, 2165, 2180, 2204, 2247, 2315, 2519, 2627, 2663, 2899, 2931, 3005, 3137, 3166, 3197, 3216, 3235, 3256, 3275, 3595, 3615, 3639, 3693, 3725, 3879, 3892, 3993, 4011, 4051, 4096, 4164, 4205, 4248, 4268], 'Scholar).': [639, 713, 751, 925, 998, 1084, 1277, 1339, 1449, 1554, 1729, 1822, 1937, 2058, 2181, 2248, 2316, 2520, 2628, 2932, 3006, 3276, 3640, 3726, 3893, 4052, 4097, 4165, 4269], 'Regulation': [640], 'nutrients': [646, 4312], 'involves': [647], 'includes': [652], 'p85/p110': [658], '3-kinases': [660], 'downstream': [663], 'kinases': [664, 3658], 'PDK-1': [665, 728], 'Akt.': [667], 'Phosphorylation': [668], 'at': [671, 757, 2463, 2909, 3410, 3793, 3811, 3816, 4172], 'Thr389': [672, 714, 2910], 'either': [678, 2765, 2870], 'directly': [679, 1280, 2554, 3080, 3810], 'phosphorylates': [680], 'its': [684, 723, 1519, 2490, 3496], 'dephosphorylation': [685], '(2Fingar': [686], 'D.C.': [687, 3882], 'Blenis': [688, 1261, 3883], 'J.': [689, 704, 909, 963, 1064, 1104, 1114, 1119, 1222, 1262, 1298, 1299, 1324, 1371, 1381, 1386, 1434, 1508, 1546, 1574, 1581, 1641, 1660, 1679, 1695, 1700, 1745, 1782, 1803, 1845, 1906, 1916, 1927, 2001, 2008, 2149, 2156, 2171, 2194, 2231, 2238, 2503, 2510, 2617, 2647, 2654, 2890, 2998, 3121, 3128, 3188, 3207, 3226, 3242, 3247, 3620, 3670, 3679, 3704, 3711, 3884, 3984, 4044, 4086, 4234], 'Oncogene.': [690, 3885], '2004;': [691, 709, 942, 966, 1028, 1072, 3584, 3628, 3886, 4194, 4237], '23:': [692, 3887], '3151-3171Crossref': [693, 3888], '(1054)': [696, 3891], 'Scholar,': [698, 828, 860, 893, 954, 978, 1040, 1060, 1129, 1156, 1179, 1214, 1235, 1252, 1314, 1396, 1423, 1498, 1591, 1620, 1651, 1670, 1689, 1710, 1797, 1852, 1902, 2166, 3138, 3167, 3198, 3217, 3236, 3257, 3596, 3616, 3694, 3880, 3994, 4249], '3Long': [699], 'X.': [700, 899, 1068, 1131, 1160, 1292, 1316, 1398, 1809, 1904, 3624], 'Muller': [701], 'F.': [702, 2324], 'Avruch': [703, 908, 1297, 1323], 'Curr.': [705, 1263, 1325], 'Top.': [706], 'Microbiol.': [707], 'Immunol.': [708], '279:': [710, 967, 4238], '115-138PubMed': [711], 'C-terminal': [719], 'hydrophobic': [720], 'motif,': [721], 'facilitates': [725, 789], 'docking': [726], 'loop': [735], '(4Leslie': [736], 'N.R.': [737], 'Biondi': [738], 'R.M.': [739], 'Alessi': [740], 'D.R.': [741], 'Chem.': [742, 965, 1301, 1436, 1784, 2619, 3681, 3713, 4236], 'Rev.': [743], '2001;': [744, 1644, 1663, 1682, 1703, 1748, 1863, 2201, 3191, 3210, 3229, 3250, 3987, 4005, 4093], '101:': [745], '2365-2380Crossref': [746], '(98)': [749], 'activity': [753, 1090, 1525, 2491, 2526, 2551, 2604, 2960, 3059, 3100, 3464, 3531, 3545, 3865, 3910, 3914, 4070, 4104, 4282, 4343, 4393], 'least': [758, 4173], 'three': [759], 'inputs:': [761], 'acids,': [763, 769, 3859, 4289], 'glucose,': [764, 4278, 4287], 'factors.': [767], 'Amino': [768], 'particularly': [770], 'leucine,': [771], 'regulate': [772], 'formation': [774], 'Raptor': [781], 'GβL/LST8': [783], '(referred': [784], 'TORC1)': [787], 'recognition': [791], 'substrates': [793], 'under': [796, 2530], 'nutrient-replete': [797], 'conditions': [798, 2532], '(5Kim': [799, 4136], 'D.H.': [800, 830, 4137], 'Sarbassov': [801, 831, 4138], 'D.D.': [802, 4139], 'Ali': [803, 834, 4140], 'S.M.': [804, 835, 1628, 1805, 3175, 4141], 'King': [805, 4142], 'J.E.': [806, 1838, 4143], 'Latek': [807, 836, 4144], 'R.R.': [808, 837, 4145], 'Erdjument-Bromage': [809, 840, 4146], 'H.': [810, 841, 1191, 1716, 1912, 2303, 2336, 2614, 2996, 3263, 3700, 4147], 'Tempst': [811, 842, 4148], 'P.': [812, 843, 876, 1135, 1402, 1781, 4149], 'Sabatini': [813, 844, 4150], 'D.M.': [814, 845, 4042, 4151], 'Cell.': [815, 847, 880, 912, 985, 1201, 1489, 2172, 2891, 4152, 4256], '110:': [817, 914, 4154], '163-175Abstract': [818, 4155], 'Full': [819, 821, 851, 853, 884, 886, 916, 918, 945, 947, 969, 971, 989, 991, 1031, 1033, 1051, 1053, 1075, 1077, 1205, 1207, 1268, 1270, 1305, 1307, 1330, 1332, 1440, 1442, 1788, 1790, 2623, 3587, 3589, 3607, 3609, 3631, 3633, 3685, 3687, 3717, 3719, 4156, 4158, 4197, 4199, 4240, 4242, 4260, 4262], 'Text': [820, 822, 852, 854, 885, 887, 917, 919, 946, 948, 970, 972, 990, 992, 1032, 1034, 1052, 1054, 1076, 1078, 1206, 1208, 1269, 1271, 1306, 1308, 1331, 1333, 1441, 1443, 1789, 1791, 2624, 3588, 3590, 3608, 3610, 3632, 3634, 3686, 3688, 3718, 3720, 4157, 4159, 4198, 4200, 4241, 4243, 4261, 4263], 'PDF': [823, 855, 888, 920, 949, 973, 993, 1035, 1055, 1079, 1209, 1272, 1309, 1334, 1444, 1792, 2625, 3591, 3611, 3635, 3689, 3721, 4160, 4201, 4244, 4264], '(2355)': [826, 4163], '6Kim': [829], 'dos': [832], 'D.': [833, 872, 938, 960, 1062, 1145, 1168, 1412, 3618, 4040, 4190, 4231], 'Guntur': [838], 'K.V.': [839], 'Mol.': [846, 879, 1200, 1488], '2003;': [848, 986, 1048, 1172, 1202, 1265, 1895, 1930, 3604, 4045, 4257], '11:': [849, 1203], '895-904Abstract': [850], '(766)': [858], '7Loewith': [861], 'R.': [862, 1118, 1385, 2988], 'Jacinto': [863], 'E.': [864, 1195, 1775], 'Wullschleger': [865], 'S.': [866, 905, 1294, 1320, 1593, 1640, 1697, 1881, 1893, 2350, 3140, 3187, 3244], 'Lorberg': [867], 'A.': [868, 1102, 1112, 1181, 1369, 1379, 1576, 1634, 1738, 1773, 1854, 1894, 1914, 2003, 2045, 2151, 2233, 2505, 2649, 2919, 3123, 3181, 3977, 3996, 4036], 'Crespo': [869], 'J.L.': [870, 1197], 'Bonenfant': [871], 'Oppliger': [873], 'W.': [874, 1108, 1375], 'Jenoe': [875], 'Hall': [877], 'M.N.': [878, 1020, 3576], '10:': [882, 1492], '457-468Abstract': [883], '(1457)': [891], '8Hara': [894], 'K.': [895, 901, 911, 980, 1022, 1216, 1322, 1597, 2196, 3144, 3578, 4088, 4251], 'Maruki': [896], 'Y.': [897, 1018, 1066, 1133, 1158, 1218, 1296, 1318, 1400, 1744, 1856, 1858, 1922, 3574, 3622, 3702, 3983, 3998, 4000], 'Long': [898], 'Yoshino': [900], 'Oshiro': [902], 'N.': [903, 1742, 1887, 1910, 1920, 3981], 'Hidayat': [904], 'Tokunaga': [906], 'C.': [907, 1714, 1883, 2301, 3261], 'Yonezawa': [910, 1321], '177-189Abstract': [915], '(1441)': [923], 'In': [926, 1730, 1966, 2521, 2562, 2840, 3641, 3962], 'cells,': [928, 2842, 3285, 3643, 3966, 4349], 'AMPK': [936, 4326, 4339, 4378], '(9Carling': [937, 4189], 'Trends': [939, 1025, 1045, 1069, 3581, 3601, 3625, 4191], 'Biochem.': [940, 1026, 1046, 3582, 3602, 4043, 4192], 'Sci.': [941, 1027, 1047, 1891, 3583, 3603, 4193], '29:': [943, 1029, 3585, 4195], '18-24Abstract': [944, 4196], '(957)': [952, 4204], '10Cheng': [955], 'S.W.': [956, 4227], 'Fryer': [957, 4228], 'L.G.': [958, 1239, 4229], 'Carling': [959, 4230], 'Shepherd': [961, 4232], 'P.R.': [962, 4233], 'Biol.': [964, 1071, 1121, 1148, 1171, 1227, 1244, 1264, 1300, 1326, 1388, 1415, 1435, 1490, 1583, 1612, 1643, 1662, 1681, 1702, 1747, 1783, 2010, 2158, 2240, 2512, 2618, 2656, 3130, 3159, 3190, 3209, 3228, 3249, 3627, 3680, 3712, 3986, 4235], '15719-15722Abstract': [968, 4239], '(263)': [976, 4247], '11Inoki': [979, 4250], 'Zhu': [981, 1219, 4252], 'T.': [982, 1110, 1139, 1185, 1220, 1241, 1377, 1406, 1630, 1740, 1860, 3177, 3979, 4002, 4253], 'Guan': [983, 1023, 1223, 3579, 4254], 'K.L.': [984, 1024, 1224, 3580, 4255], '115:': [987, 4258], '577-590Abstract': [988, 4259], '(2997)': [996, 4267], 'Finally,': [999, 3424, 3807], 'factor': [1001], 'leads': [1003, 3018], 'TSC1/TSC2': [1012, 1092, 1358, 3569, 4217], '(reviewed': [1014], 'Refs.': [1016], '12Li': [1017], 'Corradetti': [1019, 3575], 'Inoki': [1021, 3577], '32-38Abstract': [1030, 3586], '(334)': [1038, 3594], '13Manning': [1041, 3597], 'B.D.': [1042, 1256, 3598], 'Cantley': [1043, 1259, 1637, 3184, 3599, 3707], 'L.C.': [1044, 1260, 1638, 3185, 3600, 3708], '28:': [1049, 3605], '573-576Abstract': [1050, 3606], '(394)': [1058, 3614], '14Pan': [1061, 3617], 'Dong': [1063, 3619], 'Zhang': [1065, 1132, 1399, 1577, 2004, 2152, 2234, 2506, 2650, 3124, 3621], 'Gao': [1067, 1159, 3623], 'Cell': [1070, 1120, 1147, 1170, 1226, 1243, 1387, 1414, 1582, 1611, 1642, 1661, 1680, 1701, 1746, 2009, 2128, 2157, 2239, 2275, 2511, 2655, 2923, 3129, 3158, 3189, 3208, 3227, 3248, 3626, 3985], '14:': [1073, 3629], '78-85Abstract': [1074, 3630], '(133)': [1082, 3638], 'Akt-mediated': [1085], 'GAP': [1089], 'toward': [1093], 'Rheb': [1095, 1099, 1278, 1345], 'GTPase,': [1096], 'leading': [1097], '(15Jaeschke': [1101, 1368], 'Hartkamp': [1103, 1370], 'Saitoh': [1105, 1372], 'M.': [1106, 1187, 1189, 1373, 1595, 1599, 1609, 1718, 2305, 2986, 3142, 3146, 3156, 3265], 'Roworth': [1107, 1374], 'Nobukuni': [1109, 1184, 1376], 'Hodges': [1111, 1378], 'Sampson': [1113, 1380], 'Lamb': [1117, 1384, 2046], '159:': [1123, 1390], '217-224Crossref': [1124, 1391], '(183)': [1127, 1394], '16Gao': [1130, 1397], 'Arrazola': [1134, 1401], 'Hino': [1136, 1403], 'O.': [1137, 1404, 3672], 'Kobayashi': [1138, 1405], 'Yeung': [1140, 1407], 'R.S.': [1141, 1408], 'Ru': [1142, 1163, 1409], 'B.': [1143, 1164, 1410, 1842, 1844, 1926, 2198, 2323, 4090], 'Pan': [1144, 1167, 1411], 'Nat.': [1146, 1169, 1225, 1242, 1413, 1610, 3157], '4:': [1150, 1229, 1246, 1417], '699-704Crossref': [1151, 1418], '(570)': [1154, 1421], '17Zhang': [1157], 'Saucedo': [1161], 'L.J.': [1162], 'Edgar': [1165], 'B.A.': [1166], '5:': [1173], '578-581Crossref': [1174], '(715)': [1177], '18Garami': [1180], 'Zwartkruis': [1182], 'F.J.': [1183], 'Joaquin': [1186], 'Roccio': [1188], 'Stocker': [1190], 'Kozma': [1192], 'Hafen': [1194], 'Bos': [1196], '1457-1466Abstract': [1204], '(848)': [1212], '19Inoki': [1215], 'Li': [1217], 'Wu': [1221], '648-657Crossref': [1230], '(2392)': [1233], '20Potter': [1236], 'C.J.': [1237], 'Pedraza': [1238], 'Xu': [1240], '658-665Crossref': [1247], '(777)': [1250], '21Tee': [1253], 'A.R.': [1254, 1429, 1801], 'Manning': [1255], 'Roux': [1257, 4037], 'P.P.': [1258], '13:': [1266], '1259-1268Abstract': [1267], '(945)': [1275], 'binds': [1279], 'process': [1284], 'acids': [1290, 1343, 2121, 3924, 4034], '(22Long': [1291], 'Ortiz-Vega': [1293, 1319], 'Lin': [1295, 1317], '2005;': [1302, 1327, 1437], '280:': [1303, 1438], '23433-23436Abstract': [1304], '(280)': [1312], '23Long': [1315], '15:': [1328], '702-713Abstract': [1329], '(742)': [1337], 'Whereas': [1340, 3391], 'both': [1341, 3493, 3916, 4130, 4311], 'are': [1347, 2544, 3499, 3861], 'required': [1348, 1734, 1872, 2034, 2065, 2950, 3072, 3430, 3500, 3862], 'for': [1349, 1735, 1873, 2035, 2066, 2108, 2460, 2602, 2695, 2709, 2951, 2978, 3073, 3084, 3320, 3431, 3501, 3556, 3734, 3863, 4334], 'signaling': [1351, 2118, 3112], 'played': [1356], 'been': [1366, 1464, 1560, 1768, 1964, 2225, 2295, 3107], 'controversial': [1367], '24Smith': [1424], 'E.M.': [1425], 'Finn': [1426], 'S.G.': [1427], 'Tee': [1428], 'Browne': [1430], 'G.J.': [1431, 3666], 'Proud': [1432], 'C.G.': [1433], '18717-18727Abstract': [1439], '(295)': [1447], 'Unlike': [1450], 'I': [1453, 3655], 'previously': [1465, 2144, 2226, 2296, 2498, 2642, 3093], 'implicated': [1466, 1769], 'nutrients.': [1472], 'Vps34p': [1473, 1527, 1732], 'was': [1474, 2319, 2332, 2346, 2451, 2533, 2552, 2802, 2857, 3060, 3279, 3339, 3395, 3471, 3483, 3795, 3899, 3944, 4105, 4298, 4344], 'first': [1475, 3528], 'identified': [1476], 'Saccharomyces': [1478], 'cerevisiae': [1479], 'Emr': [1481, 1486, 1505, 1543], 'colleagues': [1483], '(25Herman': [1484], 'P.K.': [1485, 1502, 1540], 'S.D.': [1487, 1506, 1544], '1990;': [1491], '6742-6754Crossref': [1493], '(356)': [1496], '26Stack': [1499], 'J.H.': [1500, 1538], 'Herman': [1501, 1539, 1841], 'Schu': [1503, 1541], 'P.V.': [1504, 1542], 'EMBO': [1507, 1545, 1861, 2997, 4003], '1993;': [1509, 1547, 2051], '12:': [1510, 1548], '2195-2204Crossref': [1511, 1549], '(264)': [1514, 1552], 'Scholar),': [1516, 1755, 1870, 2018, 4012, 4206], 'who': [1517], 'characterized': [1518], 'vesicular': [1522, 1568], 'trafficking.': [1523], 'requires': [1528], 'presence': [1530, 2592, 2704, 3315], 'an': [1532, 1824, 2903, 2965, 3384, 4062, 4078, 4212, 4221], 'Vps15p': [1536], '(26Stack': [1537], 'homologue': [1557], 'shown': [1561], 'play': [1563, 2024], 'multiple': [1567], 'trafficking': [1569], 'pathways': [1570], '(27Siddhanta': [1571, 1998, 2146, 2228, 2500, 2644, 3118], 'U.': [1572, 1892, 1999, 2147, 2229, 2501, 2645, 3119], 'McIlroy': [1573, 2000, 2148, 2230, 2502, 2646, 3120], 'Shah': [1575, 2002, 2150, 2232, 2504, 2648, 3122], 'Y.T.': [1578, 2005, 2153, 2235, 2507, 2651, 3125], 'Backer': [1579, 1606, 1635, 1656, 1675, 1692, 1719, 1810, 2006, 2154, 2236, 2306, 2508, 2652, 3126, 3153, 3182, 3203, 3222, 3239, 3266], 'J.M.': [1580, 1607, 1636, 1657, 1676, 1693, 1720, 1811, 1813, 2007, 2155, 2237, 2307, 2509, 2653, 2992, 3127, 3154, 3183, 3204, 3223, 3240, 3267], '1998;': [1584, 1847, 2011, 2159, 2241, 2513, 2657, 3131, 3714], '143:': [1585, 2012, 2160, 2242, 2514, 2658, 3132], '1647-1659Crossref': [1586, 2013, 2161, 2243, 2515, 2659, 3133], '(138)': [1589, 2016, 2164, 2246, 2518, 2662, 3136], '28Christoforidis': [1592, 3139], 'Miaczynska': [1594, 1717, 2304, 3141, 3264], 'Ashman': [1596, 3143], 'Wilm': [1598, 3145], 'Zhao': [1600, 3147], 'L.': [1601, 1626, 1807, 3148, 3173], 'Yip': [1602, 3149], 'S.-C.': [1603, 3150], 'Waterfield': [1604, 3151], 'M.D.': [1605, 3152], 'Zerial': [1608, 3155], '1999;': [1613, 2925, 3160], '1:': [1614, 3161], '249-252Crossref': [1615, 3162], '(502)': [1618, 3165], '29Vieira': [1621, 3168], 'O.V.': [1622, 3169], 'Botelho': [1623, 3170], 'R.J.': [1624, 3171], 'Rameh': [1625, 3172, 3697], 'Brachmann': [1627, 1804, 3174], 'Matsuo': [1629, 3176], 'Davidson': [1631, 3178], 'H.W.': [1632, 3179], 'Schreiber': [1633, 3180], 'Grinstein': [1639, 3186], '155:': [1645, 1683, 3192, 3230], '19-25Crossref': [1646, 3193], '(421)': [1649, 3196], '30Tuma': [1652, 3199], 'P.L.': [1653, 3200], 'Nyasae': [1654, 3201], 'L.K.': [1655, 1832, 3202], 'Hubbard': [1658, 3205], 'A.L.': [1659, 3206], '154:': [1664, 1704, 3211, 3251], '1197-1208Crossref': [1665, 3212], '(41)': [1668, 3215], '31Futter': [1671, 3218], 'C.E.': [1672, 3219], 'Collinson': [1673, 3220], 'L.M.': [1674, 3221], 'Hopkins': [1677, 3224], 'C.R.': [1678, 3225], '1251-1264Crossref': [1684, 3231], '(201)': [1687, 3234], '32Fratti': [1690, 3237], 'R.A.': [1691, 3238, 3678], 'Gruenberg': [1694, 3241], 'Corvera': [1696, 3243], 'Deretic': [1698, 3245], 'V.': [1699, 3246], '631-644Crossref': [1705, 3252], '(417)': [1708, 3255], '33Murray': [1711, 3258], 'J.T.': [1712, 2299, 3259], 'Panaretou': [1713, 2300, 3260], 'Stenmark': [1715, 2302, 2995, 3262], 'Traffic.': [1721, 1814, 2308, 3268], '3:': [1723, 1816, 2310, 3270], '416-427Crossref': [1724, 2311, 3271], '(153)': [1727, 2314, 3274], 'yeast,': [1731], 'autophagy': [1736, 1771, 1874, 4029], '(34Kihara': [1737, 3976], 'Noda': [1739, 3978], 'Ishihara': [1741, 3699, 3980], 'Ohsumi': [1743, 1857, 1921, 3982, 3999], '152:': [1749, 3988], '519-530Crossref': [1750, 3989], '(804)': [1753, 3992], 'deprivation.': [1763], 'Vps34': [1765], '(35Petiot': [1772], 'Ogier-Denis': [1774], 'Blommaart': [1776], 'E.F.C.': [1777], 'Meijer': [1778], 'A.J.': [1779, 1885], 'Codogno': [1780], '2000;': [1785, 2999], '275:': [1786], '992-998Abstract': [1787], '(1032)': [1795], '36Eskelinen': [1798], 'E.L.': [1799, 1918], 'Prescott': [1800], 'Cooper': [1802], 'Wang': [1806], 'Tang': [1808], 'Lucocq': [1812], '878-893Crossref': [1817], '(143)': [1820], 'Moreover,': [1823], 'hVps34-associated': [1825], 'protein,': [1826], 'beclin': [1827, 2185, 2548, 2560, 4019, 4058, 4081, 4101], '1': [1828, 2186, 2706, 3317, 3975, 4082], '(37Liang': [1829], 'X.H.': [1830, 2192, 4084], 'Kleeman': [1831], 'Jiang': [1833], 'H.H.': [1834], 'Gordon': [1835], 'Goldman': [1837], 'Berry': [1839], 'Levine': [1843, 1884, 1925, 2197, 4089], 'Virol.': [1846], '72:': [1848], '8586-8596Crossref': [1849], '38Kihara': [1853, 3995], 'Kabeya': [1855, 3997], 'Yoshimori': [1859, 4001], 'Rep.': [1862, 4004], '2:': [1864, 4006], '330-335Crossref': [1865, 4007], '(724)': [1868, 4010], '(39Yue': [1878], 'Z.': [1879], 'Jin': [1880], 'Yang': [1882], 'Heintz': [1886], 'Proc.': [1888], 'Natl.': [1889], 'Acad.': [1890], '100:': [1896], '15077-15082Crossref': [1897], '(1765)': [1900], '40Qu': [1903], 'Yu': [1905, 2193, 4085], 'Bhagat': [1907], 'Furuya': [1909], 'Hibshoosh': [1911], 'Troxel': [1913], 'Rosen': [1915], 'Eskelinen': [1917], 'Mizushima': [1919], 'Cattoretti': [1923], 'Clin.': [1928], 'Investig.': [1929], '112:': [1931], '1809-1820Crossref': [1932], '(1863)': [1935], 'Although': [1938], 'these': [1939, 2531, 3104, 3489], 'involved': [1945, 3900], 'pathways,': [1948], 'possibility': [1950], 'might': [1954, 2023], 'be': [1955, 2493, 3515, 3646, 4170], 'state': [1961], 'addressed.': [1965], 'study,': [1969], 'we': [1970, 2019, 2831, 2957, 3008, 3091, 3442, 3527, 3771, 3808, 4067, 4279], 'have': [1971, 2224, 3106], 'examined': [1972, 3553], 'function': [1974], 'Based': [1985], 'our': [1987], 'previous': [1988, 4015], 'finding': [1989], 'blocks': [1994], 'DNA': [1996], 'synthesis': [1997], 'tested': [2020, 2832, 3896], 'whether': [2021, 2833, 2947, 3427, 3897, 4272], 'G1-S': [2037], 'transition': [2038], '(41Lane': [2042], 'H.A.': [2043], 'Fernandez': [2044], 'N.J.': [2047, 2990], 'Nature.': [2050], '363:': [2052], '170-172Crossref': [2053], '(318)': [2056], 'report': [2061, 4016], 'nor': [2077], 'does': [2078], 'affect': [2080], 'TSC2.': [2086], 'AMPK.': [2101], 'These': [2102, 2933, 3063], 'novel': [2106], 'sensing,': [2112, 2830], 'integration': [2116], 'from': [2119, 2187, 2208, 2258, 2274, 2285, 2321, 2334, 2348, 2413, 2482, 4074], 'Culture—HepG2': [2129], 'responsive': [2134], 'Chinese': [2135, 2881], 'hamster': [2136, 2882], 'ovary-derived': [2137], 'line': [2139, 2884, 3447], 'GRC+LR-73': [2140, 2369, 2569, 2885, 3284, 3300, 3760, 3932, 4330], 'were': [2141, 2206, 2256, 2272, 2283, 2355, 2366, 2379, 2390, 2411, 2419, 2426, 2435, 2458, 2571, 2586, 2600, 2631, 2639, 2691, 2713, 2730, 2755, 2795, 2808, 3302, 3414, 3536, 3762, 3915, 3929, 4332, 4367], 'cultured': [2142], 'described': [2145, 2227, 2297, 2499, 2612, 2643, 3094], '42Pollard': [2167], 'J.W.': [2168, 2887], 'Stanners': [2169, 2888], 'C.P.': [2170, 2889], 'Physiol.': [2173, 2892], '1979;': [2174, 2893], '98:': [2175, 2894], '571-585Crossref': [2176, 2895], '(75)': [2179, 2898], 'MCF-7': [2182, 4075], 'expressing': [2184, 3468, 3475, 4077], 'tetracycline-repressible': [2189], 'promoter': [2190], '(43Liang': [2191, 4083], 'Brown': [2195, 4087], 'Cancer': [2199, 4091], 'Res.': [2200, 2924, 4092], '61:': [2202, 4094], '3443-3449PubMed': [2203, 4095], 'Scholar)': [2205, 2664, 2900], 'obtained': [2207, 2257, 2273, 2320, 2333, 2347, 3415, 3930], 'Dr.': [2209, 2322, 2335, 2349], 'Beth': [2210], 'Levine,': [2211], 'University': [2212], 'Texas': [2214], 'Southwestern': [2215], 'Medical': [2216], 'Center,': [2217], 'Dallas,': [2218], 'TX.': [2219], 'Antibodies': [2220], 'Inhibitors—Anti-hVps34': [2222], 'antibodies': [2223, 2255, 2271, 2444, 2666, 3095, 3105, 3288], 'Anti-phospho-Akt': [2249], '(Ser473)': [2250, 2745], 'anti-phosphoribosomal': [2252], '(Ser235)': [2254], 'Upstate': [2259], 'Biotechnology': [2260], '(Lake': [2261], 'Placid,': [2262], 'NY).': [2263], 'Anti-phospho-S6K1': [2264], '(Thr389': [2265], 'Thr421/Ser424)': [2267], 'anti-phospho-TSC2': [2269], '(Ser939)': [2270], 'Signaling': [2276], '(Beverly,': [2277], 'MA).': [2278], 'Rapamycin,': [2279], 'oligomycin,': [2280, 4374], '5-aminoimidazole-4-carboxamide-1-β-riboside': [2282], 'purchased': [2284], 'CalBiochem': [2286], '(La': [2287], 'Jolla,': [2288], 'CA).': [2289, 2376], 'Plasmid': [2290], 'Constructs': [2291, 2354], 'Transfections—Myc-hVps34': [2293], '(33Murray': [2298], 'Myc-tagged': [2317], 'Hansen,': [2325], 'Novo-Nordisk': [2326], '(Copenhagen,': [2327], 'Denmark).': [2328], 'eGFP-2X-FYVE': [2330, 2581], 'Stenmark,': [2337], 'Norwegian': [2338], 'Radium': [2339], 'Hospital,': [2340], 'Norway.': [2341], 'HA-tagged': [2342], 'Schreiber,': [2351], 'Harvard': [2352], 'University.': [2353], 'introduced': [2356, 2367], 'into': [2357, 2368], 'HEK293T': [2358, 2841, 3919], 'using': [2360, 2371, 2384, 2605, 2665, 2764, 2804, 3286, 3829], 'calcium': [2361], 'phosphate': [2362, 3657], 'transfection.': [2363], 'Alternatively,': [2364, 2547], 'plasmids': [2365], 'Lipofectamine': [2372], 'Plus': [2373], '(Invitrogen,': [2374], 'Carlsbad,': [2375], 'HeLa': [2377, 3366, 3372, 3803], 'transfected': [2380, 2391, 2572], 'siRNA': [2382, 2388, 3360, 3375, 3419, 3798, 3818, 3832], 'duplexes': [2383, 2410, 3833], 'Oligofectamine': [2385], '(Invitrogen).': [2386], 'Experiments—Cells': [2389], 'following': [2394], 'duplexes:': [2396], 'ACUCAACACUGGCUAAUUAUU': [2397], 'UAAUUAGCCAGUGUUGAGUUU;': [2399], 'AUAGAUAGCUCCCAAAUUAUU': [2400], 'UAAUUUGGGAGCUAUCUAUUU;': [2402], 'GAACAACGGUUUCGCUCUUUU': [2403], 'AAGAGCGAAACCGUUGUUCUU;': [2405], 'GGAGGCAAAUAUCCAGUUAUU': [2406], 'UAACUGGAUAUUUGCCUCCUU.': [2408], 'Control': [2409], 'derived': [2412], 'sequence': [2415], 'luciferase.': [2417], 'Cells': [2418, 2690, 2712, 2729], 'harvested': [2420], 'after': [2421, 3546, 4369], '3': [2422, 2682], 'days,': [2423], 'lysates': [2425], 'immunoprecipitated': [2427, 2452, 2539], 'blotted': [2429, 2436], 'antibodies.': [2432, 2455, 2750, 3786], 'Parallel': [2433], 'samples': [2434], 'anti-Akt,': [2438], 'phospho-Akt,': [2440], 'phospho-S6K1,': [2441], 'phospho-TSC2': [2443], 'indicated.': [2446, 2583], 'Activity': [2448], 'Assay—Endogenous': [2449], 'Washed': [2456], 'immunoprecipitates': [2457, 2557, 2599, 4073], 'incubated': [2459, 2587, 2699, 3310], '30': [2461, 2464, 2710, 3321, 3947, 4335], 'min': [2462, 4336], '°C': [2465], '10': [2467], 'μm': [2468, 2707, 3318], 'peptide': [2471, 2609], 'raise': [2474], 'antibody': [2476, 2684, 2735], '(AVVEQIHKFAQYWRK).': [2477], 'This': [2478, 3727, 3949, 4166], 'incubation': [2479], 'releases': [2480], 'antibody,': [2484, 2740, 3309, 3770], 'inhibitory,': [2487], 'allows': [2489], 'measured': [2494, 2529, 2553, 2803, 2958, 3529, 3780, 4068, 4280], 'vitro': [2496], 'control': [2522, 2819, 2860, 3305, 3353, 3380, 3765], 'experiments,': [2523], 'specific': [2525], 'identical': [2534], 'myc-hVps34': [2538, 2845], 'anti-myc': [2541], 'inhibitory.': [2546], '1-associated': [2549, 4020, 4059, 4102], 'washed': [2556], 'FLAG-tagged': [2559, 4080], '1.': [2561], 'Vitro': [2563], 'Kinase': [2566], 'Assay—HEK293T': [2567], 'HA-S6K1': [2574, 2852, 3054, 3058, 3909], 'alone': [2575], 'myc-hVps34,': [2578], 'Quiescent': [2584, 2637], 'absence': [2590, 2702, 3313], 'indicated,': [2596], 'anti-HA': [2598], 'assayed': [2601], 'substrate': [2608], 'KRRRLASLAA': [2610], '(44Flotow': [2613], '1992;': [2620], '267:': [2621], '3074-3078Abstract': [2622], 'Microinjection—GRC+LR-73': [2629], 'grown': [2632], 'polylysine-coated': [2634], 'glass': [2635], 'coverslips.': [2636], 'microinjected': [2640, 2789, 3102, 3303, 3763], 'mixed': [2667], 'Oregon': [2669], 'Green': [2670], 'dextran': [2671], 'conjugate': [2672], '(Molecular': [2673], 'Probes,': [2674], 'Eugene,': [2675], 'OR)': [2676], 'final': [2679], 'concentration': [2680], 'mg/ml': [2683], 'phosphate-buffered': [2686], 'saline,': [2687], 'pH': [2688], '7.4.': [2689], 'allowed': [2692], 'recover': [2694], '2': [2696], 'h,': [2697], 'then': [2698, 3324], 'min.': [2711, 3948], 'fixed,': [2714], 'permeabilized': [2715], '1%': [2717], 'Triton': [2718], 'X-100,': [2719], 'Renaissance': [2723], 'blocking': [2724], 'reagent': [2725], '(PerkinElmer': [2726], 'Life': [2727], 'Science).': [2728], 'stained': [2731], 'sheep': [2733], 'anti-pSer235-S6': [2734, 3287], 'followed': [2736, 2746], 'Cy3': [2738, 2748], 'anti-sheep': [2739], 'mouse': [2743], 'anti-pSer473-Akt': [2744], 'anti-mouse': [2749], 'Imaging': [2751], 'Fluorescence': [2753], 'Quantitation—Images': [2754], 'collected': [2756], 'Nikon': [2759], 'Eclipse': [2760], '400': [2761], 'upright': [2762], 'microscope': [2763], '60': [2766], '×': [2767, 2772], '1.4': [2768], 'NA': [2769, 2774], '100': [2771], '1.25': [2773], 'oil': [2775], 'emersion': [2776], 'objectives': [2777], 'Roper': [2780], 'Cool-Snap': [2781], 'cooled': [2782], 'CCD': [2783], 'camera.': [2784], 'Fluorescent': [2785], 'images': [2786], 'individual': [2788], '(30–50': [2791], 'per': [2793], 'condition)': [2794], 'traced,': [2796], 'total': [2799, 3392], 'fluorescence': [2800, 2815], 'intensity': [2801], 'NIH': [2805], 'Image.': [2806], 'Data': [2807], 'expressed': [2809], 'percentage': [2812], 'observed': [2816, 3772, 4368], 'To': [2821, 2945, 3079, 3517, 4053, 4270, 4320], 'investigate': [2822], 'potential': [2824, 4323], 'could': [2837, 3729, 3745], 'activate': [2838], 'lead': [2846, 2901, 3382, 3746], '2-fold': [2849, 3460], 'increase': [2850, 2904], 'activity,': [2853], 'similar': [2854, 4299], 'what': [2856], 'seen': [2858, 4302], '(Fig.': [2865, 2911, 3037, 3055, 3298, 3355, 3368, 3479, 3549, 3787, 3805, 3834, 3925, 3934, 4111, 4307, 4363, 4379], '1A).': [2866], 'Furthermore,': [2867], 'insulin-responsive': [2880, 3445], 'ovary': [2883], '(42Pollard': [2886], '1B),': [2912], 'correlates': [2914], '(45Dufner': [2918], 'Exp.': [2922], '253:': [2926], '100-109Crossref': [2927], '(605)': [2930], 'show': [2935, 3491], 'increased': [2937], 'expression': [2938, 2969, 3013, 3040, 3364, 3394, 3482], 'determine': [2946, 3426, 3518, 4271], 'overexpressing': [2964], 'eGFP-2XFYVE': [2966, 3455], 'construct.': [2967, 3456], 'Low-level': [2968], 'this': [2971, 4328], 'useful': [2974], 'marker': [2977], 'PI(3)P-containing': [2979], 'membranes': [2980], '(46Gillooly': [2981], 'D.J.': [2982], 'Morrow': [2983], 'I.C.': [2984], 'Lindsay': [2985], 'Gould': [2987], 'Bryant': [2989], 'Gaullier': [2991], 'Parton': [2993], 'R.G.': [2994], '19:': [3000], '4577-4588Crossref': [3001], '(854)': [3004], 'found': [3009, 4099], 'high': [3011], 'level': [3012], '2X-FYVE': [3016, 3477], 'sequestration': [3020], 'PI(3)P': [3022, 3644], 'disruption': [3024], 'PI(3)P-dependent': [3026], 'signaling,': [3027], 'indicated': [3029], 'loss': [3032, 3387], 'EEA1': [3034], 'endosomal': [3035], 'targeting': [3036, 3376], '1C).': [3038], 'Similarly,': [3039, 3789], 'eGFP-2XFYVE,': [3042], 'but': [3043, 3347, 3378], 'caused': [3046, 3458], 'significant': [3048, 3540], 'reduction': [3049], '1D).': [3056], 'Basal': [3057], 'affected.': [3062], 'product,': [3069, 3497], 'insulin.': [3078], 'address': [3081], 'requirement': [3083, 3555], 'specifically': [3097], 'inhibit': [3098], 'cells;': [3103], 'characterize': [3110], 'hVps34-dependent': [3111], 'number': [3115], 'systems': [3117], 'analyzed': [3280], 'immunofluorescence': [3282, 3782], 'detect': [3290, 3539], 'ribosomal': [3295], 'subunit': [3297], '1E).': [3299], 'IgG': [3306, 3354, 3766], 'min,': [3322], 'fixed': [3325], 'stained.': [3327], 'Quantitative': [3328], 'imaging': [3329], 'anti-phospho-S6': [3331], 'staining': [3332, 3783], 'showed': [3333, 3401], 'injected': [3343, 3351], '1F).': [3356], 'reduce': [3362], '1G).': [3369], 'Transfection': [3370], 'almost': [3385], 'complete': [3386], 'expression.': [3390], 'minimally': [3396], 'affected,': [3397], 'siRNA-treated': [3399], 'marked': [3403], 'decrease': [3404, 3950], 'Thr389.': [3411], 'Similar': [3412, 3927, 4365], 'results': [3413, 3928, 4366], 'second': [3418], 'duplex': [3420], '(data': [3421, 3485], 'shown).': [3423, 3487], 'more': [3438], 'physiological': [3439], 'type,': [3441], 'co-transfected': [3443], 'hepatoma': [3446], 'HepG2': [3448, 3466], 'plus': [3451], 'eGFP': [3452], 'Insulin': [3457], 'abolished': [3472], '1H).': [3480], 'unaffected': [3484, 3796, 4395], 'Overall,': [3488], 'insulin-': [3507], 'acid-regulated': [3510], 'may': [3514, 4169], 'distinct.': [3516], 'mechanism': [3520, 3733], 'signals': [3524], 'unable': [3537], 'increases': [3541], 'endogenous': [3543, 3912], '2A).': [3550], 'next': [3552], 'Akt,': [3562, 3753], 'major': [3566], 'regulator': [3567], '(12Li': [3573], 'can': [3645], 'converted': [3647], 'PI(3,4,5)P3': [3649], 'action': [3652], '(47Zhang': [3659], 'X.L.': [3660], 'Loijens': [3661], 'J.C.': [3662], 'Boronenkov': [3663], 'I.V.': [3664], 'Parker': [3665], 'Norris': [3667], 'F.A.': [3668], 'Chen': [3669, 3703], 'Thum': [3671], 'Prestwich': [3673, 3705], 'G.D.': [3674, 3706], 'Majerus': [3675], 'P.W.': [3676], 'Anderson': [3677], '1997;': [3682], '272:': [3683], '17756-17761Abstract': [3684], '(121)': [3692], '48Tolias': [3695], 'K.F.': [3696], 'L.E.': [3698], 'Shibisaki': [3701], 'Carpenter': [3709], 'C.L.': [3710], '273:': [3715], '18040-18046Abstract': [3716], '(123)': [3724], 'provide': [3730], 'plausible': [3732], 'production': [3748], 'TSC1/TSC2.': [3757], 'when': [3759], 'effects': [3774, 4388], 'activation,': [3778], 'anti-pSer473-AKT': [3785], '2B).': [3788], 'Ser473': [3794], '2C).': [3806], 'looked': [3809], 'Ser939;': [3817], 'had': [3822], 'TSC2,': [3828], 'two': [3830], 'distinct': [3831], '2,': [3835], 'D': [3836], 'E).': [3838], 'Thus,': [3839], 'independent': [3848, 4386], 'Akt/TSC2': [3851], 'pathway.': [3852], '2Fingar': [3881], 'therefore': [3895], 'acid-dependent': [3904], 'Insulin-stimulated': [3908], 'deprived': [3921, 4285], '3A).': [3926], '3B),': [3935], 'where': [3936], 'starvation': [3943, 4135, 4297, 4306], 'maximal': [3945], 'occurred': [3951], 'without': [3952], 'any': [3953], 'change': [3954, 4120], 'abundance': [3957], '(inset).': [3961, 4122], 'yeast': [3963, 4188], 'forms': [3968], 'complexes': [3969], 'autophagy-related': [3972], 'Apg6p/beclin': [3974], 'suggested': [4017], 'transiently': [4023], 'induction': [4027], 'withdrawal': [4031], '(49Tassa': [4035], 'M.P.': [4038], 'Attaix': [4039], 'Bechet': [4041], '376:': [4046], '577-586Crossref': [4047], '(194)': [4050], 'study': [4054], 'established': [4063], 'autophagy-competent': [4064], 'line,': [4066], 'anti-FLAG': [4072], 'inducible': [4079], '3C);': [4112], 'amount': [4114], 'beclin-associated': [4116], 'did': [4118, 4313], 'appreciably': [4121], 'latter': [4167], 'due': [4171], 'through': [4211], 'activating': [4213], 'complex,': [4218], 'via': [4220], '(10Cheng': [4226], 'both.': [4291], 'Inhibition': [4292], '4A);': [4308], 'removal': [4309], 'cause': [4315], 'additional': [4316], 'examine': [4321], 'inhibition,': [4329], 'treated': [4333], 'activator': [4340], '5-aminoimidazole-4-carboxamide-1-β-riboside.': [4341], 'significantly': [4345], '5-aminoimidazole-4-carboxamide-1-β-riboside-treated': [4348], 'negatively': [4354], 'AMPK-mediated': [4358, 4381], '4B).': [4364], 'treatment': [4370, 4397], '4C).': [4380], 'because': [4391], 'rapamycin,': [4401], 'inhibi': [4403]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W1968513003', 'counts_by_year': [{'year': 2024, 'cited_by_count': 2}, {'year': 2023, 'cited_by_count': 5}, {'year': 2022, 'cited_by_count': 7}, {'year': 2021, 'cited_by_count': 11}, {'year': 2020, 'cited_by_count': 15}, {'year': 2019, 'cited_by_count': 11}, {'year': 2018, 'cited_by_count': 10}, {'year': 2017, 'cited_by_count': 16}, {'year': 2016, 'cited_by_count': 19}, {'year': 2015, 'cited_by_count': 23}, {'year': 2014, 'cited_by_count': 32}, {'year': 2013, 'cited_by_count': 38}, {'year': 2012, 'cited_by_count': 43}], 'updated_date': '2024-12-17T05:59:50.776671', 'created_date': '2016-06-24'}
Publication Information

Basic Information

Access and Citation

AI Researcher Chatbot

Primary Location

Authors

Topics

Keywords

Related Works
