The Role of Hepatic Nuclear Factor 1α and PDX-1 in Transcriptional Regulation of the pdx-1 Gene

Name: Work Video:
Duration: 3 min 30 s
Kevin Gerrish; Michelle A. Cissell; Roland Stein
{'id': 'https://openalex.org/W1565835249', 'doi': 'https://doi.org/10.1074/jbc.m109244200', 'title': 'The Role of Hepatic Nuclear Factor 1α and PDX-1 in Transcriptional Regulation of the pdx-1 Gene', 'display_name': 'The Role of Hepatic Nuclear Factor 1α and PDX-1 in Transcriptional Regulation of the pdx-1 Gene', 'publication_year': 2001, 'publication_date': '2001-12-01', 'ids': {'openalex': 'https://openalex.org/W1565835249', 'doi': 'https://doi.org/10.1074/jbc.m109244200', 'mag': '1565835249', 'pmid': 'https://pubmed.ncbi.nlm.nih.gov/11590182'}, 'language': 'en', 'primary_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m109244200', 'pdf_url': 'http://www.jbc.org/article/S0021925819402810/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'type': 'article', 'type_crossref': 'journal-article', 'indexed_in': ['crossref', 'pubmed'], 'open_access': {'is_oa': True, 'oa_status': 'hybrid', 'oa_url': 'http://www.jbc.org/article/S0021925819402810/pdf', 'any_repository_has_fulltext': False}, 'authorships': [{'author_position': 'first', 'author': {'id': 'https://openalex.org/A5063167684', 'display_name': 'Kevin Gerrish', 'orcid': 'https://orcid.org/0000-0002-4236-5329'}, 'institutions': [{'id': 'https://openalex.org/I901861585', 'display_name': 'Vanderbilt University Medical Center', 'ror': 'https://ror.org/05dq2gs74', 'country_code': 'US', 'type': 'healthcare', 'lineage': ['https://openalex.org/I4210162197', 'https://openalex.org/I901861585']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Kevin Gerrish', 'raw_affiliation_strings': ['From the Department of Molecular Physiology and Biophysics, Vanderbilt University Medical Center, Nashville, Tennessee 37215'], 'affiliations': [{'raw_affiliation_string': 'From the Department of Molecular Physiology and Biophysics, Vanderbilt University Medical Center, Nashville, Tennessee 37215', 'institution_ids': ['https://openalex.org/I901861585']}]}, {'author_position': 'middle', 'author': {'id': 'https://openalex.org/A5050121334', 'display_name': 'Michelle A. Cissell', 'orcid': None}, 'institutions': [{'id': 'https://openalex.org/I901861585', 'display_name': 'Vanderbilt University Medical Center', 'ror': 'https://ror.org/05dq2gs74', 'country_code': 'US', 'type': 'healthcare', 'lineage': ['https://openalex.org/I4210162197', 'https://openalex.org/I901861585']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Michelle A. Cissell', 'raw_affiliation_strings': ['From the Department of Molecular Physiology and Biophysics, Vanderbilt University Medical Center, Nashville, Tennessee 37215'], 'affiliations': [{'raw_affiliation_string': 'From the Department of Molecular Physiology and Biophysics, Vanderbilt University Medical Center, Nashville, Tennessee 37215', 'institution_ids': ['https://openalex.org/I901861585']}]}, {'author_position': 'last', 'author': {'id': 'https://openalex.org/A5103208218', 'display_name': 'Roland Stein', 'orcid': 'https://orcid.org/0000-0001-9192-8661'}, 'institutions': [{'id': 'https://openalex.org/I901861585', 'display_name': 'Vanderbilt University Medical Center', 'ror': 'https://ror.org/05dq2gs74', 'country_code': 'US', 'type': 'healthcare', 'lineage': ['https://openalex.org/I4210162197', 'https://openalex.org/I901861585']}], 'countries': ['US'], 'is_corresponding': False, 'raw_author_name': 'Roland Stein', 'raw_affiliation_strings': ['From the Department of Molecular Physiology and Biophysics, Vanderbilt University Medical Center, Nashville, Tennessee 37215'], 'affiliations': [{'raw_affiliation_string': 'From the Department of Molecular Physiology and Biophysics, Vanderbilt University Medical Center, Nashville, Tennessee 37215', 'institution_ids': ['https://openalex.org/I901861585']}]}], 'institution_assertions': [], 'countries_distinct_count': 1, 'institutions_distinct_count': 1, 'corresponding_author_ids': [], 'corresponding_institution_ids': [], 'apc_list': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'apc_paid': {'value': 2500, 'currency': 'USD', 'value_usd': 2500, 'provenance': 'doaj'}, 'fwci': 11.101, 'has_fulltext': True, 'fulltext_origin': 'ngrams', 'cited_by_count': 118, 'citation_normalized_percentile': {'value': 0.949697, 'is_in_top_1_percent': False, 'is_in_top_10_percent': True}, 'cited_by_percentile_year': {'min': 96, 'max': 97}, 'biblio': {'volume': '276', 'issue': '51', 'first_page': '47775', 'last_page': '47784'}, 'is_retracted': False, 'is_paratext': False, 'primary_topic': {'id': 'https://openalex.org/T10839', 'display_name': 'Pancreatic function and diabetes', 'score': 1.0, 'subfield': {'id': 'https://openalex.org/subfields/2746', 'display_name': 'Surgery'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, 'topics': [{'id': 'https://openalex.org/T10839', 'display_name': 'Pancreatic function and diabetes', 'score': 1.0, 'subfield': {'id': 'https://openalex.org/subfields/2746', 'display_name': 'Surgery'}, 'field': {'id': 'https://openalex.org/fields/27', 'display_name': 'Medicine'}, 'domain': {'id': 'https://openalex.org/domains/4', 'display_name': 'Health Sciences'}}, {'id': 'https://openalex.org/T11772', 'display_name': 'Genetics and Neurodevelopmental Disorders', 'score': 0.9759, 'subfield': {'id': 'https://openalex.org/subfields/1311', 'display_name': 'Genetics'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}, {'id': 'https://openalex.org/T11171', 'display_name': 'Diabetes and associated disorders', 'score': 0.9759, 'subfield': {'id': 'https://openalex.org/subfields/1311', 'display_name': 'Genetics'}, 'field': {'id': 'https://openalex.org/fields/13', 'display_name': 'Biochemistry, Genetics and Molecular Biology'}, 'domain': {'id': 'https://openalex.org/domains/1', 'display_name': 'Life Sciences'}}], 'keywords': [{'id': 'https://openalex.org/keywords/chromatin-immunoprecipitation', 'display_name': 'Chromatin immunoprecipitation', 'score': 0.62485147}, {'id': 'https://openalex.org/keywords/hepatocyte-nuclear-factors', 'display_name': 'Hepatocyte nuclear factors', 'score': 0.4808348}], 'concepts': [{'id': 'https://openalex.org/C86339819', 'wikidata': 'https://www.wikidata.org/wiki/Q407384', 'display_name': 'Transcription factor', 'level': 3, 'score': 0.8007088}, {'id': 'https://openalex.org/C134320426', 'wikidata': 'https://www.wikidata.org/wiki/Q901026', 'display_name': 'Chromatin immunoprecipitation', 'level': 5, 'score': 0.62485147}, {'id': 'https://openalex.org/C86803240', 'wikidata': 'https://www.wikidata.org/wiki/Q420', 'display_name': 'Biology', 'level': 0, 'score': 0.5331784}, {'id': 'https://openalex.org/C72699923', 'wikidata': 'https://www.wikidata.org/wiki/Q3064192', 'display_name': 'Hepatocyte nuclear factor 4', 'level': 5, 'score': 0.53125376}, {'id': 'https://openalex.org/C83640560', 'wikidata': 'https://www.wikidata.org/wiki/Q180951', 'display_name': 'Chromatin', 'level': 3, 'score': 0.50641525}, {'id': 'https://openalex.org/C121587040', 'wikidata': 'https://www.wikidata.org/wiki/Q898769', 'display_name': 'Homeobox', 'level': 4, 'score': 0.4844201}, {'id': 'https://openalex.org/C99535661', 'wikidata': 'https://www.wikidata.org/wiki/Q5731779', 'display_name': 'Hepatocyte nuclear factors', 'level': 4, 'score': 0.4808348}, {'id': 'https://openalex.org/C104317684', 'wikidata': 'https://www.wikidata.org/wiki/Q7187', 'display_name': 'Gene', 'level': 2, 'score': 0.4647597}, {'id': 'https://openalex.org/C161733203', 'wikidata': 'https://www.wikidata.org/wiki/Q911828', 'display_name': 'Reporter gene', 'level': 4, 'score': 0.46126157}, {'id': 'https://openalex.org/C107824862', 'wikidata': 'https://www.wikidata.org/wiki/Q616005', 'display_name': 'Binding site', 'level': 2, 'score': 0.44348556}, {'id': 'https://openalex.org/C153911025', 'wikidata': 'https://www.wikidata.org/wiki/Q7202', 'display_name': 'Molecular biology', 'level': 1, 'score': 0.43361792}, {'id': 'https://openalex.org/C27153228', 'wikidata': 'https://www.wikidata.org/wiki/Q3787274', 'display_name': 'Transcriptional regulation', 'level': 4, 'score': 0.42212075}, {'id': 'https://openalex.org/C95444343', 'wikidata': 'https://www.wikidata.org/wiki/Q7141', 'display_name': 'Cell biology', 'level': 1, 'score': 0.4195885}, {'id': 'https://openalex.org/C101762097', 'wikidata': 'https://www.wikidata.org/wiki/Q224093', 'display_name': 'Promoter', 'level': 4, 'score': 0.3359629}, {'id': 'https://openalex.org/C54355233', 'wikidata': 'https://www.wikidata.org/wiki/Q7162', 'display_name': 'Genetics', 'level': 1, 'score': 0.31961292}, {'id': 'https://openalex.org/C150194340', 'wikidata': 'https://www.wikidata.org/wiki/Q26972', 'display_name': 'Gene expression', 'level': 3, 'score': 0.31750625}, {'id': 'https://openalex.org/C63932345', 'wikidata': 'https://www.wikidata.org/wiki/Q422500', 'display_name': 'Nuclear receptor', 'level': 4, 'score': 0.1175549}], 'mesh': [{'descriptor_ui': 'D004268', 'descriptor_name': 'DNA-Binding Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': True}, {'descriptor_ui': 'D005786', 'descriptor_name': 'Gene Expression Regulation', 'qualifier_ui': 'Q000502', 'qualifier_name': 'physiology', 'is_major_topic': True}, {'descriptor_ui': 'D018398', 'descriptor_name': 'Homeodomain Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': True}, {'descriptor_ui': 'D009687', 'descriptor_name': 'Nuclear Proteins', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': True}, {'descriptor_ui': 'D015534', 'descriptor_name': 'Trans-Activators', 'qualifier_ui': 'Q000502', 'qualifier_name': 'physiology', 'is_major_topic': True}, {'descriptor_ui': 'D014157', 'descriptor_name': 'Transcription Factors', 'qualifier_ui': 'Q000502', 'qualifier_name': 'physiology', 'is_major_topic': True}, {'descriptor_ui': 'D014158', 'descriptor_name': 'Transcription, Genetic', 'qualifier_ui': 'Q000502', 'qualifier_name': 'physiology', 'is_major_topic': True}, {'descriptor_ui': 'D000818', 'descriptor_name': 'Animals', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D001483', 'descriptor_name': 'Base Sequence', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D017124', 'descriptor_name': 'Conserved Sequence', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D004247', 'descriptor_name': 'DNA', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D005786', 'descriptor_name': 'Gene Expression Regulation', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D051537', 'descriptor_name': 'Hepatocyte Nuclear Factor 1', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D051538', 'descriptor_name': 'Hepatocyte Nuclear Factor 1-alpha', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D051539', 'descriptor_name': 'Hepatocyte Nuclear Factor 1-beta', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D006801', 'descriptor_name': 'Humans', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D007515', 'descriptor_name': 'Islets of Langerhans', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D007515', 'descriptor_name': 'Islets of Langerhans', 'qualifier_ui': 'Q000503', 'qualifier_name': 'physiopathology', 'is_major_topic': False}, {'descriptor_ui': 'D007515', 'descriptor_name': 'Islets of Langerhans', 'qualifier_ui': 'Q000502', 'qualifier_name': 'physiology', 'is_major_topic': False}, {'descriptor_ui': 'D011485', 'descriptor_name': 'Protein Binding', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D012689', 'descriptor_name': 'Sequence Homology, Nucleic Acid', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D015534', 'descriptor_name': 'Trans-Activators', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D015534', 'descriptor_name': 'Trans-Activators', 'qualifier_ui': 'Q000235', 'qualifier_name': 'genetics', 'is_major_topic': False}, {'descriptor_ui': 'D014157', 'descriptor_name': 'Transcription Factors', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}, {'descriptor_ui': 'D014157', 'descriptor_name': 'Transcription Factors', 'qualifier_ui': 'Q000378', 'qualifier_name': 'metabolism', 'is_major_topic': False}, {'descriptor_ui': 'D014158', 'descriptor_name': 'Transcription, Genetic', 'qualifier_ui': '', 'qualifier_name': None, 'is_major_topic': False}], 'locations_count': 2, 'locations': [{'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m109244200', 'pdf_url': 'http://www.jbc.org/article/S0021925819402810/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, {'is_oa': False, 'landing_page_url': 'https://pubmed.ncbi.nlm.nih.gov/11590182', 'pdf_url': None, 'source': {'id': 'https://openalex.org/S4306525036', 'display_name': 'PubMed', 'issn_l': None, 'issn': None, 'is_oa': False, 'is_in_doaj': False, 'is_core': False, 'host_organization': 'https://openalex.org/I1299303238', 'host_organization_name': 'National Institutes of Health', 'host_organization_lineage': ['https://openalex.org/I1299303238'], 'host_organization_lineage_names': ['National Institutes of Health'], 'type': 'repository'}, 'license': None, 'license_id': None, 'version': None, 'is_accepted': False, 'is_published': False}], 'best_oa_location': {'is_oa': True, 'landing_page_url': 'https://doi.org/10.1074/jbc.m109244200', 'pdf_url': 'http://www.jbc.org/article/S0021925819402810/pdf', 'source': {'id': 'https://openalex.org/S140251998', 'display_name': 'Journal of Biological Chemistry', 'issn_l': '0021-9258', 'issn': ['0021-9258', '1067-8816', '1083-351X'], 'is_oa': True, 'is_in_doaj': True, 'is_core': True, 'host_organization': 'https://openalex.org/P4310320990', 'host_organization_name': 'Elsevier BV', 'host_organization_lineage': ['https://openalex.org/P4310320990'], 'host_organization_lineage_names': ['Elsevier BV'], 'type': 'journal'}, 'license': 'cc-by', 'license_id': 'https://openalex.org/licenses/cc-by', 'version': 'publishedVersion', 'is_accepted': True, 'is_published': True}, 'sustainable_development_goals': [], 'grants': [], 'datasets': [], 'versions': [], 'referenced_works_count': 77, 'referenced_works': ['https://openalex.org/W1506002717', 'https://openalex.org/W1536708473', 'https://openalex.org/W1572616623', 'https://openalex.org/W1573536022', 'https://openalex.org/W1627567497', 'https://openalex.org/W1830287761', 'https://openalex.org/W1918701699', 'https://openalex.org/W1924905604', 'https://openalex.org/W1963537017', 'https://openalex.org/W1963917064', 'https://openalex.org/W1964526847', 'https://openalex.org/W1966544076', 'https://openalex.org/W1968995536', 'https://openalex.org/W1976150837', 'https://openalex.org/W1978595730', 'https://openalex.org/W1981286265', 'https://openalex.org/W1987690732', 'https://openalex.org/W1992517228', 'https://openalex.org/W1995269929', 'https://openalex.org/W2005688198', 'https://openalex.org/W2014297339', 'https://openalex.org/W2016730049', 'https://openalex.org/W2017911450', 'https://openalex.org/W2023590823', 'https://openalex.org/W2023640290', 'https://openalex.org/W2037439300', 'https://openalex.org/W2038070725', 'https://openalex.org/W2039307052', 'https://openalex.org/W2042126195', 'https://openalex.org/W2045042588', 'https://openalex.org/W2045956369', 'https://openalex.org/W2046889691', 'https://openalex.org/W2048056915', 'https://openalex.org/W2048523814', 'https://openalex.org/W2049672602', 'https://openalex.org/W2050395079', 'https://openalex.org/W2052589912', 'https://openalex.org/W2056626308', 'https://openalex.org/W2063909610', 'https://openalex.org/W2064546248', 'https://openalex.org/W2066275743', 'https://openalex.org/W2073668865', 'https://openalex.org/W2075221196', 'https://openalex.org/W2075829878', 'https://openalex.org/W2080132636', 'https://openalex.org/W2082255237', 'https://openalex.org/W2083556306', 'https://openalex.org/W2089328941', 'https://openalex.org/W2091664490', 'https://openalex.org/W2091965516', 'https://openalex.org/W2095311108', 'https://openalex.org/W2096570297', 'https://openalex.org/W2097794242', 'https://openalex.org/W2099057503', 'https://openalex.org/W2099605574', 'https://openalex.org/W2101172511', 'https://openalex.org/W2102612565', 'https://openalex.org/W2104458426', 'https://openalex.org/W2107601240', 'https://openalex.org/W2115140616', 'https://openalex.org/W2116979396', 'https://openalex.org/W2120965964', 'https://openalex.org/W2125182057', 'https://openalex.org/W2126705032', 'https://openalex.org/W2137987484', 'https://openalex.org/W2138701894', 'https://openalex.org/W2139168410', 'https://openalex.org/W2140331829', 'https://openalex.org/W2146127531', 'https://openalex.org/W2147788578', 'https://openalex.org/W2159128174', 'https://openalex.org/W2160544122', 'https://openalex.org/W2166421062', 'https://openalex.org/W2182155699', 'https://openalex.org/W2345224450', 'https://openalex.org/W2914278830', 'https://openalex.org/W4301387263'], 'related_works': ['https://openalex.org/W4243852877', 'https://openalex.org/W4220655218', 'https://openalex.org/W2584288105', 'https://openalex.org/W2368942489', 'https://openalex.org/W2098016032', 'https://openalex.org/W2095475285', 'https://openalex.org/W2023693943', 'https://openalex.org/W1999358679', 'https://openalex.org/W1989791725', 'https://openalex.org/W1982846641'], 'abstract_inverted_index': {'The': [0, 219, 279, 498, 645, 730, 1884, 2379, 2861, 2869, 2923, 2950, 3046, 3285, 3555, 3573, 3587, 3636, 3869, 3913, 3995, 4228, 4279, 4293], 'PDX-1': [1, 210, 225, 280, 489, 504, 731, 834, 1138, 1201, 2549, 3355, 3549, 3781, 4145], 'homeodomain': [2, 281], 'transcription': [3, 34, 140, 150, 204, 260, 282, 313, 419, 429, 483, 539, 576, 743, 866, 1754, 2142, 2298, 2385, 2459, 2480, 2567], 'factor': [4, 98, 141, 231, 283, 377, 420, 510, 560, 744, 1755, 2299, 2481], 'regulates': [5, 284, 865], 'pancreatic': [6, 285, 582, 750, 2076, 3000], 'development': [7, 286, 751, 1156, 1359, 2461], 'and': [8, 56, 73, 125, 173, 185, 266, 277, 287, 335, 352, 404, 452, 464, 545, 556, 589, 741, 752, 864, 1112, 1152, 1170, 1214, 1360, 1540, 1597, 1707, 1764, 1770, 1890, 1972, 2035, 2082, 2120, 2177, 2200, 2240, 2317, 2442, 2462, 2477, 2548, 2578, 2585, 2599, 2605, 2611, 2632, 2718, 2735, 2850, 2852, 2914, 2943, 3007, 3061, 3107, 3118, 3141, 3235, 3297, 3450, 3522, 3566, 3585, 3634, 3638, 3841, 3905, 3924, 3971, 4008, 4051, 4099, 4118, 4175, 4191, 4208, 4222, 4240, 4259, 4273, 4290, 4313, 4373, 4388, 4401, 4428, 4438], 'adult': [9, 28, 288, 307, 598, 753, 1891], 'islet': [10, 105, 289, 384, 583, 754, 840, 1015, 1140, 1361, 3001], 'β': [11, 24, 32, 80, 106, 242, 290, 303, 311, 359, 385, 521, 675, 755, 841, 872, 1141, 1165, 1215, 1362, 1644, 2077, 2251, 2560, 2583, 2608, 3002, 4332, 4403, 4416], 'cell': [12, 107, 291, 386, 756, 873, 1166, 1216, 1363, 1645, 2584, 2609, 4404, 4417], 'function.': [13, 108, 292, 387], 'Expression': [14, 293], 'of': [15, 67, 78, 95, 104, 113, 133, 262, 294, 346, 357, 374, 383, 392, 412, 541, 592, 641, 656, 674, 685, 749, 867, 1157, 1163, 1168, 1200, 1204, 1264, 1271, 1748, 1894, 1910, 2027, 2074, 2116, 2134, 2140, 2248, 2313, 2381, 2440, 2471, 2527, 2534, 2555, 2581, 2592, 2636, 2731, 2874, 2937, 2999, 3104, 3169, 3478, 3876, 3934, 3963, 4021, 4056, 4070, 4078, 4083, 4144, 4157, 4188, 4194, 4202, 4211, 4233, 4247, 4253, 4262, 4284, 4383], 'the': [16, 27, 64, 68, 134, 237, 258, 263, 295, 306, 343, 347, 413, 516, 537, 542, 590, 597, 672, 683, 686, 832, 868, 1155, 1272, 1749, 1768, 1895, 1907, 1911, 2028, 2117, 2126, 2131, 2141, 2180, 2187, 2311, 2435, 2450, 2464, 2491, 2531, 2576, 2582, 2637, 2647, 2728, 2740, 2746, 2866, 2926, 2932, 2938, 2982, 3062, 3511, 3709, 3739, 3786, 3814, 3842, 3846, 3906, 3972, 4071, 4097, 4100, 4113, 4368, 4389, 4445], 'pdx-1': [17, 69, 239, 264, 296, 348, 518, 543, 1896, 2122, 2384, 2393, 2566, 2616, 2675, 2934, 3162, 4320], 'gene': [18, 83, 240, 265, 297, 362, 519, 544, 1209, 1897, 2031, 2254, 3712, 3742, 3790, 3817, 3849], 'is': [19, 35, 269, 298, 314, 548, 745, 835, 1641, 2300, 2568, 2863, 2929], 'almost': [20, 299, 837], 'exclusively': [21, 300, 838], 'localized': [22, 301], 'to': [23, 46, 53, 59, 145, 155, 162, 168, 176, 189, 199, 214, 233, 251, 257, 302, 325, 332, 338, 424, 434, 441, 447, 455, 468, 478, 493, 512, 530, 536, 677, 681, 1148, 1261, 1757, 1903, 2009, 2014, 2019, 2183, 2191, 2197, 2204, 2539, 2607, 2622, 2681, 2722, 2725, 2757, 2763, 2769, 2775, 2781, 2787, 2793, 2799, 2805, 2815, 2818, 2821, 2825, 2828, 2832, 2836, 2843, 2846, 2854, 2859, 2865, 2882, 2885, 2889, 2892, 2897, 2905, 2908, 2912, 2916, 2921, 2931, 3054, 3167, 3184, 3293, 3509, 3548, 3577, 3646, 3654, 3662, 3666, 3670, 3676, 3682, 3690, 3698, 3704, 3734, 3779, 3809, 3839, 3867, 3885, 3902, 3956, 4005, 4096, 4112, 4328], 'cells': [25, 304, 584, 676, 842, 1142, 3010, 3096, 3879, 3914, 4049], 'within': [26, 63, 120, 236, 305, 342, 399, 515, 581, 2024, 2137, 2530, 2727], 'endocrine': [29, 308], 'pancreas.': [30, 309], 'Islet': [31, 310], 'cell-selective': [33, 81, 312, 360, 2078, 2252], 'controlled': [36, 315], 'by': [37, 139, 271, 316, 418, 550, 671, 1368, 2032, 2264, 2305, 2389, 2570, 2627, 2948, 2988, 3922, 4074, 4152, 4177, 4298, 4315], 'evolutionarily': [38, 317], 'conserved': [39, 117, 254, 318, 396, 533, 2469, 2532, 2729, 4369], 'subdomain': [40, 122, 319, 401], 'sequences': [41, 192, 255, 320, 471, 534, 1885, 2071, 2319, 2533, 2617, 2676, 2730, 2940, 3640, 4370], '(termed': [42, 321, 3783], 'Areas': [43, 71, 322, 350, 2238, 2474], 'I': [44, 72, 191, 217, 235, 253, 323, 351, 470, 496, 514, 532, 2034, 2189, 2239, 2261, 2316, 2536, 2557, 2620, 2749, 4236, 4326, 4393], '(−2839': [45, 324, 2190, 2621, 4327], '−2520': [47, 326, 2192, 2623, 4329], 'base': [48, 143, 327, 422, 561], 'pairs': [49, 328], '(bp)),': [50, 329], 'II': [51, 74, 330, 353, 2195, 2318, 3788], '(−2252': [52, 331, 2196], '−2023': [54, 333, 2198], 'bp),': [55, 334, 2011, 2016, 2021, 2193, 2199], 'III': [57, 336, 2202], '(−1939': [58, 337, 2203], '−1664': [60, 339, 2205], 'bp))': [61, 340], 'found': [62, 138, 213, 341, 417, 492, 1740], '5′-flanking': [65, 344, 1908], 'region': [66, 345, 1909, 2026, 2128, 2182, 2452, 2645], 'gene.': [70, 349, 2868, 2935], 'are': [75, 354, 579, 659, 1196, 1259, 1366, 1738, 2551, 2941, 3872, 4376], 'independently': [76, 355, 2249, 4386], 'capable': [77, 356, 2073, 2247], 'directing': [79, 358, 2075, 2250, 2458], 'reporter': [82, 361, 2253, 2445, 4322], 'activity': [84, 363, 2255, 3164, 4434], 'in': [85, 193, 241, 364, 472, 520, 596, 662, 669, 839, 1143, 1154, 1650, 1741, 1767, 1900, 1906, 2080, 2256, 2310, 2383, 2398, 2457, 2463, 2487, 2559, 2590, 2613, 2646, 2981, 3094, 3294, 3552, 3708, 3738, 3785, 3813, 3845, 3888, 3917, 3931, 4309, 4378, 4397, 4423], 'transfection': [86, 365, 2083, 2257, 2983, 3117], 'assays,': [87, 366, 2258], 'with': [88, 224, 367, 503, 664, 871, 1256, 1643, 1743, 2259, 2573, 3100, 3499, 3560, 3582, 3980, 4018, 4053, 4154, 4443], 'Area': [89, 114, 190, 202, 216, 234, 252, 368, 393, 469, 481, 495, 513, 531, 2188, 2194, 2201, 2244, 2260, 2306, 2315, 2535, 2556, 2619, 2733, 2748, 4235, 4325, 4392, 4432], 'I-mediated': [90, 369], 'stimulation': [91, 370, 2304], 'dependent': [92, 371], 'upon': [93, 372], 'binding': [94, 250, 373, 529, 2482, 3252, 3579], 'hepatic': [96, 375, 558, 1369], 'nuclear': [97, 376, 559, 1370], '3β': [99, 378], '(HNF3β),': [100, 379], 'a': [101, 380, 666, 1636, 3981, 4305], 'key': [102, 381, 1762, 2552], 'regulator': [103, 382, 748], 'To': [109, 388, 4365], 'identify': [110, 389], 'other': [111, 390], 'transactivators': [112, 391], 'I,': [115, 394, 2475], 'highly': [116, 395], 'sequence': [118, 397], 'segments': [119, 398], 'this': [121, 230, 400, 509, 1257, 2025, 2488, 2541], 'were': [123, 137, 402, 416, 1898, 2022, 2072, 2246, 2396, 2485, 2537, 2625, 2737, 3011, 3097, 3112, 3253, 3260, 3558, 3580, 3589, 3883, 3908, 3915, 3954, 3997, 4146, 4150, 4173, 4237, 4296, 4302, 4412], 'mutagenized,': [124, 403], 'their': [126, 405, 1146, 4439], 'effect': [127, 406, 4390, 4440], 'on': [128, 407, 3591, 3929, 4391], 'activation': [129, 408, 2262, 2558, 4334, 4394], 'was': [130, 196, 212, 409, 475, 491, 2386, 2946, 2985, 3052, 3165, 3173, 3291, 3488, 3497, 3550, 3900, 3974, 4016, 4094, 4102, 4385, 4395, 4441], 'determined.': [131, 410], 'Several': [132, 411, 575], 'sensitive': [135, 414], 'sites': [136, 415, 2483], 'data': [142, 421, 2436], 'analysis': [144, 423, 2038, 2115, 2439], 'potentially': [146, 425], 'bind': [147, 426], 'endodermally': [148, 427], 'expressed': [149, 428, 836], 'factors,': [151, 430], 'including': [152, 431, 875, 1267], 'HNF1α': [153, 195, 432, 474, 1651, 2547, 2951, 3186, 3299, 3562], '(−2758': [154, 433], '−2746': [156, 435], 'bp,': [157, 164, 170, 178, 436, 443, 449, 457], 'Segment': [158, 165, 171, 179, 206, 437, 444, 450, 458, 485], '2),': [159, 438], 'HNF4': [160, 184, 439, 463, 3811], '(−2742': [161, 440, 2849], '−2730': [163, 442], '4;': [166, 445], '−2683': [167, 446], '−2671': [169, 448], '7–8),': [172, 451], 'HNF6': [174, 453, 3236, 3327, 3843], '(−2727': [175, 454], '−2715': [177, 456], '5).': [180, 459], 'HNF1α,': [181, 275, 460, 554, 2598], 'but': [182, 461, 2242], 'not': [183, 462, 2243], 'HNF6,': [186, 465, 2847, 2909], 'binds': [187, 466], 'specifically': [188, 200, 467, 479], 'vitro.': [194, 473], 'also': [197, 227, 476, 506, 660, 735, 1365, 1739, 2129, 2301, 2387], 'shown': [198, 477], 'activate': [201, 480], 'I-driven': [203, 482, 4433], 'through': [205, 484, 4304], '2.': [207, 486, 648], 'In': [208, 487, 831, 1192], 'addition,': [209, 488, 1193], 'itself': [211, 490, 2550], 'stimulate': [215, 494], 'activation.': [218, 497], 'chromatin': [220, 499, 570, 3973], 'immunoprecipitation': [221, 500, 571], 'assay': [222, 501], 'performed': [223, 502, 3098], 'antisera': [226, 505, 3496, 3547], 'demonstrated': [228, 507, 1899], 'that': [229, 247, 267, 508, 526, 546, 578, 1195, 1640, 1886, 2125, 2392, 2449, 2468, 2484, 2546, 2565, 2586, 3168], 'bound': [232, 511, 4170], 'endogenous': [238, 517, 2029], 'cells.': [243, 522, 2561], 'Our': [244, 523, 2543], 'results': [245, 524, 2390, 2544, 4411], 'indicate': [246, 525, 2545], 'regulatory': [248, 527], 'factors': [249, 528, 577, 1371, 2571], 'contribute': [256, 535, 2606], 'selective': [259, 538], 'pattern': [261, 540], 'control': [268, 547, 1887], 'mediated': [270, 549, 2263], 'endodermal': [272, 551], 'regulators': [273, 552, 2554, 2595], 'like': [274, 553, 2490], 'HNF3β,': [276, 555], 'PDX-1.': [278, 557], 'pair(s)': [562], 'polymerase': [563, 2628], 'chain': [564, 2629], 'reaction': [565, 2630, 4101], 'thymidine': [566, 2641], 'kinase': [567, 2642, 3584], 'chloramphenicol': [568, 2648], 'acetyltransferase': [569, 2649], 'β-fibrinogen': [572], 'phosphoenolpyruvate': [573], 'carboxykinase': [574], 'enriched': [580], 'mediate': [585], 'differentiation': [586, 1763], 'during': [587, 2460], 'embryogenesis': [588], 'maintenance': [591], 'specialized': [593], 'cellular': [594], 'functions': [595], '(1Sander': [599], 'M.': [600, 795, 898, 939, 1039, 1243, 1316, 1434, 1446, 1476, 1478, 1528, 1559, 1616, 1674, 1686, 1726, 1806, 1833, 1866, 1916, 1918, 1924, 1945, 1951, 1983, 2042, 2044, 2050, 2088, 2090, 2096, 2148, 2154, 2211, 2217, 2269, 2275, 2323, 2325, 2331, 2352, 2358, 2407, 2413, 2497, 2503, 2689, 2691, 2697, 3019, 3025, 3076, 3125, 3368, 3380, 3611, 3758, 4338, 4344, 4451, 4457], 'German': [601, 3389], 'M.S.': [602, 3390], 'J.': [603, 720, 759, 778, 850, 884, 925, 965, 991, 1025, 1044, 1069, 1077, 1097, 1175, 1221, 1290, 1329, 1343, 1481, 1547, 1604, 1794, 1831, 1956, 1977, 1984, 2159, 2222, 2280, 2363, 2418, 2508, 2660, 3030, 3311, 3358, 3384, 3424, 3463, 3752, 3798, 4349], 'Mol.': [604, 932, 950, 1126, 1417, 1566, 1586, 1623, 1778, 1813, 1933, 2059, 2105, 2340, 2706, 3081, 3130, 3245, 3369, 3622, 3854], 'Med.': [605, 694, 706], '1997;': [606, 823, 1047, 1350, 1459, 1699, 1876, 1936, 2062, 2108, 2343, 2709, 3314, 3347, 3393, 3539, 4135], '75:': [607], '327-340Crossref': [608], 'PubMed': [609, 627, 698, 710, 725, 770, 785, 808, 826, 861, 888, 917, 955, 980, 1010, 1029, 1055, 1081, 1107, 1131, 1187, 1233, 1250, 1296, 1335, 1353, 1390, 1406, 1423, 1462, 1490, 1506, 1535, 1572, 1592, 1629, 1663, 1702, 1733, 1784, 1819, 1838, 1860, 1879, 1939, 1967, 1995, 2065, 2111, 2170, 2233, 2291, 2346, 2374, 2429, 2519, 2669, 2712, 2975, 3041, 3087, 3136, 3154, 3210, 3230, 3280, 3322, 3350, 3374, 3396, 3434, 3472, 3542, 3627, 3727, 3772, 3802, 3832, 3860, 4138, 4360], 'Scopus': [610, 628, 699, 711, 726, 771, 827, 889, 918, 956, 981, 1011, 1030, 1056, 1082, 1108, 1132, 1188, 1234, 1251, 1297, 1336, 1354, 1391, 1407, 1424, 1463, 1507, 1536, 1573, 1593, 1630, 1664, 1703, 1734, 1785, 1820, 1839, 1861, 1880, 1968, 1996, 2171, 2234, 2292, 2375, 2430, 2520, 2976, 3042, 3088, 3137, 3155, 3211, 3231, 3281, 3323, 3351, 3397, 3435, 3543, 3628, 3728, 3773, 3803, 3833, 3861, 4139, 4361], '(284)': [611], 'Google': [612, 630, 701, 713, 728, 773, 786, 809, 829, 862, 891, 920, 958, 983, 1013, 1032, 1058, 1084, 1110, 1134, 1190, 1236, 1253, 1299, 1338, 1356, 1393, 1409, 1426, 1465, 1491, 1509, 1538, 1575, 1595, 1632, 1666, 1705, 1736, 1787, 1822, 1841, 1863, 1882, 1940, 1970, 1998, 2066, 2112, 2173, 2236, 2294, 2347, 2377, 2432, 2522, 2670, 2713, 2978, 3044, 3090, 3139, 3157, 3213, 3233, 3250, 3283, 3325, 3353, 3375, 3399, 3437, 3473, 3545, 3630, 3730, 3775, 3805, 3835, 3863, 4141, 4363], 'Scholar,': [613, 631, 702, 714, 774, 787, 810, 892, 921, 937, 959, 1033, 1059, 1085, 1237, 1300, 1339, 1394, 1410, 1492, 1510, 1788, 1823, 1842, 1864, 1941, 2348], '2St-Onge': [614], 'L.': [615, 761, 941, 1177, 1223, 1470, 1848, 3336, 3613], 'Wehr': [616], 'R.': [617, 633, 848, 906, 949, 1003, 1041, 1932, 1955, 2058, 2104, 2158, 2221, 2279, 2339, 2362, 2417, 2507, 2705, 3029, 3621, 4348], 'Gruss': [618], 'P.': [619, 718, 963, 1123, 1289, 1318, 1518, 1543, 1557, 1600, 1614, 1716, 1790, 1804, 3269, 3428], 'Curr.': [620], 'Opin.': [621], 'Genet.': [622, 822, 1349, 1458, 1698, 3538, 4134], 'Dev.': [623, 1183, 1229, 1502, 3206, 3226, 3345, 3392, 3828], '1999;': [624, 1293, 1332, 3431, 3769], '9:': [625], '295-300Crossref': [626], '(79)': [629], '3Stein': [632], 'Jefferson': [634], 'L.S.': [635], 'Cherrington': [636], 'A.D.': [637], 'Goodman': [638], 'H.M.': [639], 'Handbook': [640], 'Physiology': [642], 'Section': [643], '7:': [644, 3085, 3134, 3372], 'Endocrine': [646], 'System.': [647], 'Oxford': [649], 'University': [650], 'Press,': [651], '2001:': [652], '25-47Google': [653], 'Scholar).': [654, 729, 830, 1135, 1191, 1254, 1357, 1576, 1883, 2067, 2113, 2174, 2237, 2295, 2378, 2433, 2523, 2671, 2714, 3045, 3091, 3284, 4364], 'Some': [655], 'these': [657, 3553, 4415], 'proteins': [658], 'dysfunctional': [661], 'patients': [663, 1742], 'diabetes,': [665, 1158, 1266], 'disease': [667, 2612], 'caused': [668], 'part': [670], 'failure': [673], 'produce': [678], 'sufficient': [679], 'insulin': [680, 876, 1169, 1212, 2829, 2855, 2893, 2917, 3741, 3789], 'meet': [682], 'needs': [684], 'body': [687], '(4Poitout': [688], 'V.': [689, 816, 1283, 3532, 4128], 'Robertson': [690, 903], 'R.P.': [691, 904], 'Annu.': [692], 'Rev.': [693], '1996;': [695, 782, 805, 1007, 1026, 1104, 1128, 1403, 1532, 1660, 1730, 1987, 3247, 3857], '47:': [696], '69-83Crossref': [697], '(64)': [700], '5Hattersley': [703], 'A.T.': [704, 1328], 'Diabetes': [705], '1998;': [707, 722, 1184, 1230, 1247, 1420, 1589, 1781, 1835], '15:': [708, 824, 3540, 4136], '15-24Crossref': [709], '(264)': [712], '6Velho': [715], 'G.': [716, 856, 929, 945, 1119, 1498, 1500, 1551, 1608, 1798, 3202, 3308, 3617, 3714, 3720], 'Froguel': [717, 1288], 'Eur.': [719], 'Endocrinol.': [721, 933, 951, 1127, 3246, 3370, 3623], '138:': [723], '233-239Crossref': [724], '(118)': [727], '(pancreas': [732], 'duodenum': [733], 'homeobox-1;': [734], 'known': [736], 'as': [737, 3013, 3256], 'STF-1,': [738], 'IDX-1,': [739], 'IPF-1,': [740], 'IUF-1)': [742], 'an': [746, 2454, 2587], 'essential': [747, 2455], 'function': [757, 1217, 1364, 2178], '(7Jonsson': [758], 'Carlson': [760], 'Edlund': [762, 764, 779, 881, 1066, 1180, 1226, 3795], 'T.': [763, 882, 993, 997, 1093, 1324, 1442, 1452, 1682, 1692, 3362, 3762, 3796], 'H.': [765, 780, 878, 987, 1067, 1087, 1091, 1181, 1227, 1436, 1450, 1514, 1676, 1690, 1712, 1979, 3334, 3422, 3756, 3792], 'Nature.': [766, 1246, 1531, 1729, 1856], '1994;': [767, 952, 977, 1484, 1503, 3466, 3624], '371:': [768], '606-609Crossref': [769], '(1558)': [772], '8Ahlgren': [775], 'U.': [776, 911, 974, 1173, 1219, 1384, 1873, 2962, 2969, 3332, 3851], 'Jonsson': [777, 1174, 1176, 1220, 1222], 'Development.': [781, 804, 857], '122:': [783, 806], '1409-1416Crossref': [784], '9Offield': [788], 'M.F.': [789, 1920, 2046, 2092, 2327, 2693], 'Jetton': [790], 'T.L.': [791], 'Labosky': [792], 'P.A.': [793], 'Ray': [794, 1923, 2049, 2095, 2330, 2696], 'Stein': [796, 847, 905, 948, 1040, 1931, 1954, 2057, 2103, 2157, 2220, 2278, 2338, 2361, 2416, 2506, 2704, 3028, 3620, 4347, 4460], 'R.W.': [797], 'Magnuson': [798], 'M.A.': [799, 1827], 'Hogan': [800], 'B.L.': [801], 'Wright': [802, 853, 899, 946, 1244, 1929, 1952, 2055, 2101, 2155, 2218, 2276, 2336, 2359, 2414, 2504, 2702, 3026, 3618, 4345, 4458], 'C.V.': [803, 1930, 1953, 2056, 2102, 2156, 2219, 2277, 2337, 2360, 2415, 2505, 2703, 3027, 4346, 4459], '983-995Crossref': [807], '10Stoffers': [811], 'D.A.': [812, 1277, 1341, 3528, 4124], 'Zinkin': [813, 3529, 4125], 'N.T.': [814, 3530, 4126], 'Stanojevic': [815, 1282, 3531, 4127], 'Clarke': [817, 1344, 3533, 4129], 'W.L.': [818, 1345, 3534, 4130], 'Habener': [819, 1286, 1346, 3535, 4131], 'J.F.': [820, 1287, 1347, 3536, 4132], 'Nat.': [821, 1348, 1457, 1697, 3537, 4133], '106-110Crossref': [825, 3541, 4137], '(917)': [828, 3544, 4140], 'pancreas,': [833], '(11Guz': [843], 'Y.': [844, 989, 1001, 1005, 1089, 1095, 1099, 1430, 1438, 1454, 1670, 1678, 1694, 3458, 3754, 3764], 'Montminy': [845, 930, 1242, 1982, 3367], 'M.R.': [846, 931], 'Leonard': [849, 924, 964, 1068, 1976], 'Gamer': [851, 940, 1927, 2053, 2099, 2334, 2700, 3612], 'L.W.': [852, 1928, 2054, 2100, 2335, 2701], 'C.V.E.': [854, 900, 947, 1245, 3619], 'Teitelman': [855, 928, 944, 3616], '1995;': [858, 914, 934, 1078], '121:': [859], '11-18Crossref': [860], 'Scholar)': [863, 1596, 1633, 1737, 1971, 1999, 3140, 3158, 3251, 3631], 'genes': [869, 2123], 'associated': [870, 1642, 2572], 'identity,': [874], '(12Ohlsson': [877, 3791], 'Karlson': [879, 3793], 'K.': [880, 995, 999, 1179, 1225, 1326, 1396, 1444, 1512, 1653, 1684, 1710, 1943, 2146, 2209, 2267, 2350, 2405, 2495, 3017, 3364, 3744, 3748, 3794, 4336, 4449], 'EMBO': [883, 3797], '1993;': [885, 3371, 3799], '12:': [886, 1185, 1231, 3800], '4251-4259Crossref': [887, 3801], '(767)': [890, 3804], '13Olson': [893], 'L.K.': [894], 'Sharma': [895, 926], 'A.': [896, 913, 976, 1320, 1322, 1386, 1480, 1875, 1926, 2052, 2098, 2333, 2699, 2971, 3382], 'Peshavaria': [897, 1038, 1917, 2043, 2089, 2324, 2690], 'Towle': [901, 2658], 'H.C.': [902, 2659, 3386], 'Proc.': [907, 970, 1380, 1869, 2965], 'Natl.': [908, 971, 1381, 1870, 2966], 'Acad.': [909, 972, 1382, 1871, 2967], 'Sci.': [910, 973, 1383, 1872, 2968], 'S.': [912, 927, 975, 1061, 1239, 1241, 1306, 1314, 1385, 1472, 1494, 1520, 1526, 1718, 1724, 1874, 1975, 2970, 3080, 3129, 3188, 3366], '92:': [915], '9127-9131Crossref': [916], '(130)': [919], '14Peers': [922], 'B.': [923, 3360], '8:': [935, 953, 3625], '1798-1806Google': [936], '15Peshavaria': [938], 'Henderson': [942, 1921, 1948, 2047, 2093, 2151, 2214, 2272, 2328, 2355, 2410, 2500, 2694, 3022, 3614, 4341, 4454], 'E.': [943, 1281, 1922, 1949, 1981, 2048, 2094, 2152, 2215, 2273, 2329, 2356, 2411, 2501, 2695, 3023, 3221, 3267, 3615, 3823, 4342, 4455], '806-816Crossref': [954, 3626], '(139)': [957, 3629], '16Petersen': [960], 'H.V.': [961, 1063], 'Serup': [962, 3427], 'Michelsen': [966], 'B.K.': [967], 'Madsen': [968, 1074, 1554, 1611, 1801, 3425], 'O.D.': [969, 1075, 1555, 1612, 1802, 3426], '91:': [978], '10465-10469Crossref': [979], '(189)': [982], 'Scholar),': [984, 1014, 1111, 1427, 1466, 1539, 1667, 1706, 3214, 3234, 3731, 3776, 3806, 3836, 3864], 'glucokinase': [985], '(17Watada': [986], 'Kajimoto': [988, 1088, 3753], 'Miyagawa': [990, 3751], 'Hanafusa': [992, 3761], 'Hamaguchi': [994], 'Matsuoka': [996, 1092], 'Yamamoto': [998], 'Matsuzawa': [1000, 3763], 'Kawamori': [1002], 'Yamasaki': [1004, 1098], 'Diabetes.': [1006], ':': [1008], '1826-1831Crossref': [1009], '(183)': [1012], 'amyloid': [1016], 'polypeptide': [1017], '(18Bretherton-Watt': [1018], 'D.': [1019, 1561, 1618, 1808, 1829, 1947, 2150, 2213, 2271, 2354, 2409, 2499, 3021, 4340, 4453], 'Gore': [1020], 'N.': [1021, 1121, 1398, 1432, 1474, 1516, 1655, 1672, 1714], 'Boam': [1022], 'D.S.W.': [1023], 'Biochem.': [1024, 1076, 1100, 3765], '313:': [1027], '495-502Crossref': [1028], '(47)': [1031], '19Carty': [1034], 'M.D.': [1035], 'Lilliquist': [1036], 'J.S.': [1037, 1071], 'Soeller': [1042], 'W.C.': [1043], 'Biol.': [1045, 1419, 1482, 1568, 1588, 1625, 1780, 1815, 1935, 1957, 1985, 2061, 2107, 2160, 2223, 2281, 2342, 2364, 2419, 2509, 2661, 2708, 3031, 3083, 3132, 3312, 3346, 3464, 3856, 4350], 'Chem.': [1046, 1483, 1958, 1986, 2161, 2224, 2282, 2365, 2420, 2510, 2662, 3032, 3313, 3465, 4351], '272:': [1048, 3315], '11986-11993Abstract': [1049], 'Full': [1050, 1052, 1487, 1962, 1964, 1990, 1992, 2165, 2167, 2228, 2230, 2286, 2288, 2369, 2371, 2424, 2426, 2514, 2516, 2666, 3036, 3038, 3317, 3319, 3469, 4355, 4357], 'Text': [1051, 1053, 1488, 1963, 1965, 1991, 1993, 2166, 2168, 2229, 2231, 2287, 2289, 2370, 2372, 2425, 2427, 2515, 2517, 2667, 3037, 3039, 3318, 3320, 3470, 4356, 4358], 'PDF': [1054, 1489, 1966, 1994, 2169, 2232, 2290, 2373, 2428, 2518, 2668, 3040, 3321, 3471, 4359], '(85)': [1057], '20Serup': [1060], 'Petersen': [1062, 1070, 3421], 'Pedersen': [1064], 'E.E.': [1065], 'Larsson': [1072], 'L.I.': [1073, 1310], '310:': [1079], '997-1003Crossref': [1080], '(82)': [1083], '21Watada': [1086], 'Kaneto': [1090], 'Fujitani': [1094], 'Miyazaki': [1096], 'Biophys.': [1101, 3766], 'Res.': [1102, 3276, 3767], 'Commun.': [1103, 3768], '229:': [1105], '746-751Crossref': [1106], '(84)': [1109], 'glucose': [1113, 1150, 1205], 'transporter': [1114], 'type': [1115], '2': [1116, 2012, 3600, 3911, 4206, 4257], '(GLUT2)': [1117], '(22Waeber': [1118], 'Thompson': [1120], 'Nicod': [1122], 'Bonny': [1124], 'C.': [1125, 1285, 1549, 1606, 1796, 2960, 3196], '10:': [1129, 3248], '1327-1334Crossref': [1130], '(324)': [1133], 'Selectively': [1136], 'removing': [1137], 'from': [1139, 2438, 2677], 'mice': [1144, 1194, 1634], 'compromised': [1145], 'ability': [1147], 'maintain': [1149], 'homeostasis': [1151], 'resulted': [1153], 'at': [1159, 3176, 3505, 3596, 3896, 3976, 3992, 4002, 4010, 4065, 4107, 4164], 'least': [1160, 3177], 'partially': [1161], 'because': [1162], 'reduced': [1164, 2397, 4431], 'expression': [1167, 1213, 1893, 2079, 2604, 2651, 2952, 3068], 'GLUT2': [1171], '(23Ahlgren': [1172, 1218], 'Simu': [1178, 1224], 'Genes': [1182, 1228, 3205, 3225, 3391, 3827], '1763-1768Crossref': [1186, 1232], '(775)': [1189, 1235], 'heterozygous': [1197], 'mutant': [1198, 2809], 'carriers': [1199], 'exhibit': [1202, 1635], 'signs': [1203], 'intolerance,': [1206], 'suggesting': [1207], 'thatpdx-1': [1208], 'dosage': [1210], 'affects': [1211], '24Dutta': [1238], 'Bonner-Weir': [1240], '392:': [1248], '560Crossref': [1249], '(117)': [1252], 'Humans': [1255], 'condition': [1258], 'susceptible': [1260], 'different': [1262], 'forms': [1263], 'non-insulin-dependent': [1265, 1637], 'mature': [1268, 1745], 'onset': [1269, 1746], 'diabetes': [1270, 1747], 'young': [1273], '(25Hani': [1274], 'E.H.': [1275], 'Stoffers': [1276], 'Chevre': [1278], 'J.C.': [1279, 1308], 'Durand': [1280], 'Dina': [1284], 'Clin.': [1291, 1330], 'Invest.': [1292, 1331], '104:': [1294, 1333], 'R41-R48Crossref': [1295], '(266)': [1298], '26Macfarlane': [1301], 'W.M.': [1302, 3219, 3821], 'Frayling': [1303], 'T.M.': [1304], 'Ellard': [1305], 'Evans': [1307], 'Allen': [1309], 'Bulman': [1311], 'M.P.': [1312], 'Ayres': [1313], 'Shepherd': [1315], 'Clark': [1317], 'Millward': [1319], 'Demaine': [1321], 'Wilkin': [1323], 'Docherty': [1325], 'Hattersley': [1327], 'R33-R39Crossref': [1334], '(219)': [1337], '27Stoffers': [1340], 'Ferrer': [1342], '17:': [1351, 1460, 1700, 1937, 2063, 2109, 2344, 2710, 3278], '138-139Crossref': [1352], '(8)': [1355], 'Pancreatic': [1358], 'influenced': [1367], '(HNFs)1': [1372], '1α': [1373], '(28Emens': [1374], 'L.A.': [1375, 3718], 'Landers': [1376], 'D.W.': [1377], 'Moss': [1378], 'L.G.': [1379], '1992;': [1387, 1857], '89:': [1388], '7300-7304Crossref': [1389], '(122)': [1392], '29Yamagata': [1395], 'Oda': [1397, 1515, 1654, 1713], 'Kaisaki': [1399, 1517, 1656, 1715], 'P.J.': [1400, 1657], 'et': [1401, 1658], 'al.Nature.': [1402, 1659], '384:': [1404, 1533, 1661, 1731], '455-458Crossref': [1405, 1662], '(1037)': [1408, 1665], '30Lee': [1411], 'H-L': [1412, 1581, 1773], 'Sauer': [1413, 1582, 1774], 'B': [1414, 1583, 1775], 'Gonzalez': [1415, 1584, 1776], 'F.J.': [1416, 1585, 1777], 'Cell.': [1418, 1567, 1587, 1624, 1779, 1814, 1934, 2060, 2106, 2341, 2707, 3082, 3131, 3855], '18:': [1421, 1590, 1782], '3059-3068Crossref': [1422, 1591, 1783], '(228)': [1425, 1594, 1786], '1β': [1428], '(31Horikawa': [1429, 1669], 'Iwasaki': [1431, 1671], 'Hara': [1433, 1673], 'Furuta': [1435, 1513, 1675, 1711], 'Hinokio': [1437, 1677], 'Cockburn': [1439, 1679], 'B.N.': [1440, 1680], 'Lindner': [1441, 1681], 'Yamagata': [1443, 1683, 3747], 'Ogata': [1445, 1685], 'Tomonaga': [1447, 1687], 'O.': [1448, 1688], 'Kuroki': [1449, 1689], 'Kasahara': [1451, 1691], 'Iwamoto': [1453, 1693], 'Bell': [1455, 1529, 1695, 1727], 'G.I.': [1456, 1530, 1696, 1728], '384-385Crossref': [1461, 1701], '(740)': [1464, 1704], '3β,': [1467], '4α': [1468], '(32Miquerol': [1469], 'Lopez': [1471], 'Cartier': [1473], 'Tulliez': [1475], 'Raymondjean': [1477], 'Kahn': [1479], '269:': [1485, 3467], '8944-8951Abstract': [1486], '33Taraviras': [1493], 'Monaghan': [1495], 'A.P.': [1496], 'Schutz': [1497], 'Kelsey': [1499], 'Mech.': [1501], '48:': [1504], '67-79Crossref': [1505], '(143)': [1508], '34Yamagata': [1511], 'Menzel': [1519, 1717], 'Cox': [1521, 1719], 'N.J.': [1522, 1720], 'Fajans': [1523, 1721], 'S.S.': [1524, 1722], 'Signorini': [1525, 1723], 'Stoffel': [1527, 1725, 1832, 1950, 2153, 2216, 2274, 2357, 2412, 2502, 3024, 4343, 4456], '458-460Crossref': [1534, 1732], '(1044)': [1537, 1735], '6': [1541], '(35Jacquemin': [1542, 1599], 'Durviaux': [1544, 1601, 1791], 'S.M.': [1545, 1602, 1792], 'Jensen': [1546, 1603, 1793], 'Godfraind': [1548, 1605, 1795], 'Gradwohl': [1550, 1607, 1797], 'Guillemot': [1552, 1609, 1799], 'F.': [1553, 1610, 1800, 3330], 'Carmeliet': [1556, 1613, 1803], 'Dewerchin': [1558, 1615, 1805], 'Collen': [1560, 1617, 1807], 'Rousseau': [1562, 1619, 1809], 'G.G.': [1563, 1620, 1810], 'Lemaigre': [1564, 1621, 1811], 'F.P.': [1565, 1622, 1812], '2000;': [1569, 1626, 1816, 1959, 2162, 2225, 2283, 2366, 2421, 2511, 3033, 4352], '20:': [1570, 1627, 1817], '4445-4454Crossref': [1571, 1628, 1818], '(277)': [1574, 1631, 1821], 'For': [1577], 'instance,': [1578], 'HNF1α−/−': [1579], '(30Lee': [1580, 1772], 'HNF6−/−': [1598], 'diabetic': [1638], 'phenotype': [1639], 'dysfunction.': [1646], 'Heterogeneous': [1647], 'nonfunctional': [1648], 'mutations': [1649, 2720], '(29Yamagata': [1652], 'HNF1β': [1668, 3568], 'HNF4α': [1708, 3215, 3305], '(34Yamagata': [1709], 'human': [1744, 2121, 2732, 2747, 3642, 3648, 3656, 3664, 3672, 3678, 3684, 3692, 3700, 3740, 3815, 3847], 'young.': [1750], 'Each': [1751, 3171], 'distinct': [1752], 'HNF': [1753], 'appears': [1756], 'be': [1758, 1904, 2184], 'required': [1759], 'for': [1760, 2303, 2872, 2925, 3502, 3599, 3893, 3910, 3926, 3988, 3999, 4047, 4062, 4104, 4161, 4205, 4214, 4219, 4225, 4231, 4245, 4256, 4265, 4270, 4276, 4282], 'controlling': [1761, 2574], 'metabolic': [1765, 2579], 'programs': [1766], 'pancreas': [1769], 'liver': [1771], '35Jacquemin': [1789], '36Duncan': [1824], 'S.A.': [1825, 1868], 'Navas': [1826], 'Dufort': [1828], 'Rossant': [1830], 'Science.': [1834, 3723], '281:': [1836], '692-695Crossref': [1837], '(293)': [1840], '37Kuo': [1843], 'C.J.': [1844, 2956, 3194], 'Conley': [1845, 2957, 3191], 'P.B.': [1846, 2958, 3192], 'Chen': [1847], 'Sladek': [1849, 3309], 'F.M.': [1850, 3217, 3310, 3819], 'Darnell': [1851, 3222, 3824], 'Jr.,': [1852, 3223, 3825], 'J.E.': [1853, 3224, 3826], 'Crabtree': [1854, 2963, 2991, 3203, 3721], 'G.R.': [1855, 2964, 3204, 3388, 3722], '355:': [1858], '457-461Crossref': [1859], '(369)': [1862], '38Stoffel': [1865], 'Duncan': [1867], '94:': [1877], '13209-13214Crossref': [1878], '(335)': [1881], 'appropriate': [1888], 'developmental': [1889, 2577], 'specific': [1892], 'transgenic': [1901, 2081, 2441], 'studies': [1902, 2084, 2563, 2984, 3093], 'located': [1905], 'mouse': [1912, 2030, 2674, 2933, 3710, 3877, 4234, 4248, 4285], '(39Wu': [1913, 2039, 2085, 2320, 2686], 'K.L.': [1914, 2040, 2086, 2321, 2687], 'Gannon': [1915, 1944, 2041, 2087, 2147, 2210, 2268, 2322, 2351, 2406, 2496, 2688, 3018, 4337, 4450], 'Offield': [1919, 2045, 2091, 2326, 2692], 'Marks': [1925, 2051, 2097, 2332, 2698], '6002-6013Crossref': [1938, 2064, 2110, 2345, 2711], '41Gerrish': [1942, 2349], 'Shih': [1946, 2149, 2212, 2270, 2353, 2408, 2498, 3020, 4339, 4452], '275:': [1960, 2163, 2226, 2284, 2367, 2422, 2512, 3034, 4353], '3485-3492Abstract': [1961, 2164, 2227, 2285, 2368, 2423, 2513, 3035, 4354], '(137)': [1969, 2172, 2235, 2293, 2376, 2431, 2521, 3043, 4362], 'rat': [1973, 3787], '(40Sharma': [1974], 'Chapman': [1978], 'Leiter': [1980], '271:': [1988], '2294-2299Abstract': [1989], '(77)': [1997], 'genes.': [2000], 'Three': [2001], 'nuclease': [2002, 2037], 'hypersensitive': [2003], 'sites,': [2004], 'termed': [2005], 'HSS': [2006], '1': [2007, 3056, 3101, 3948, 4039, 4063, 4076, 4105, 4407, 4420, 4436], '(−2560': [2008], '−1880': [2010], '(−1330': [2013], '−880': [2015], '3': [2017, 4162], '(−260': [2018], '+180': [2020], 'identified': [2023], 'DNase': [2033], 'micrococcal': [2036], 'However,': [2068], 'only': [2069, 2132, 2309], 'HSS1': [2070, 2127, 2181, 2451, 2472], 'Sequence': [2114, 2175], 'mouse,': [2118], 'chicken,': [2119], 'revealed': [2124], 'represented': [2130], 'area': [2133], 'significant': [2135], 'identity': [2136, 4384], '4.5': [2138], 'kilobases': [2139], 'start': [2143], 'site': [2144, 3707, 3737, 4447], '(41Gerrish': [2145, 2208, 2266, 2404, 2494, 3016, 4335, 4448], 'conservation': [2176], 'allowed': [2179], 'divided': [2185], 'into': [2186], 'bp)': [2206, 2624, 4330], 'subdomains': [2207, 2470], 'II,': [2241, 2307, 2476], 'III,': [2245, 3146], 'HNF3β': [2265, 2382, 2401, 2492, 3848, 4446], 'This': [2296], 'forkhead': [2297], 'necessary': [2302], 'although': [2308], 'context': [2312], 'both': [2314, 2575], 'importance': [2380], 'supported': [2388], 'showing': [2391], 'mRNA': [2394], 'levels': [2395], 'homozygous': [2399], 'null': [2400], 'embryoid': [2402], 'bodies': [2403], 'Collectively,': [2434], 'obtained': [2437, 4413], 'transfected': [2443, 4398], 'pdx-1-driven': [2444], 'constructs': [2446, 4323], 'strongly': [2447], 'suggested': [2448], 'played': [2453], 'role': [2456], 'adult.': [2465], 'We': [2466], 'proposed': [2467], '(i.e.': [2473], 'III)': [2478], 'contained': [2479], 'critical': [2486, 2594], 'process,': [2489], 'element': [2493, 3782, 3812, 3844], 'A': [2524, 4013], 'comprehensive': [2525], 'series': [2526], 'block': [2528, 2717], 'mutants': [2529], 'prepared': [2538, 3113, 3261], 'test': [2540], 'hypothesis.': [2542], 'positive': [2553], 'These': [2562], 'suggest': [2564], 'regulated': [2569], 'states': [2580], 'inactivating': [2588], 'mutation': [2589], 'one': [2591, 4200, 4251], 'its': [2593, 2603], '(e.g.': [2596], 'PDX-1,': [2597], 'HNF3β)': [2600], 'could': [2601], 'affect': [2602], 'dysfunction': [2610], 'patients.': [2614], 'Human': [2615], 'spanning': [2618, 4324], 'generated': [2626, 2738], '(PCR)': [2631], 'cloned': [2633], 'directly': [2634], 'upstream': [2635], 'herpes': [2638], 'simplex': [2639], 'virus': [2640, 3065], '(Tk)': [2643], 'promoter': [2644], '(CAT)': [2650], 'vector,': [2652], 'pTk(An)': [2653], '(42Jacoby': [2654], 'D.B.': [2655, 3190], 'Zilz': [2656], 'N.D.': [2657], '1989;': [2663, 3277], '264:': [2664], '17623-17626Abstract': [2665], 'Pst-Bst·pTk': [2672, 2736, 2875, 2927], 'contains': [2673], '−2917': [2678], '(Pst': [2679], 'I)': [2680], '−1918': [2682], '(Bst': [2683], 'EII)': [2684], 'bp': [2685, 4375], 'Noncomplementary': [2715], 'transversional': [2716], 'point': [2719], '(G': [2721], 'T;': [2723], 'C': [2724], 'A)': [2726], 'I·pTk': [2734], 'using': [2739, 3262, 4179], 'Quik': [2741], 'Change': [2742], 'mutagenesis': [2743, 2873, 2928], 'kit': [2744], '(Stratagene);': [2745], 'oligonucleotides': [2750, 2870, 3575], 'used': [2751, 2871, 2980, 3053, 3292, 3489, 3551, 3559, 3576, 4230, 4281], 'were:': [2752, 2876, 3641, 4199, 4250, 4287], 'S1': [2753], 'mutant,': [2754, 2760, 2766, 2772, 2778, 2784, 2790, 2796, 2802, 2840, 2879, 2902, 3651, 3659, 3687, 3695], 'CAGTATCAGCGAGGAAGCGACTGACGTCCTGCTAATA': [2755], '(−2788': [2756], '−2752);': [2758], 'S2': [2759, 2807, 2817, 2827, 2877, 2884, 2891, 3649, 3657, 3665], 'AGGACTATCAGGACGGAAGTAGCCGCCACGACTTTTTCACTGT': [2761], '(−2777': [2762, 2814], '−2735);': [2764], 'S3': [2765], 'TCCTGCTAATAAACGCAGGGGGCACTGTCCACACTTT': [2767], '(−2762': [2768], '−2726);': [2770, 2826], 'S4': [2771], 'AATAAACGACTTTTTACAGTGAATTCCTTTAATTGGTTTAC': [2773], '(−2755': [2774], '−2715);': [2776, 3683, 3691, 3699], 'S5': [2777, 2838, 2845, 2853, 2899, 2907, 2915, 3693], 'TTTCACTGTCCACACGGGCCGGTTGGGCACCCTTTTTTGTTTATT': [2779], '(−2743': [2780, 2858], '−2699);': [2782], 'S6': [2783], 'TGTTTATTTATCCATCCTCGAGTAGGTTAAATGGCTCGGGA': [2785], '(−2706': [2786], '−2666);': [2788], 'S7': [2789], 'TCCATAAGAGCTGCTTGGCCCGGTACCGGGAAGTTGCTCCC': [2791], '(−2696': [2792, 2888], '−2656);': [2794, 2883], 'S8': [2795, 4429], 'GCTGTTAAATGGCTCTTTCCTTTGCTCCCTAATGGC': [2797], '(−2684': [2798], '−2649);': [2800, 2890], 'S9': [2801], 'TCGGGAAGTTGCTCCCGCCGTTAGCGGTATCGCTGCCGG': [2803], '(−2671': [2804], '−2633);': [2806], '7–11': [2808, 2811, 2878, 3658], '(S2': [2810, 2820, 2831], 'MUT),': [2812], 'AGGACTATCAGGACGTCCTGAGCAAAAACGACTTTTTCACTGTCC': [2813], '−2733);': [2816], 'β-Fibrinogen': [2819], 'β-FIB),': [2822], 'CTATCAGGACGTTTAGTAATATTTGACAGTTTCACTGTCCACACTTT': [2823], '(−2773': [2824], 'A3': [2830], 'A3),': [2833], 'GGACTATCAGGACTAAGACTCTAATTACCCTTTTTTCACTGTCCAC': [2834], '(−2776': [2835], '−2731);': [2837], '8–11': [2839, 2901, 3694], 'TTTTTCACTGTCCACACTTTCCGGGGTTTACACCTTTTTTGTTTA': [2841], '(−2745': [2842, 3675], '−2701);': [2844], 'TTCACTGTCCACACTGATATTGATTTTTACCTTTTTTGTTTAT': [2848], '−2700);': [2851], 'A3,': [2856, 2894, 2918], 'TTTCACTGTCCACACTAAGACTCTAATTACCCTTTTTTGTTTATT': [2857], '−2699).': [2860], 'numbering': [2862, 2924], 'relative': [2864, 2930], 'humanpdx-1': [2867], 'AGGACTATCAGGACGTCCTGAGCAAAAAAGACTTTTTCACTGTCC': [2880], '(−2700': [2881], 'β-Fib,': [2886], 'CTATCAGGACGTTTAGTTTAATATTTGACAGTTTCACTGTCCACAGTAT': [2887], 'GGACTATCAGGACTAAGACTCTAATTACGACTTTTTCACTGTC': [2895], '(−2690': [2896], '−2657);': [2898], 'nt': [2900], 'TTTTTCAGTGTCCACACTATCCGGGGTTTACAGCCGTTTTTGTTT': [2903], '(−2668': [2904], '−2624);': [2906], 'TTCACTGTCCACAGTGATATTGATTTTTAGCCGTTTTTGTTTA': [2910], '(−2665': [2911], '−2623);': [2913], 'TTTCACTGTCCACAGTAAGACTCTAATTACGCCGTTTTTGTTTAT': [2919], '(−2666': [2920], '−2622).': [2922], 'All': [2936], 'mutated': [2939, 3870], 'underlined,': [2942], 'each': [2944, 3058, 3103, 4189, 4380], 'construct': [2945], 'verified': [2947], 'sequencing.': [2949, 4299], 'plasmid': [2953], '(pBJ5-HNF1α': [2954], '(43Kuo': [2955], 'Hsieh': [2959], 'Francke': [2961], '1990;': [2972, 3207, 3227, 3829], '87:': [2973], '9838-9842Crossref': [2974], '(93)': [2977], 'Scholar))': [2979, 3546, 4142], 'kindly': [2986], 'provided': [2987], 'Dr.': [2989], 'Gerald': [2990], '(Stanford': [2992], 'University,': [2993], 'Palo': [2994], 'Alto,': [2995], 'CA).': [2996], 'Monolayer': [2997, 3874], 'cultures': [2998, 3875, 3907], '(βTC3,': [3003], 'HIT': [3004], 'T-15,': [3005], 'MIN6)': [3006], 'non-β': [3008], '(NIH3T3)': [3009], 'maintained': [3012], 'described': [3014, 3264], 'previously': [3015, 3265], 'LipofectAMINE': [3047], 'reagent': [3048], '(Life': [3049], 'Technologies,': [3050], 'Inc.)': [3051, 3987], 'transfect': [3055], 'μg': [3057, 3102, 3477, 4082], 'ofpdx-1': [3059], '·pTk': [3060], 'Rous': [3063], 'sarcoma': [3064], 'enhancer-driven': [3066], 'luciferase': [3067, 3119], 'plasmid,': [3069], 'pRSVLUC': [3070], '(44DeWet': [3071, 3120], 'J.R.': [3072, 3121], 'Wood': [3073, 3122], 'K.V.': [3074, 3123], 'DeLuca': [3075, 3124], 'Helinski': [3077, 3126], 'D.R.': [3078, 3127], 'Subramani': [3079, 3128], '1987;': [3084, 3133, 3151, 3724], '725-737Crossref': [3086, 3135], '(2474)': [3089, 3138], 'Co-transfection': [3092], 'NIH3T3': [3095], 'similarly': [3099], 'pdx-1·pTk,': [3105], 'pRSVLUC,': [3106], 'pBJ5': [3108], 'or': [3109, 3481, 4091], 'pBJ5-HNF1α.': [3110], 'Extracts': [3111], '40–48': [3114], 'h': [3115, 3601, 4064, 4106, 4163], 'after': [3116], 'CAT': [3142], '(45Nordeen': [3143], 'S.K.': [3144], 'Green': [3145], 'P.P.': [3147], 'Fowles': [3148], 'D.M.': [3149], 'DNA.': [3150], '6:': [3152], '173-178Crossref': [3153], '(178)': [3156, 3212], 'enzymatic': [3159], 'assays': [3160], 'performed.': [3161], '·CAT': [3163], 'normalized': [3166], 'pRSVLUC.': [3170], 'experiment': [3172], 'carried': [3174, 3254], 'out': [3175, 3255], 'three': [3178], 'independent': [3179], 'times.': [3180], 'Gel': [3181], 'shift': [3182, 3493], 'conditions': [3183, 3557, 3609], 'detect': [3185, 3578], '(46Baumhueter': [3187], 'Mendel': [3189], 'Kuo': [3193], 'Turk': [3195], 'Graves': [3197], 'M.K.': [3198], 'Edwards': [3199], 'C.A.': [3200], 'Courtois': [3201], '4:': [3208, 3228, 3830], '372-379Crossref': [3209], '(47Sladek': [3216, 3818], 'Zhong': [3218, 3820], 'Lai': [3220, 3822], '2353-2365Crossref': [3229, 3831], '(852)': [3232, 3834], '(48Wang': [3237], 'J.-C.': [3238], 'Stromstedt': [3239], 'P.-E.': [3240], "O'Brien": [3241], 'R.M.': [3242], 'Granner': [3243], 'D.K.': [3244], '794-800PubMed': [3249], 'described.': [3257], 'Nuclear': [3258], 'extracts': [3259], 'methods': [3263], '(49Schreiber': [3266], 'Matthias': [3268], 'Muller': [3270], 'M.M.': [3271], 'Schaffner': [3272], 'W.': [3273], 'Nucleic': [3274], 'Acids': [3275], '6419Crossref': [3279], '(3912)': [3282], 'TNT-coupled': [3286], 'reticulocyte': [3287], 'lysate': [3288], 'system': [3289], '(Promega)': [3290], 'vitro': [3295, 3485], 'transcribe': [3296], 'translate': [3298], '(pGEM7-HNF1α': [3300], '(Richard': [3301], "O'Brien,": [3302], 'Vanderbilt': [3303, 3520], 'University)),': [3304], '(pMT7-HNF4α': [3306], '(50Jiang': [3307], '1218-1225Abstract': [3316], '(70)': [3324], 'Scholar)),': [3326, 3354, 3376, 3400, 3438], '(pGEM1-HNF6': [3328], '(51Rausa': [3329], 'Samadani': [3331], 'Ye': [3333], 'Lim': [3335], 'Fletcher': [3337], 'C.F.': [3338], 'Jenkins': [3339], 'N.A.': [3340], 'Copeland': [3341], 'N.G.': [3342], 'Costa': [3343, 3852], 'R.H.': [3344, 3853], '192:': [3348], '228-246Crossref': [3349], '(157)': [3352], '(SKII900': [3356], '(52Leonard': [3357], 'Peers': [3359], 'Johnson': [3361], 'Ferreri': [3363], 'Lee': [3365], '1275-1283Crossref': [3373], 'Pax6': [3377], '(pKW10-Pax6': [3378], '(53Sander': [3379], 'Neubuser': [3381], 'Kalamaras': [3383], 'Ee': [3385], 'Martin': [3387], '11:': [3394], '1662-1673Crossref': [3395], '(457)': [3398], 'Pax4': [3401], '(pBluescript': [3402, 3415], 'KSII(+)-Pax4,': [3403], 'Beatriz': [3404], 'Sosa-Pineda,': [3405], 'St.': [3406], "Jude's": [3407], "Children's": [3408], 'Research': [3409, 3446], 'Hospital,': [3410], 'Memphis,': [3411], 'TN),': [3412], 'Nkx': [3413, 3439], '6.1': [3414, 3417], 'SKII(+)-Nkx': [3416], '(54Jorgensen': [3418], 'M.C.': [3419], 'Vestergard': [3420], 'Ericson': [3423], 'FEBS': [3429], 'Lett.': [3430], '461:': [3432], '287-294Crossref': [3433], '(35)': [3436], '2.2': [3440], '(PCRII-Nkx': [3441], '2.2,': [3442], 'Pelle': [3443], 'Serup,': [3444], 'Hagedorn': [3445], 'Institute,': [3447], 'Gentofte,': [3448], 'Denmark),': [3449], 'Hblx9': [3451], '(HB9C': [3452], '(55Harrison': [3453], 'K.A.': [3454, 3750], 'Druey': [3455], 'K.M.': [3456], 'Deguchi': [3457], 'Tuscano': [3459], 'J.M.': [3460], 'Kehrl': [3461], 'J.H.': [3462], '19968-19975Abstract': [3468], 'Scholar)).': [3474], 'Approximately': [3475], '5': [3476, 3482, 3894], 'extract': [3479, 3500], 'protein': [3480, 3487, 3501, 4060, 4159], 'μl': [3483, 4055, 4077, 4156, 4193], 'ofin': [3484], 'translated': [3486], 'per': [3490], 'gel': [3491, 3607, 4308], 'mobility': [3492], 'reaction.': [3494], 'Anti-PDX-1': [3495], 'preincubated': [3498], '20': [3503], 'min': [3504, 3895, 3928, 4001, 4207, 4258], 'room': [3506], 'temperature': [3507], 'prior': [3508], 'adding': [3510], 'DNA': [3512, 4171], 'probe;': [3513], 'anti-N-terminal': [3514], '(amino': [3515, 3524, 4115, 4120], 'acids': [3516, 3525, 4116, 4121], '1–75;': [3517], 'Chris': [3518], 'Wright,': [3519], 'University)': [3521], 'anti-C-terminal': [3523], '271–283': [3526, 4122], '(10Stoffers': [3527, 4123], 'assays.': [3554], 'same': [3556], 'anti': [3561, 3567], '(Santa': [3563, 3569, 4087], 'Cruz': [3564, 3570, 4088], 'Biotechnology)': [3565, 3571], 'antisera.': [3572], 'double-stranded': [3574], 'end-labeled': [3581], 'polynucleotide': [3583], '[γ-32P]ATP.': [3586], 'samples': [3588, 3953], 'electrophoresed': [3590, 4303], '6%': [3592], 'nondenaturing': [3593], 'polyacrylamide': [3594, 3606], 'gels': [3595], '150': [3597], 'V': [3598], 'under': [3602], 'high': [3603], 'ionic': [3604], 'strength': [3605], 'electrophoresis': [3608], '(15Peshavaria': [3610], 'before': [3632], 'drying': [3633], 'autoradiography.': [3635], 'probe': [3637], 'competitor': [3639], 'S2,': [3643], 'GTCCTGCTAATAAACGACTTTTT': [3644], '(−2763': [3645, 3653, 3661, 3669], '−2741);': [3647, 3655, 3663, 3671], 'BLOCK': [3650, 3686], 'GGAAGTAGCCGCCCCGACTTTTT': [3652], 'GTCCTGAGCAAAAACGACTTTTT': [3660], 'β-FIB,': [3667], 'GTTTAGTTAATATTTGACAGTTT': [3668], 'S4,': [3673, 4424], 'TTTTTCACTGTCCACACT': [3674], '−2728);': [3677], 'S5,': [3679, 4425], 'ACACTTTAATTGGTTTAC': [3680], '(−2732': [3681, 3689, 3697], 'E5': [3685], 'ACACGGGCCGGTTGGGCACC': [3688], 'ACACTTTCCGGGGTTTAC': [3696], 'S7–8,': [3701], 'CTGCTGTTAAATGGCTCGGG': [3702], '(−2686': [3703], '−2667);': [3705], 'HNF1': [3706, 3736], 'β-Fib': [3711], '(56Courtois': [3713], 'Morgan': [3715], 'J.G.': [3716], 'Campbell': [3717], 'Fourel': [3719], '238:': [3725], '688-692Crossref': [3726], '(281)': [3729], 'TTTAGTTAATATTTGACAGTT': [3732], '(−99': [3733], '−79);': [3735], '(57Okita': [3743], 'Yang': [3745], 'Q.': [3746], 'Hangenfeldt': [3749], 'Nakajima': [3755], 'Namba': [3757], 'Wollheim': [3759], 'C.B.': [3760], '263:': [3770], '566-569Crossref': [3771], '(58)': [3774], 'CCCTGGTTAAGACTCTAATGACC': [3777], '(−229': [3778], '−207);': [3780], 'A3)': [3784], 'CCTCTTAAGACTCTAATTACCCT': [3807], '(−212': [3808], '−190);': [3810], 'ApoCIII': [3816], 'GTCTACTGGAAACGGGTC': [3837], '(−86': [3838], '−69);': [3840], '(58Samadani': [3850], '16:': [3858], '6273-6284Crossref': [3859], '(131)': [3862], 'CGATATTGATTTTT': [3865], '(−140': [3866], '−127).': [3868], 'nucleotides': [3871], 'underlined.': [3873], 'βTC-3': [3878], '(∼0.5–1.0': [3880], '×': [3881], '108)': [3882], 'exposed': [3884], '1%': [3886], 'formaldehyde': [3887], "Dulbecco's": [3889], 'modified': [3890], "Eagle's": [3891], 'medium': [3892], '23': [3897], '°C;': [3898], 'glycine': [3899], 'added': [3901, 4095], '0.125': [3903], 'm,': [3904], 'incubated': [3909, 3925, 4103], 'min.': [3912], 'collected': [3916], 'cold': [3918], 'phosphate-buffered': [3919], 'saline,': [3920], 'pelleted': [3921], 'centrifugation,': [3923, 4075], '10': [3927, 3940, 4000, 4081, 4192], 'ice': [3930], '0.6': [3932], 'ml': [3933, 4020], 'SDS': [3935], 'lysis': [3936], 'buffer': [3937, 4022, 4312], '(1%': [3938], 'SDS,': [3939, 4024], 'mm': [3941, 3944, 3949, 4029, 4032, 4037, 4040], 'EDTA,': [3942, 4030], '50': [3943], 'Tris-HCl,': [3945, 4033], 'pH': [3946, 4034], '8.1,': [3947, 4035], 'phenylmethylsulfonyl': [3950, 4041], 'fluoride).': [3951], 'Lysed': [3952], 'transferred': [3955], 'prechilled': [3957], 'microcentrifuge': [3958], 'tubes': [3959], 'containing': [3960], '250': [3961], 'mg': [3962], 'glass': [3964], 'beads': [3965, 4073, 4182], '(≤106': [3966], 'μm': [3967], 'diameter,': [3968], '106': [3969], 'μm),': [3970], 'sonicated': [3975], 'power': [3977], 'setting': [3978], '4': [3979, 3993, 4003, 4066, 4108, 4165], 'Virsonic': [3982], '100': [3983], 'sonicator': [3984], '(Virtis': [3985], 'Company,': [3986], 'twelve': [3989], '10-s': [3990], 'pulses': [3991], '°C.': [3994, 4012, 4067, 4109, 4166], 'reactions': [3996], 'centrifuged': [3998], '°C': [4004, 4204, 4213, 4218, 4224, 4255, 4264, 4269, 4275], 'remove': [4006], 'debris': [4007], 'stored': [4009], '−70': [4011], '100-μl': [4014], 'aliquot': [4015], 'diluted': [4017], '0.9': [4019], '(0.01%': [4023], '1.1%': [4025], 'Triton': [4026], 'X-100,': [4027], '1.2': [4028], '16.7': [4031], '167': [4036], 'NaCl,': [4038], 'fluoride,': [4042], '0.1%': [4043], 'protease': [4044], 'inhibitor': [4045], 'mixture': [4046], 'mammalian': [4048], '(Sigma))': [4050], 'precleared': [4052], '60': [4054, 4155], 'bovine': [4057], 'serum': [4058], 'albumin-blocked': [4059], 'A-Sepharose': [4061, 4160], 'After': [4068, 4167], 'removal': [4069], 'Sepharose': [4072], 'anti-PDX-1': [4079], 'antisera,': [4080], 'normal': [4084], 'rabbit': [4085], 'IgG': [4086], 'Biotechnology,': [4089], 'Inc.),': [4090], 'no': [4092], 'antibody': [4093], 'supernatant,': [4098], 'Antisera': [4110], 'raised': [4111], 'N-terminal': [4114], '1–75)': [4117], 'C-terminal': [4119], 'regions': [4143], 'used.': [4147], 'Antibody-protein-DNA': [4148], 'complexes': [4149], 'isolated': [4151], 'incubation': [4153], 'blocked': [4158], 'extensive': [4168], 'washing,': [4169], 'fragments': [4172], 'eluted': [4174], 'analyzed': [4176], 'PCR': [4178, 4181, 4294], 'Ready-to-Go': [4180], '(Amersham': [4183], 'Pharmacia': [4184], 'Biotech),': [4185], '15': [4186], 'pmol': [4187], 'primer,': [4190], 'immunoprecipitated': [4195], 'DNA/reaction.': [4196], 'Cycling': [4197, 4243], 'parameters': [4198, 4244], 'cycle': [4201, 4252], '95': [4203, 4212, 4254, 4263], '28': [4209, 4260], 'cycles': [4210, 4261], '30': [4215, 4220, 4226, 4266, 4271, 4277], 's,': [4216, 4221, 4267, 4272], '61': [4217, 4268], '72': [4223, 4274], 's.': [4227, 4278], 'primers': [4229, 4280], 'amplification': [4232, 4246, 4283], '5′-CCACTAAGAAGGAAGGCCAG-3′': [4238], '(−2785)': [4239], '5′-CTGAGGTTCTTTCTCTGCCTCTCTG-3': [4241], '(−2435).': [4242], 'PEPCK': [4249, 4286], '5′-GAGTGACACCTCACAGCTGTGG-3′': [4288], '(−434)': [4289], '5′-GGCAGGCCTTTGGATCATAGCC-3′': [4291], '(−96).': [4292], 'products': [4295, 4301], 'confirmed': [4297], 'Amplified': [4300], '1.4%': [4306], 'agarose': [4307], 'Tris': [4310], 'acetate/EDTA': [4311], 'visualized': [4314], 'ethidium': [4316], 'bromide': [4317], 'staining.': [4318], 'Transfected': [4319], 'driven': [4321], 'display': [4331], 'cell-specific': [4333], 'determine': [4366], 'whether': [4367], 'between': [4371, 4414], '−2773': [4372], '−2643': [4374], 'involved': [4377], 'regulation,': [4379], 'segment': [4381], '(S)': [4382], 'mutated,': [4387], 'assayed': [4396], 'HIT-T15,': [4399], 'βTC-3,': [4400], 'MIN6': [4402], 'lines': [4405, 4418], '(Fig.': [4406, 4419, 4435], 'A).': [4408], 'Essentially': [4409], 'equivalent': [4410], 'B).': [4421], 'Mutations': [4422], 'S6,': [4426], 'S7,': [4427], 'all': [4430], 'B),': [4437], 'comparable': [4442], 'mutating': [4444]}, 'cited_by_api_url': 'https://api.openalex.org/works?filter=cites:W1565835249', 'counts_by_year': [{'year': 2023, 'cited_by_count': 1}, {'year': 2022, 'cited_by_count': 3}, {'year': 2021, 'cited_by_count': 2}, {'year': 2020, 'cited_by_count': 1}, {'year': 2019, 'cited_by_count': 1}, {'year': 2018, 'cited_by_count': 1}, {'year': 2017, 'cited_by_count': 4}, {'year': 2016, 'cited_by_count': 1}, {'year': 2015, 'cited_by_count': 5}, {'year': 2014, 'cited_by_count': 4}, {'year': 2013, 'cited_by_count': 1}, {'year': 2012, 'cited_by_count': 4}], 'updated_date': '2024-12-07T15:04:08.956359', 'created_date': '2016-06-24'}
Publication Information

Basic Information

Access and Citation

AI Researcher Chatbot

Primary Location

Authors

Topics

Keywords

Related Works
