Title: Effect of C-C Chemokine Receptor 2 (CCR2) Knockout on Type-2 (Schistosomal Antigen-Elicited) Pulmonary Granuloma Formation
Abstract: Monocyte chemotactic protein (MCP)-1 is postulated to play a role in cellular recruitment during inflammatory reactions. C-C chemokine receptor 2 (CCR2) is considered the major G-protein coupled receptor for MCP-1/JE. We reported that mice with knockout of the CCR2 gene display partially impaired type-1 granuloma formation. The present study similarly examined the effect of CCR2 deficiency on synchronously developing type-2 (Th2) cytokine-mediated lung granulomas elicited by embolization of beads coated with Ags of Schistosoma mansoni eggs. Systemically, blood monocytes were reduced by about half throughout the 8-day study period. At the local level, granuloma size and macrophage content were impaired during the early growth phase (days 1 to 2). By day 4, granuloma sizes were similar to controls. In granulomatous lungs, CCR2 knockout increased mRNA for CCR2 agonists, MCP-1, MCP-3, and MCP-5, but reduced IL-4 and IFNγ mRNA. The latter was possibly related to decreased CD4+ T cell recruitment. Regionally, draining lymph nodes showed panlymphoid hyperplasia with impaired production of IFNγ, IL-2, and IL-4, but not IL-5, IL-10, or IL-13. Analysis of procollagen gene expression indicated transient impairment of procollagen III transcripts on day 4 of granuloma formation. These findings indicate that agonists of CCR2 contribute to multiple facets of type-2 hypersensitivity granulomatous inflammation. Monocyte chemotactic protein (MCP)-1 is postulated to play a role in cellular recruitment during inflammatory reactions. C-C chemokine receptor 2 (CCR2) is considered the major G-protein coupled receptor for MCP-1/JE. We reported that mice with knockout of the CCR2 gene display partially impaired type-1 granuloma formation. The present study similarly examined the effect of CCR2 deficiency on synchronously developing type-2 (Th2) cytokine-mediated lung granulomas elicited by embolization of beads coated with Ags of Schistosoma mansoni eggs. Systemically, blood monocytes were reduced by about half throughout the 8-day study period. At the local level, granuloma size and macrophage content were impaired during the early growth phase (days 1 to 2). By day 4, granuloma sizes were similar to controls. In granulomatous lungs, CCR2 knockout increased mRNA for CCR2 agonists, MCP-1, MCP-3, and MCP-5, but reduced IL-4 and IFNγ mRNA. The latter was possibly related to decreased CD4+ T cell recruitment. Regionally, draining lymph nodes showed panlymphoid hyperplasia with impaired production of IFNγ, IL-2, and IL-4, but not IL-5, IL-10, or IL-13. Analysis of procollagen gene expression indicated transient impairment of procollagen III transcripts on day 4 of granuloma formation. These findings indicate that agonists of CCR2 contribute to multiple facets of type-2 hypersensitivity granulomatous inflammation. Due to their potent leukocyte chemotactic activity, the class of 8- to 10-kd protein molecules known as chemokines are postulated to be important mediators of inflammation.1Taub DD Oppenheim JJ Chemokines, inflammation and the immune system.Therapeutic Immunol. 1994; 1: 229-246PubMed Google Scholar, 2Baggiolini M Dewald B Moser B Human chemokines: an update.Annu Rev Immunol. 1997; 15: 675-705Crossref PubMed Scopus (1968) Google Scholar In recent years they have been extensively investigated and a host of these molecules are known. Based upon positional conservation of cysteine residues, two major classes are recognized, the C-X-C and C-C chemokines. Recently, a group of G-protein-coupled transmembrane receptors for these molecules has been described that shows both selective and promiscuous binding of particular chemokines. Among the C-C group of chemokines, monocyte chemoattractant protein (MCP)-1 appears to bind selectively to C-C chemokine receptor 2 (CCR2).3Boring L Gosling J Monteclaro FS Lusis AJ Tsou C-L Charo IF Molecular cloning and functional expression of murine JE (monocyte chemotactic protein 1) and murine macrophage inflammatory protein 1a receptors: evidence for two closely linked C-C chemokine receptors on chromosome 9.J Biol Chem. 1996; 271: 7551-7558Crossref PubMed Scopus (111) Google Scholar However, other C-C chemokines are known to bind this receptor. As a potent chemoattractant for mononuclear phagocytes, MCP-1 may potentially recruit macrophages during chronic inflammation and indeed a number of reports seem to support this notion.4Yla-Herttuala S Lipton BA Rosenfeld ME Sarkioja T Yoshimura T Leonard EJ Witztum JL Steinberg D Expression of monocyte chemoattractant protein 1 in macrophage-rich areas of human and rabbit atherosclerotic lesions.Proc Natl Acad Sci USA. 1991; 88: 5252-5256Crossref PubMed Scopus (799) Google Scholar, 5Koch AE Kunkel SL Harlow LA Johnson B Evanoff HL Haines GK Burdick MD Pope RM Strieter RM Enhanced production of monocyte chemoattractant protein-1 in rheumatoid arthritis.J Clin Invest. 1992; 90: 772-779Crossref PubMed Scopus (578) Google Scholar, 6Flory CM Jones ML Warren JS Pulmonary granuloma formation in the rat is partially dependent on monocyte chemoattractant protein 1.Lab Invest. 1993; 69: 396-404PubMed Google Scholar, 7Chensue SW Warmington KS Ruth JH Sanghi PS Lincoln P Kunkel SL Role of monocyte chemoattractant protein-1 (MCP-1) in Th1 (mycobacterial) and Th2 (schistosomal) antigen-induced granuloma formation: relationship to local inflammation, Th cell expression, and IL-12 production.J Immunol. 1996; 157: 4602-4608PubMed Google Scholar, 8Gu L Rutledge B Fiorillo J Ernst C Grewal I Flavell R Gladue R Rollins B In vivo properties of monocyte chemoattractant protein-1.J Leuk Biol. 1997; 62: 577-580PubMed Google Scholar, 9Lu B Rutledge BJ Gu L Fiorillo J Lukacs NW Kunkel SL North R Gerard C Rollins BJ Abnormalities in monocyte recruitment and cytokine expression in monocyte chemoattractant protein 1-deficient mice.J Exp Med. 1998; 187: 601-608Crossref PubMed Scopus (877) Google Scholar, 10Boring L Gosling J Chensue SW Kunkel SL Farese Jr, RV Broxmeyer HE Charo IF Impaired monocyte migration and reduced type-1 (Th1) cytokine responses in C-C chemokine receptor 2 knockout mice.J Clin Invest. 1997; 100: 2552-2561Crossref PubMed Scopus (859) Google Scholar We have previously shown that T-cell-mediated, hypersensitivity-type granuloma formation can be classified on the basis of cytokine participation into type-1/Th1 dominant, and type-2/Th2 dominant.11Chensue SW Warmington K Ruth J Lincoln P Kuo MC Kunkel SL Cytokine responses during mycobacterial and schistosomal antigen-induced pulmonary granuloma formation. Production of Th1 and Th2 cytokines and relative contribution of tumor necrosis factor.Am J Pathol. 1994; 145: 1105-1113PubMed Google Scholar More recently, we examined type-1 mycobacterial Ag-elicited granuloma formation in mice with targeted knockout of the CCR2 receptor and showed a transient defect in local macrophage recruitment as well as a defect in regional IFNγ production.10Boring L Gosling J Chensue SW Kunkel SL Farese Jr, RV Broxmeyer HE Charo IF Impaired monocyte migration and reduced type-1 (Th1) cytokine responses in C-C chemokine receptor 2 knockout mice.J Clin Invest. 1997; 100: 2552-2561Crossref PubMed Scopus (859) Google Scholar That study indicated that CCR2 was involved at least temporally in local macrophage recruitment and regional T cell maturational events during a Th1 response. In a previous study using anti-MCP-1 antibodies, we showed that MCP-1 also appears to participate in Th2 (type-2) cytokine-mediated granulomas at both local and regional levels.7Chensue SW Warmington KS Ruth JH Sanghi PS Lincoln P Kunkel SL Role of monocyte chemoattractant protein-1 (MCP-1) in Th1 (mycobacterial) and Th2 (schistosomal) antigen-induced granuloma formation: relationship to local inflammation, Th cell expression, and IL-12 production.J Immunol. 1996; 157: 4602-4608PubMed Google Scholar Subsequent studies using MCP-1 knockout mice showed similar results using Schistosoma mansoni egg challenge.9Lu B Rutledge BJ Gu L Fiorillo J Lukacs NW Kunkel SL North R Gerard C Rollins BJ Abnormalities in monocyte recruitment and cytokine expression in monocyte chemoattractant protein 1-deficient mice.J Exp Med. 1998; 187: 601-608Crossref PubMed Scopus (877) Google Scholar In the present study, we performed a detailed analysis of local, regional, and systemic parameters during synchronized type-2 granuloma formation in mice targeted for knockout of the CCR2 receptor. The results indicate a broad role for CCR2 agonists in hypersensitivity-type granuloma formation, ranging from chemotaxis to regulation of matrix synthesis. CCR2 knockout mice were generated from 129 strain embryonic stem cells using targeting vectors as previously described.10Boring L Gosling J Chensue SW Kunkel SL Farese Jr, RV Broxmeyer HE Charo IF Impaired monocyte migration and reduced type-1 (Th1) cytokine responses in C-C chemokine receptor 2 knockout mice.J Clin Invest. 1997; 100: 2552-2561Crossref PubMed Scopus (859) Google Scholar Control animals consisted of age-matched nonmutant 129 X B6 F1 mice. Mice were maintained in isolator cages under specific pathogen-free conditions and provided with food and water ad libitum. Pulmonary granulomas with predominantly type-2 cytokine involvement were generated as described.11Chensue SW Warmington K Ruth J Lincoln P Kuo MC Kunkel SL Cytokine responses during mycobacterial and schistosomal antigen-induced pulmonary granuloma formation. Production of Th1 and Th2 cytokines and relative contribution of tumor necrosis factor.Am J Pathol. 1994; 145: 1105-1113PubMed Google Scholar Briefly, mice were sensitized by i.p. injection of 3000 S. mansoni eggs suspended in 0.5 ml phosphate-buffered saline (PBS). Fourteen to 16 days later, sensitized mice were challenged by i.v. with 6000 Sepharose 4B beads (in 0.5 ml PBS) covalently coupled with soluble schistosome egg antigens (SEA) obtained from the World Health Organization (Geneva, Switzerland). Groups of mice were killed at days 1, 2, 4, and 8 of granuloma formation. Following perfusion with cold RPMI, lungs (excluding trachea and major bronchi) were excised. The right upper lung of each mouse was snap-frozen in liquid N2 for mRNA isolation. The left lower lobe was post-inflated and formalin-fixed. The remaining lung lobes were placed in cold RPMI medium; granulomas were then isolated and dispersed as previously described.7Chensue SW Warmington KS Ruth JH Sanghi PS Lincoln P Kunkel SL Role of monocyte chemoattractant protein-1 (MCP-1) in Th1 (mycobacterial) and Th2 (schistosomal) antigen-induced granuloma formation: relationship to local inflammation, Th cell expression, and IL-12 production.J Immunol. 1996; 157: 4602-4608PubMed Google Scholar, 11Chensue SW Warmington K Ruth J Lincoln P Kuo MC Kunkel SL Cytokine responses during mycobacterial and schistosomal antigen-induced pulmonary granuloma formation. Production of Th1 and Th2 cytokines and relative contribution of tumor necrosis factor.Am J Pathol. 1994; 145: 1105-1113PubMed Google Scholar For differential counting, duplicate cytospin preparations were prepared from the remaining dispersed granuloma cells and stained with Wright's stain. Blood was also collected from each animal and total white cell count and differential analysis performed. Mediastinal lymph nodes were collected at the time of lung harvest and teased into single cell suspension. After washing, the cells were cultured in RPMI-1640 medium (JRH Biosciences, Lenexa, KS) containing 10% FBS (Intergen, Purchase, NY), 10 mmol/L glutamine, and 100 mg/ml streptomycin and 100 U/ml penicillin (RPMI-FBS) at 5 × 106/ml in the presence or absence of 5 μg/ml SEA, then cultured as above for 24 hours. Supernates were collected by centrifugation and stored at −45°C. Granulomas were measured blindly from formalin-inflated lungs that were paraffin-embedded, sectioned, and stained with hematoxylin and eosin. Granuloma area was measured by computerized morphometry. A minimum of 20 lesions was measured per lung. Dispersed granulomas and mediastinal lymph node suspensions were subjected to flow cytometry using two- and three-color fluorescent analysis. Anti-CD3, -CD4, -CD8, -CD14, -CD19, and Mac-3 fluorescent-labeled antibodies were obtained commercially (Pharmingen, San Diego, CA). Samples were stained and analyzed immediately using a FACSCAN (Becton-Dickinson, Franklin Lakes, NJ) and WinList analysis program as described previously.12Curtis JL Kim S Scott PJ Buechner-Maxwell VA Adhesion receptor phenotypes of murine CD4+ T cells during a pulmonary immune response to sheep erythrocytes.Am J Respir Cell Mol Biol. 1995; 12: 520-530Crossref PubMed Scopus (29) Google Scholar Using a modified method of Chirgwin et al13Chirgwin JM Przbyca AE MacDonald RJ Rutter WJ Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease.Biochemistry. 1979; 18: 5294-5299Crossref PubMed Scopus (16610) Google Scholar and Jonas et al,14Jonas ET Sargent D Dawid IB Epidermal keratin gene expressed in embryos of Xenopus laevis.Proc Natl Acad Sci USA. 1985; 82: 5413-5417Crossref PubMed Scopus (189) Google Scholar total cellular RNA was extracted from perfused lung lobes excluding major bronchi that had been snap-frozen with liquid N2. The frozen tissues were suspended in extraction buffer (25 mmol/L Tris, pH 8.0, 4.2 mol/L guanidine isothiocyanate, 0.5% Sarkosyl, and 0.1 mol/L 2-mercaptoethanol), homogenized, then added to an equal volume of extraction buffer (100 mmol/L Tris, pH 8.0, 10 mmol/L EDTA and 1% sodium dodecyl sulfate (SDS). The mixture was then serially extracted with chloroform-phenol and chloroform-isoamyl alcohol. The RNA is next precipitated at −70°C in ethyl alcohol, washed, and reprecipitated. The pellet was finally dissolved in DEPC water and RNA concentrations determined spectrophotometrically prior to storage at −70°C. Primers and probes (18-22 mer) were designed based upon nucleotide sequences downloaded from the NCBI data bank and using primer design software (Premier Biosoft International, Palo Alto, CA). Designed primer and probe sequences for each of the target RNA species examined are shown in Table 1. All primers and probes were prepared by Genosys Biotechnologies Inc. (The Woodlands, TX). Probes were biotinylated with biotin-UTP using a standard 3′-end labeling kit (Boehringer Mannheim, Indianapolis, IN), unincorporated biotin was removed with QuickSpin columns (Boehringer Mannheim). Incorporation was confirmed by nitrocellulose blotting followed by streptavidin-alkaline phosphatase detection.Table 1Primer and Probe Sequences Used for PCR Amplification and Detection of Cytokine TranscriptsMouse geneSequence (5′ to 3′)Product sizeProduct spanProbe spanIFNγsenseAGTGGCATAGATGTGGAAGAAA247228–474267–288antisenseGACCTCAAACTTGGCAATACTCprobeATCTGGAGGAACTGGCAAAAGGIL-4senseCTGACGGCACAGAGCTATTGA25268–319181–199antisenseTATGCGAAGCACCTTGGAAGCprobeGAGATCATCGGCATTTTGAMCP-1/JE*Based on MCP-1/JE exon 1371–1488.senseTTAACGCCCCACTCACCTGCTG1071377–14831417–1438antisenseGCTTCTTTGGGACACCTGCTGCprobeGATGATCCCAATGAGTAGGCTGMCP-3senseGTGCCTGAACAGAAACCAACCT148353–500393–415antisenseCATTCCTTAGGCGTGACCATTprobeTTCCTCACCGCTGTTCTTTCTGMCP-5senseTTGGCTGGACCAGATGCG118116–233204–226antisenseGGGACACTGGCTGCTTGTGAprobeACAGGAGAATCACAAGCAGCCACCR2senseTCATCCACGGCATACTATCAA343120–462262–282antisenseTATTCCCAAAGACCCACTCATprobeCCTGCCTCCACTCTACTCCCTProcollagen IsenseTCGTGACCGTGACCTTGCG255255–509327–348antisenseGAGGCACAGACGGCTGAGTAGGprobeCGANAGCAGCCGCAAGAACCCTProcollagen IIIsenseGGCTGATGTACACATGCTCC259192–450275–296antisenseGCTCAGAGTAGCACCATCAGprobeTTGCTTTTACTGCTGAGGGGATCyclophilinsenseACCTAAAGTCACAGTCAACG327133–459296–316antisenseTGGTGTCTTTGCCTGCATTGprobeCATCGTGTCATCAAGGACTTC* Based on MCP-1/JE exon 1371–1488. Open table in a new tab The isolated RNA was first reverse transcribed (RT) to DNA as follows. To 25 μg of RNA (in 25 μl of DEPC water) were added 3.6 μl of RNAsin (Boehringer Mannheim) and 10 μl of random hexamer solution (500 mg/ml, Promega, Madison, WI) followed by heating to 70°C for 5 minutes in a thermocycler (9600, Perkin-Elmer Corp., Norwalk, CT). The temperature was then reduced to 43°C and 69 μl of a first-strand buffer (Gibco BRL, Grand Island, NY) containing dTT, dNTPs, and 1000 U murine Moloney leukemia virus reverse transcriptase was added.15Krug MS Berger SL First strand cDNA synthesis primed with oligo (dT).Methods Enzymol. 1987; 152: 316-325Crossref PubMed Scopus (189) Google Scholar The mixture was incubated for 2 hours, then heated to 95°C to stop the reaction. The DNA was then subjected to PCR.16Saiki RK Gelfand DH Stoffel S Scharf SJ Higuchi R Horn GT Mullis KB Erlich HA Primer-directed enzymatic amplification of DNA with thermostable DNA polymerase.Science. 1988; 239: 487-491Crossref PubMed Scopus (13369) Google Scholar Briefly, 5 μl of DNA were added to 95 μl PCR buffer containing unlabeled dNTPs (0.2 mmol/L of each) plus digoxigenin-labeled dUTP, 1 μg sense primer, 1 μg antisense primer, and 5 U Taq polymerase (all from Boehringer Mannheim) in a thin-walled PCR tube. Amplification was performed in a thermocycler as follows: 4 minutes at 95°C, followed by up to 23 cycles of 1 minute at 95°C, 2 minutes at 57°C, and 1 minute at 72°C. After cycling there was a DNA extension period of 6 minutes at 72°C. Samples were stored at −20°C prior to analysis. Detection of PCR products was performed as follows. Initially a series of amplification reactions using unlabeled dNTPs was performed and the products analyzed by standard agarose gel electrophoresis to confirm that primers yielded predicted products. Once confirmed, la- beled products were generated and detected by PCR-ELISA.17Venturoli S Zerbini M La Placa Jr, M D'Antuono A Negosanti M Gentilomi G Gallinella G Manaresi E Musiani M Evaluation of immunoassays for the detection and typing of PCR ampified human papillomavirus DNA.J Clin Pathol. 1998; 51: 143-148Crossref PubMed Scopus (25) Google Scholar Briefly, 10–60 μl of amplified product were added to a sterile microfuge tube containing 40 μl of denaturing buffer (Boehringer Mannheim) and incubated for 10 minutes. Next, 500 μl of hybridization buffer containing 4 ng/ml of appropriate (target gene) biotinylated probe was added. Negative controls included tubes with no DNA or DNA with inappropriate probe. The solution was mixed and 200-μl portions were distributed into duplicate wells of a multiwell, streptavidin-coated plate and incubated for 3 hours at 42°C. The plate was then washed and any bound product detected with peroxidase labeled anti-digoxigenin Ab by standard colorimetric reaction using 2,2′-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) substrate. A 96-well plate ELISA reader was used to measure O.D. at 405 nm. The O.D. was directly proportional to levels of target PCR product, which was normalized to levels of a housekeeping gene, cyclophilin. Interleukins 2, 4, 5, 10, and 13 and interferon-γ were measured by ELISA using commercially available reagents (Pharmingen; R&D Systems, Minneapolis, MN); sensitivities ranged from 10 to 50 pg/ml. Commercially available recombinant murine cytokines served as standards in all assays (Genzyme, Cambridge, MA; Preprotech Inc., Rocky Hill, NJ; R&D Systems). Student's t-test (two-tailed) was used to compare control with experimental groups. Values of P > 0.05 were considered to indicate lack of significance. In order to determine the effect of CCR2 knockout on leukocyte mobilization, we assessed blood leukocyte differentials and granuloma size and composition during type-2 granuloma formation. As shown in Figure 1, the day 0 baseline levels of blood leukocyte populations were comparable among groups. Thereafter, granuloma induction caused peripheral increases in monocytes, eosinophils, and neutrophils in control mice. Of these populations, the percentage of circulating monocytes in knockout mice was reduced by 50–70% during the 8-day study period. This decrease was absolute and relatively specific to monocytes; total leukocyte counts were comparable or lower in knockout mice (data not shown). Despite the persistent decrease in circulating monocytes, granuloma sizes were only transiently impaired on days 1 and 2 with the mean area being reduced to near that of the bead diameter on day 1 and reaching only 30% of controls on day 2 (Figure 2, Figure 3). Analysis of lesion composition revealed that this impairment was due to a 50% reduction in granuloma macrophages (Figure 4). This effect was selective in that there was no reduction in lymphocytes, eosinophils, or neutrophils. By day 4, both granuloma size and composition had returned to control levels. Although not totally specific for macrophages, CD14 and Mac-3 markers were evaluated by flow cytometry. Cells coexpressing these markers were likewise reduced during the early recruitment stage (Figure 5). Thus, CCR2 deficiency was associated with re-duced circulating monocytes and transient monocyte/macrophage recruitment defect in the early phase of granuloma formation.Figure 2Histologic appearance of type-2 lung granulomas in wild type and CCR2 knockout mice. A, B, and C: Lesions of wild type mice on days 2, 4 and 8 respectively. D, E, and F: Lesions of knockout mice on days 2, 4, and 8, respectively. Day 2 knockout lesions contained fewer mononuclear cells. Hematoxylin and eosin stain. Magnification, ×200.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Figure 3Effect of CCR2 knockout on type-2 lung granuloma sizes. Bars are means ± SE derived from 4 to 6 mice per group. A minimum of 20 lesions was measured from each lung. Dashed line indicates size of bead nidus. Asterisks indicate statistically significant changes, P < 0.05.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Figure 4Leukocyte composition of granulomas in wild-type and CCR2 knockout mice during type-2 lung granuloma formation. Bars are mean percentages ± SE derived from 4 to 5 individual mice per group. Asterisks indicate statistically significant changes, P < 0.05.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Figure 5Effect of CCR2 knockout on recruitment of Mac-3/CD14+ cells during type-2 lung granuloma formation. Dispersed granuloma cells were stained with fluorescent-labeled antibodies to known mouse macrophage markers, Mac-3 and CD14, then subjected to flow cytometry. Bars show levels of expression in knockout preparations as compared to the wild-type control, normalized as 100 percent. Values were derived from two experiments with a total of 4 mice per group. Asterisks indicate statistically significant changes, P < 0.05.View Large Image Figure ViewerDownload Hi-res image Download (PPT) In order to explore potential compensatory changes in knockout mice, we assessed granulomatous lungs for mRNA specific for MCP-1/JE and other CCR2 chemokine agonists, MCP-3 and MCP-5. Message levels were determined on days 2, 4, and 8 of granuloma formation using semiquantitative RT-PCR ELISA assay. As shown in Figure 6, wild-type transcript expression for MCP-1/JE and MCP-3 was generally 1.5- to 2-fold above granuloma-free lungs. Message for MCP-5 was less pronounced, ranging from 30–40% above noninflamed lungs. In all cases, CCR2 knockout caused profound augmentations. This was especially notable for MCP-1/JE and MCP-3, which ranged from 3- to 7-fold above levels in unchallenged lungs on days 4 and 8. Increases were seen on all days for MCP-5 transcripts. These findings suggested that CCR2 participates in a feedback inhibition of chemokine synthesis. In order to determine if CCR2 knockout influenced the local expression of cytokines, we compared levels of IFNγ and IL-4 transcripts in lungs with type-2 granulomas. Figure 7 shows the expression of these transcripts and those for CCR2. As expected, knockout mice showed no expression of CCR2 mRNA. Interestingly, among the control groups there was increasing CCR2 transcript expression during the response, especially on days 4 and 8. With regard to IFNγ mRNA, wild-type mice showed about two-fold increases on days 4 and 8. Consistent with the type-2 response, wild-type mice also showed strong IL-4 expression over the study period, ranging from two- to three-fold above granuloma-free control mice. Knockout mice displayed definite alterations in these patterns. On day 2, IFNγ message was enhanced in knockout mice, possibly reflecting the reduced component of macrophages. The latter may contribute RNA species that dilute IFNγ mRNA or produce factors that inhibit IFNγ synthesis by lymphocytes. By day 4, IFNγ transcripts declined by 40%, but recovered to control levels by day 8. In contrast, CCR2 deficiency showed greater effect on IL-4 message. Initially on day 2, IL-4 mRNA was comparable, but then declined by about 40–50% among knockout mice on days 4 and 8. Thus, CCR2 and presumably its ligands regulated levels of local cytokine production or numbers of cytokine-producing cells. In order to detect changes in lymphocyte recruitment, flow cytometric analysis of granuloma lymphocyte populations was performed. Figure 8 summarizes the gated analysis of granuloma lymphocytes. A significant component of CD19+ B cells appeared in granulomas, ranging from 20–30% of lymphocytes (upper panel). This population was comparable between control and knockout mice over the study period. The bulk of the remaining lymphocytes were CD3+ T cells. A subpopulation analysis of CD3+CD4+ and CD3+CD8+ cells showed a small but significant reduction in the percentage of CD4+ on day 4 with a corresponding increase in CD8+ cells (middle and lower panels). It is unclear if this was due to impaired CD4+ T cell expansion or increased CD8+ T cell recruitment. We and others have reported that chemokines can modulate cytokine production by lymphocytes.18Taub DD Turcovski-Corrales SM Key ML Longo DL Murphy WJ Chemokines and T lymphocyte activation: I. Beta chemokines costimulate human T lymphocyte activation in vitro.J Immunol. 1996; 156: 2095-2103PubMed Google Scholar, 19Lukacs NW Chensue SW Karpus WJ Lincoln P Keefer C Strieter RM Kunkel SL C-C chemokines differentially alter interleukin-4 production from lymphocytes.Am J Pathol. 1997; 150: 1861-1868PubMed Google Scholar, 20Karpus WJ Lukacs NW Kennedy KJ Smith WS Hurst SD Barrett TA Differential CC chemokine-induced enhancement of T helper cell cytokine production.J Immunol. 1997; 158: 4129-4136PubMed Google Scholar In addition, we recently demonstrated that draining lymph node cells of CCR2−/− mice display defective IFNγ production during the course of type-1 (Th1) granuloma formation.10Boring L Gosling J Chensue SW Kunkel SL Farese Jr, RV Broxmeyer HE Charo IF Impaired monocyte migration and reduced type-1 (Th1) cytokine responses in C-C chemokine receptor 2 knockout mice.J Clin Invest. 1997; 100: 2552-2561Crossref PubMed Scopus (859) Google Scholar In a similar fashion, we assessed cytokine profiles in CCR2 knockout during type-2 (Th2) granuloma formation. Table 2 shows spontaneous and Ag-elicited levels of IFNγ and interleukins 2, 4, 5, and 13 in lymph node cultures. In accord with a Th2 response, the wild-type profile was dominated by type-2 related cytokines IL-4, IL-5, IL-10, and IL-13, which were produced in greatest amounts on days 4 and 8. With regard to IFN-γ and IL2, the CCR2 knockout mice displayed virtually complete impairment, especially after day 2, similar to our finding in the type-1 response.10Boring L Gosling J Chensue SW Kunkel SL Farese Jr, RV Broxmeyer HE Charo IF Impaired monocyte migration and reduced type-1 (Th1) cytokine responses in C-C chemokine receptor 2 knockout mice.J Clin Invest. 1997; 100: 2552-2561Crossref PubMed Scopus (859) Google Scholar Interestingly, partial impairment also extended to spontaneous and elicited IL-4 production throughout the study period. Some impairment of spontaneous IL-5 and IL-13 was also seen on day 4. In contrast, Ag-elicited IL-5 and IL-13 were initially enhanced on day 2 and thereafter were statistically no different than controls.Table 2Effect of CCR2 Knockout on Draining Lymph Node Cytokine Profiles during Type-2 Granuloma FormationCytokine (ng/ml)Day of granuloma formation and genotypeAgIFNγIL-2IL-4IL-5IL-10IL-13Day 2 CCR2+/+−0.06 ± 0.090.10 ± 0.080.02 ± 0.010.07 ± 0.01<0.01†Below assay detection level.0.07 ± 0.07 CCR2−/−−<0.05†Below assay detection level.0.05 ± 0.01<0.01†Below assay detection level.0.33 ± 0.01<0.01†Below assay detection level.0.13 ± 0.04 CCR2+/++0.03 ± 0.020.36 ± 0.010.08 ± 0.040.11 ± 0.030.05 ± 0.010.17 ± 0.08 CCR2−/−+0.07 ± 0.080.43 ± 0.02<0.01†Below assay detection level.0.72 ± 0.01*P < 0.05.0.22 ± 0.04*P < 0.05.0.44 ± 0.02*P < 0.05.Day 4 CCR2+/+−0.23 ± 0.260.09 ± 0.140.02 ± 0.010.55 ± 0.02<0.01†Below assay detection level.0.66 ± 0.20 CCR2−/−−<0.05†Below assay detection level.<0.01†Below assay detection level.<0.01†Below assay detection level.0.17 ± 0.01*P < 0.05.<0.01†Below assay detection level.<0.05†Below assay detection level. CCR2+/++0.17 ± 0.050.41 ± 0.040.21 ± 0.046.25 ± 0.471.20 ± 0.135.17 ± 0.49 CCR2−/−+<0.05†Below assay detection level.0.09 ± 0.01*P < 0.05.0.14 ± 0.03*P < 0.05.5.93 ± 1.801.40 ± 0.138.40 ± 2.80Day 8 CCR2+/+−0.08 ± 0.010.07 ± 0.100.03 ± 0