Title: TFPI-2 silencing increases tumour progression and promotes metalloproteinase 1 and 3 induction through tumour-stromal cell interactions
Abstract: Journal of Cellular and Molecular MedicineVolume 15, Issue 2 p. 196-208 Open Access TFPI-2 silencing increases tumour progression and promotes metalloproteinase 1 and 3 induction through tumour-stromal cell interactions Guillaume Gaud, Guillaume Gaud Inserm, U618, Université François Rabelais, Tours, France These authors equally contributed to this study.Search for more papers by this authorSophie Iochmann, Sophie Iochmann Inserm, U618, Université François Rabelais, Tours, France These authors equally contributed to this study.Search for more papers by this authorAudrey Guillon-Munos, Audrey Guillon-Munos Inserm, U618, Université François Rabelais, Tours, FranceSearch for more papers by this authorBenjamin Brillet, Benjamin Brillet Inserm, U618, Université François Rabelais, Tours, FranceSearch for more papers by this authorStéphanie Petiot, Stéphanie Petiot Inserm, U618, Université François Rabelais, Tours, FranceSearch for more papers by this authorFlorian Seigneuret, Florian Seigneuret Inserm, U618, Université François Rabelais, Tours, FranceSearch for more papers by this authorAntoine Touzé, Antoine Touzé Inserm, U618, Université François Rabelais, Tours, FranceSearch for more papers by this authorNathalie Heuzé-Vourc’h, Nathalie Heuzé-Vourc’h Inserm, U618, Université François Rabelais, Tours, FranceSearch for more papers by this authorYves Courty, Yves Courty Inserm, U618, Université François Rabelais, Tours, FranceSearch for more papers by this authorStéphanie Lerondel, Stéphanie Lerondel TAAM-UPS44, CIPA, CNRS d’Orléans, Orléans, FranceSearch for more papers by this authorYves Gruel, Yves Gruel Inserm, U618, Université François Rabelais, Tours, France Service d’Hématologie-Hémostase, CHRU Trousseau, Tours, FranceSearch for more papers by this authorPascale Reverdiau, Corresponding Author Pascale Reverdiau Inserm, U618, Université François Rabelais, Tours, France Correspondence to: Pascale REVERDIAU, Ph.D.,Inserm U618, ‘Protéases et Vectorisation Pulmonaires’, Faculté de Médecine, 10 Boulevard Tonnellé, 37032 Tours Cedex, France.Tel.: + 33 2 47 36 60 67Fax: + 33 2 47 36 60 46E-mail: [email protected]Search for more papers by this author Guillaume Gaud, Guillaume Gaud Inserm, U618, Université François Rabelais, Tours, France These authors equally contributed to this study.Search for more papers by this authorSophie Iochmann, Sophie Iochmann Inserm, U618, Université François Rabelais, Tours, France These authors equally contributed to this study.Search for more papers by this authorAudrey Guillon-Munos, Audrey Guillon-Munos Inserm, U618, Université François Rabelais, Tours, FranceSearch for more papers by this authorBenjamin Brillet, Benjamin Brillet Inserm, U618, Université François Rabelais, Tours, FranceSearch for more papers by this authorStéphanie Petiot, Stéphanie Petiot Inserm, U618, Université François Rabelais, Tours, FranceSearch for more papers by this authorFlorian Seigneuret, Florian Seigneuret Inserm, U618, Université François Rabelais, Tours, FranceSearch for more papers by this authorAntoine Touzé, Antoine Touzé Inserm, U618, Université François Rabelais, Tours, FranceSearch for more papers by this authorNathalie Heuzé-Vourc’h, Nathalie Heuzé-Vourc’h Inserm, U618, Université François Rabelais, Tours, FranceSearch for more papers by this authorYves Courty, Yves Courty Inserm, U618, Université François Rabelais, Tours, FranceSearch for more papers by this authorStéphanie Lerondel, Stéphanie Lerondel TAAM-UPS44, CIPA, CNRS d’Orléans, Orléans, FranceSearch for more papers by this authorYves Gruel, Yves Gruel Inserm, U618, Université François Rabelais, Tours, France Service d’Hématologie-Hémostase, CHRU Trousseau, Tours, FranceSearch for more papers by this authorPascale Reverdiau, Corresponding Author Pascale Reverdiau Inserm, U618, Université François Rabelais, Tours, France Correspondence to: Pascale REVERDIAU, Ph.D.,Inserm U618, ‘Protéases et Vectorisation Pulmonaires’, Faculté de Médecine, 10 Boulevard Tonnellé, 37032 Tours Cedex, France.Tel.: + 33 2 47 36 60 67Fax: + 33 2 47 36 60 46E-mail: [email protected]Search for more papers by this author First published: 24 February 2011 https://doi.org/10.1111/j.1582-4934.2009.00989.xCitations: 19 AboutSectionsPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Share a linkShare onFacebookTwitterLinkedInRedditWechat Abstract Tissue factor pathway inhibitor-2 (TFPI-2) is a potent inhibitor of plasmin which activates matrix metalloproteinases (MMPs) involved in degradation of the extracellular matrix. Its secretion in the tumour microenvironment makes TFPI-2 a potential inhibitor of tumour invasion and metastasis. As demonstrated in aggressive cancers, TFPI-2 is frequently down-regulated in cancer cells, but the mechanisms involved in the inhibition of tumour progression remained unclear. We showed in this study that stable TFPI-2 down-regulation in the National Cancer Institute (NCI)-H460 non-small cell lung cancer cell line using specific micro interfering micro-interfering RNA promoted tumour progression in a nude mice orthotopic model that resulted in an increase in cell invasion. Moreover, TFPI-2 down-regulation enhanced cell adhesion to collagen IV and laminin via an increase in α1 integrin on cell surface, and increased MMP expression (mainly MMP-1 and -3) contributing to cancer cell invasion through basement membrane components. This study also reveals for the first time that pulmonary fibroblasts incubated with conditioned media from TFPI-2 silencing cancer cells exhibited increased expression of MMPs, particularly MMP-1, -3 and -7, that are likely involved in lung cancer cell invasion through the surrounding stromal tissue, thus enhancing formation of metastases. Introduction Tumour progression is a complex multistep process that depends on an evolving crosstalk between cancer cells and the surrounding stromal tissue. The microenvironment is now recognized as having a pivotal role in promoting cancer initiation, progression and dissemination to form metastases [1]. The invasion process involves extracellular matrix (ECM)-degrading proteases, particularly matrix metalloproteinases (MMPs), that have been shown to be highly expressed and activated in the tumour microenvironment [2], especially in highly aggressive malignant tumours [3, 4]. Activated fibroblasts, the major cell component of the microenvironment, actively contribute to tumour invasiveness by secreting a consistent amount of MMPs at the tumour–stroma interface. Moreover, this MMP synthesis could be increased by the ECM metalloproteinase inducer (EMMPRIN) expressed by cancer cells. Activation of zymo-gens (pro-MMPs) in the extracellular environment needs proteolytic cleavage of the aminoterminal prodomain [5] that depends on ser-ine proteases, such as trypsin and plasmin, and also involves activated MMPs or membrane-anchored matrix metalloproteinases (MT-MMPs). Apart from tissue inhibitors of metalloproteinases (TIMPs) that are specific regulators of MMP activity, TFPI-2 (tissue factor pathway inhibitor-2), an inhibitor of serine proteases – particularly plasmin – could also regulate the activation of MMPs [6, 7], thus regulating ECM degradation and tumour cell invasion. TFPI-2 is a 32 kD Kunitz-type serine proteinase inhibitor secreted into the ECM by a wide variety of human cells including endothelial cells, monocytes, fibroblasts, epithelial cells, smooth muscle cells, syncytiotrophoblast cells [8–11] and also several human tumour cells [12–15]. Interestingly, TFPI-2, now considered to be a candidate tumour suppressor gene, has been shown to be down-regulated in particularly aggressive tumours [11, 13, 16] in association with epigenetic changes. Hypermethylation of CpG islands of TFPI-2 promoter and histone deacetylation have frequently been correlated with transcriptional silencing of the TFPI-2 gene in cancer cells [16–21]. In agreement with these studies, we have demonstrated that decreased TFPI-2 gene expression and hypermethylation are frequently associated with advanced stages of non-small cell lung cancer, particularly with lymph node invasion [15]. The consequences of TFPI-2 down-regulation on MMP expression by both tumoural and stromal cells remain unclear and could have a key role in controlling tumour invasion by modifying the balance between ECM-degrading proteases and their inhibitors into the microenvironment. We therefore investigated the impact of stable TFPI-2 inactivation in NCI-H460 non-small lung cancer cells on their behaviour toward lung fibroblast cells. We applied the promising new micro-interfering RNA approach (miRNA) to trigger sequence-specific TFPI-2 RNA degradation and gene silencing. We studied the effects of TFPI-2 inactivation on tumour growth in a nude mice orthotopic model and then invasiveness, proliferation and adhesion properties of cancer cells to ECM proteins and their MMP expression pattern. We also evaluated whether TFPI-2 inactivation in cancer cells might be responsible for regulation of MMP synthesis by pulmonary fibroblasts. Materials and methods Cell cultures The human non-small cell lung cancer cell line NCI-H460 was obtained from the American Type Culture Collection (LGC Promochem, Molsheim, France). Cells were grown in Roswell Park Institute Medium 1640 medium (Invitrogen, Cergy-Pontoise, France) supplemented with 2 mM L-glutamine, 25 mM sodium bicarbonate, 2 mM glucose, 10 mM 4-(2-hydroxyethyl)-1-piperazi-neethanesulfonic acid (HEPES), 1 mM sodium pyruvate, 100 μg/ml streptomycin, 100 U/ml penicillin and 10% endotoxin-free heat inactivated foetal calf serum (FCS, ATGC Biotechnologie, Noisy le Grand, France). The human fibroblast cell line CCD19-Lu (LGC Promochem) derived from adult normal lung tissue was grown in MEM/Earle's/Glutamax medium supplemented with non-essential amino acids, 25 mM sodium bicarbonate, 1 mM sodium pyru-vate, 100 μg/ml streptomycin, 100 U/ml penicillin and 10% FCS. All cells were cultured in a humidified atmosphere containing 5% CO2 at 37°C. Construction of pre-micro-interfering RNA targeting TFPI-2 Two different sequences of pre-miRNA targeting the human TFPI-2 transcripts [22] were designed using Invitrogen's RNAi design algorithm and BLAST to avoid off-target gene silencing. Pre-miRNA-1 sequence targets the nucleotides 858 to 878 of the 3′UTR region. The sequence of pre-miRNA-2 was designed according to the TFPI-2 siRNA we used in a previous study [23] and targets the nucleotides 581 to 601 of the TFPI-2 K3 domain. The pcDNA 6.2-GW/EmGFP-miR plasmid (Invitrogen) with blasticidin resistance gene and expressing the EnGFP (emerald green fluorescent protein) was used for the synthesis of pre-miRNA. This pre-miRNA is based on the murine miR-155 sequence [24] and the stem loop structure was optimized by the supplier to obtain a high knockdown rate. Pre-miRNA is then processed by endogenous Dicer enzyme into a 22 nucleotide mature miRNA using cellular machinery. The sequences used were: miRNA-1, top strand 5′-tgctgatgatttgtttcctcatgctggttttggccactgactgaccagcatgaaaacaaatcat-3′; bottom strand 5′-cctgatgatttgttttcatgctggtcagtcagtggccaaaaccagcatgaggaaacaaatcatc-3′; miRNA-2, top strand 5′-tgctgaataatagcgagtcacattgggttttggccactgactgacccaatgtgtcgctattatt-3′; bottom strand 5′-cct-gaataatagcgacacattgggtcagtcagtggccaaaacccaatgtgactcgctattattc-3′. Sequences were annealed and ligated using 1 U/μl T4 DNA ligase (Invitrogen). A control plasmid vector expressing miRNA not directed against a known mammalian gene was used as a negative control (miRNA-Neg). The recombinant plasmids were recovered by PCR using the forward sequencing primer (5′-ggcatggacgagctgtacaa-3′) and the reverse sequencing primer (5′- ctctagatcaaccactttgt-3′) (Invitrogen). The PCR product sequences which contained the miRNA inserts were sequenced (Perkin Elmer AbiPrism™ 377 DNA sequencer). Stable transfection with plasmids encoding TFPI-2 pre-miRNA Confluent NCI-H460 cells were washed with Ca2+ and Mg2+-free Hank's balanced solution and harvested using 0.05% trypsin-0.02% ethylenediaminetetraacetic acid (EDTA). Cell viability was determined by Trypan blue dye exclusion test and ranged between 90% and 95%. For miRNA transfection, 105 cells were seeded in 24-well plates for 24 hrs in RPMI-1640 10% FCS without antibiotics. Purified pcDNA 6.2GW/EmGFP-miR expression vectors (0.8 μg) containing either the TFPI-2 pre-miRNA insert (pcDNA-TFPI-2 pre-miRNA-1, pcDNA-TFPI-2 pre-miRNA-2) or a negative-control mismatch sequence (pcDNA-TFPI-2 pre-miRNA-Neg) were transfected into 75–80% confluency NCI-H460 cells with 2 μl of Lipofectamine 2000 reagent (Invitrogen). Six hours after transfection, the medium was replaced by fresh complete medium containing 10% FCS. After 24 hrs, cells were plated in 6-well plates with selection medium, containing 6 μg/ml blasticidin. Transfection efficacy was checked by fluorescence microscopy 48 hrs after transfec-tion by measuring EmGFP expression. Successfully transfected cell clones were then obtained by 3 weeks culture in the selection medium and TFPI-2 knockdown was assessed by reverse transcriptase real-time PCR and Western blotting. Reverse transcription and real-time PCR Total mRNA was extracted from 106 cells using the Dynabeads mRNA Direct Kit (Invitrogen) according to the manufacturer's instructions. Total mRNA was then reverse transcribed for 1 hr at 42°C in incubation buffer containing 250 μM of each deoxynucleotide triphosphate, 5 μM oligo (dT)20, 24 units RNase inhibitor, and 20 units of avian myeloblastosis virus reverse transcriptase (Roche Diagnostics, Meylan, France). The amounts of TFPI-2, MMP-1, -2, -3, -7, -9, -13, -14 and EMMPRIN transcripts within cells were assessed by real-time PCR using the icycler iQ detection system (Bio-Rad, Ivry sur Seine, France). PCR was performed in a total reaction volume of 25 μl containing cDNA obtained from mRNA of 2 × 104 cells, 2-fold dilution of Platinum Quantitative PCR SuperMix-UDG (Invitrogen), 0.32 μM of each primer (Eurogentech, Angers, France, Table 1) and a 50,000-fold dilution of Sybr Green solution (Roche Diagnostics). To study gene expression, PCR were initiated by decontamination (50°C for 2 min.) and denaturation steps (95°C for 2 min.), followed by n cycles (Table 1) at 95°C for 20 sec. and at hybridization T°C for 40 sec. The melting curve was analysed for each sample to check PCR specificity. For each gene studied, specific standard curves were established using decreasing amounts of purified PCR products (from 107 to 5 × 101 copies). mRNA copies of the gene of interest were then normalized to 106 copies of β-actin mRNA used as gene control. Table 1. Oligonucleotide sequences used for real-time PCR Gene Sequences (5′ 3′) Size (bp) Hybridization T°C Cycles TFPI-2 Forward: AACGCCAACAATTTCTACACCT Reverse: TACTTTTCTGTGGACCCCTCAC 109 67 35 MMP-1 Forward: CTGCTGCTGTTCTGGGGT Reverse: GCCACTATTTCTCCGCTTTTC 147 65 40 MMP-2 Forward: GGCCCTGTCACTCCTGAGAT Reverse: CAGTCCGCCAAATGAACCGG 105 67 34 MMP-3 Forward: ATCCCGAAGTGGAGGAAAAC Reverse: GCCTGGAGAATGTGAGTGGA 139 65 40 MMP-7 Forward: CCGCATATTACAGTGGATCG Reverse: GCCAATCATGATGTCAGCAG 111 60 40 MMP-9 Forward: AGACCGGTGAGCTGGATAG Reverse: GTGATGTTGTGGTGGTGCC 121 69 45 MMP-13 Forward: AGCATGGCGACTTCTACCC Reverse: CATCAAAATGGGCATCTCCT 96 65 40 MMP-14 Forward: CGAGGGGAGATGTTTGTCTT Reverse: TCGTAGGCAGTGTTGATGGA 131 65 40 EMMPRIN Forward: TGCTGGTCTGCAAGTCAGAG Reverse: GCGAGGAACTCACGAAGAAC 123 65 40 β-actine Forward: GCCCTAGACTTCGAGCAAGA Reverse: AGGAAGGAAGGCTGAAGAG 143 62 25 Western blotting Transfected cells (miRNA-1 and -2, miRNA-Neg clones and parental NCI-H460) were grown in complete medium to 70–80% confluency in 6-well plates. Cells were eliminated by trypsinization and proteins from the ECM were solubilized in TNC buffer (50 mM Tris-HCl pH 7.5, 0.15 M NaCl, 10 mM CaCl2 and 0.05% Brij 35) and then centrifuged at 15,000 × g for 5 min. Total protein concentrations of the supernatants were measured using the Lowry method (Total Protein Kit, Sigma Aldrich, Saint Quentin Fallavier, France). Proteins (3 μg) were separated on 12% SDS-PAGE and transferred onto a nitrocellulose membrane. Membranes were then saturated for 2 hrs at room temperature in TNT buffer (10 mM Tris-HCl and 150 mM NaCl pH 7.4, 0.1% Tween-20) with 5% non-fat dried milk, incubated overnight at 4°C with polyclonal rabbit anti-TFPI-2 antibody (generous gift of W. Kisiel) diluted 1/3000 in TNT buffer with 5% non-fat milk and for 1h with peroxidase-labelled anti-rabbit IgG (Sigma Aldrich) after washing with TNT buffer. Following exposure for 1 min. to the Chemiluminescence Reagent Plus (Perkin Elmer Biosystems, Courtaboeuf, France), membranes were drained, wrapped in a plastic bag and exposed to autoradiography film (Sigma Aldrich) for 10 min. in the dark. Nude mice orthotopic model of human lung cancer Pathogen-free male BALB/c nude mice 4 weeks old (Charles River laboratories, Lyon, France) were acclimatized for 2 weeks before starting the study in a sterile environment. All animals were handled and cared in accordance with the national and institutional guidelines. Protocols were conducted under the supervision of an authorized investigator with the approval of the institutional ethic committee where experiments are performed (CIPA, TAAM-UPS44 Orléans, France). Mice were maintained in sterilized filter-stopped cages throughout the experimentation. They were examined daily and monitored for signs of distress, decreased physical activity and weight. Before implantation, confluent miRNA-1 and -2 and miRNA-Neg NCI-H460 cells were harvested using 0.05% trypsin and 0.02% EDTA and washed twice in FCS-free medium. Cells were then resuspended in RPMI-1640 containing 10 mM EDTA (Sigma Aldrich) added immediately before implantation. Trypan Blue dye exclusion test was used to assess cell viability >95% for implantation. The intrabronchial tumoral cell implantation procedure was derived from that previously described [25]. Mice (nine animals for each miRNA clones) were anesthetized and the surgery area prepared with a skin disinfection using betadine swabs. Immediately before transplantation, a 99mTc-labelled tin colloid, used as tracer, was added to cell suspension containing 10 mM EDTA. A 0.5 cm ventral incision was made over the region of the trachea superior to expose the trachea that was punctured using a 23-gauge needle. Cell inoculum (7.5 × 105 tumour cells in 25 μl) was aspirated in a 1.9 Fr × 50 cm blunt-ended catheter (Beckton Dickinson, Le Pont de Claix, France) that was inserted and advanced preferentially into the right main bronchus. Position of the catheter was monitored using high resolution radiological imaging (MX-20, Faxitron X-ray Corporation, Wheeling, IL, USA). Tumour cells were slowly injected into the lung and the scintigraphic assessment of cell deposition into lung was performed (Gamma Imager, Biospace Mesures, Paris, France). The catheter was removed, the incision closed and the animals were placed on a heating pad (37°C) until fully awake. Animal reactions were observed to ensure recovery from the anaesthesia. To document tumour location and measurement, computed tomography was performed on anesthetized animals using a small animal imager (eXplore Locus, General Electric Healthcare, Velizy, France). Width (W, in axial), height (H, in mid sagittal) and length (L, in mid sagittal) were measured and the volume was calculated using the ellipsoid formula 4/3π (W/2 ×H/2 ×L/2). Migration and invasion assays Cell migration was assessed using a model based on the Boyden chamber (8 μm pore size, BD Biosciences). Briefly, transfected cells were harvested by trypsinisation, then washed with phosphate-buffered saline (PBS) and 2 × 105 cells were suspended in 400 μl of serum-free medium and seeded on the upper chamber of the inserts. The lower chamber of a 24-well cell culture plate was filled with 600 μl of culture medium containing 10% FCS used as chemoattractant. Plates were incubated for 48 hrs at 37°C in a humidified atmosphere containing 5% CO2. The cells remaining in the insert were removed by aspiration and wiping with cotton swabs. Migrated cells on the lower surface of the filter and adhering to the plate were detached by 0.05% trypsin-0.02% EDTA and counted in a Malassez chamber. The results were expressed as the percentage of migrating cells ± S.E.M. To study the cell invasion through the basement membrane components, cell culture inserts were coated with a thin layer of 0.8 mg/ml Matrigel™ (BD Biosciences) according to the manufacturer's instructions. Proliferation assay Tumour cells (1.25 ± 104) were seeded in 24-well plates and cultured in 700 μl complete medium containing 10% FCS. After 24, 48, 72 and 96 hrs of culture, 140 μl of MTS (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2H-tetrazolium, inner salt) and an electron coupling agent, phenazine ethosulphate (CellTiter 96® AQueousOne Solution, Promega, Charbonnières les Bains, France) were added. Cells were incubated for 1 hr at 37°C in a humidified atmosphere containing 5% CO2 and absorbance was then measured on an ELISA plate reader (Thermomax Molecular Devices, St Grégoire, France) at a wavelength of 490 nm. Extracellular matrix protein attachment assay Adhesion of stably pre-miRNA-transfected NCI-H460 cells to laminin, vitronectin, fibronectin and collagen I and IV was studied using the ‘CytoMatrix SCREEN Kit’ (AbCys, Paris, France) according to the manufacturer's instructions. Cells were serum-starved overnight, detached with 0.05% trypsin-0.02% EDTA and allowed to express novel integrins in the shaking incubator at 37°C in 5% CO2 for 2 hrs in complete medium containing 1% bovine serum albumin (BSA). After counting cells in the presence of Trypan blue using a Malassez chamber, 5 × 104 viable cells in 100 μl complete medium with 1% BSA were plated in triplicate on ECM protein-coated wells, or on wells coated with BSA used as control, for 2 hrs at 37°C in a humidified CO2 atmosphere. Cells were then rinsed three times with PBS containing Ca2+ and Mg2+ and adhering cells were fixed and stained in 100 μl of 0.2% crystal violet in 10% ethanol over 5 min. of gentle shaking at room temperature. Relative attachment of cells was determined using absorbance readings at 570 nm in a microplate reader (Thermomax Molecular Devices). Readings measured with BSA for each cell type were subtracted from ECM protein readings. Identification of cell surface Integrins Identification of cell surface integrins was performed by using the fluorimetric Alpha/Beta Integrin-Mediated Cell Adhesion Assay Combo Kit (Chemicon Millipore, Saint Quentin en Yvelines, France). Briefly, 3 × 106 tumour cells (miRNA-Neg, miRNA-1b or miRNA-2b NCI-H460 clones) were seeded in medium complemented with 1% BSA and incubated overnight at 37°C in 5% CO2. Cells were then detached with 0.05% to 0.02% EDTA and washed twice in Hank's Buffered Salt Solution (HBSS) (without Ca2+ and Mg2+). After centrifugation at 800 × g, the pellet was resuspended in 2 ml medium supplemented with 1% BSA and the cells were incubated rocking for 2 hrs at 37°C in 5% CO2. The cells were then spun down and the pellet was resuspended in 2 ml Assay Buffer. 100 μl of the cell suspension in Assay Buffer were distributed in a microtitre plate coated with anti-human Integrin mouse monoclonal antibodies and incubated for 2 hrs at 37°C in 5% CO2. The unbound cells were washed away and adhering cells were lysed and detected with the patental CyQuant GR dye (Molecular Probes, Invitrogen, Carlsbad, CA, USA), which binds to nucleic acids, by reading fluorescence with a Wallac 1420 Victor2 apparatus (excitation: 485 nm; emission: 535 nm). Results are expressed in relative fluorescence units. Identification of regulated signal transduction pathways The measurement of 10 signal transduction pathways in the tumour cell clones was performed with the Cignal Finder™ Cancer 10-Pathway Reporter Array (SA Biosciences, TEBU, Le Perry en Yvelines, France). Briefly, 5 × 104 NCI-H460 miRNA-Neg, miRNA-1b or miRNA-2b cells were reverse-transfected with SureFECT reagent directly in a 96-well plate containing a mixture of a pathway-focused transcription factor-responsive. Each of the 10-pathway reporter assays contains an inducible transcription factor responsive firefly luciferase reporter and constitutively expressing Renilla construct (20:1). The cells were incubated for 16 hrs in the trans-fection medium and then cultured 24 hrs in complete medium to allow the transcription factor activity on the reporters. The reporter activity is measured using the Dual Glo® Luciferase Assay kit from Promega with a Wallac 1420 Victor2 apparatus (10 sec. reading). Results are expressed in Relative Luciferase Activities (ratio firefly/Renilla). Preparation of tumour cell-conditioned medium Tumour cells (miRNA-Neg, miRNA-1b or miRNA-2b NCI-H460 clones) were grown in complete medium to confluency. Cells were then washed twice with HBSS medium without Ca2+ and Mg2+ and cultured with serum-free medium supplemented with 1% Nutridoma® (Roche Diagnostics) for 24 hrs at 37°C. The conditioned medium was collected, centrifuged at 1600 × g for 10 min. and concentrated 10-fold (Amicon concentrator, Millipore, Saint Quentin en Yvelines, France). Fibroblast cells seeded overnight in 6-well plates (106 cells) in complete medium with 10% FCS were washed twice with PBS, and fresh concentrated conditioned medium equivalent to 107 tumour cells (ratio 10:1) was then applied for 24 hrs. A control condition was assayed by using non-conditioned medium complemented with 1% Nutridoma® and concentrated 10-fold. Twenty-four hours later, fibroblast cells were lysed, total mRNA was extracted and the amounts of MMP-1, -2, -3, -7, -9, -13, -14 and EMMPRIN transcripts assessed by reverse transcription and real-time PCR. MMP-1, -3 and -7 protein expression was evaluated by immunofluorescence assay. Immunofluorescence assay Tumour cells or fibroblasts were seeded in 8-well chamber slides (LabTek, Dominique Dutscher, Issy les Moulineaux, France) 24 hrs prior to immuno-fluorescence staining in complete medium with 10% FCS or with fresh concentrated conditioned medium from tumour cells. Cells were then washed twice with PBS and fixed in 4% paraformaldehyde solution for 10 min. at room temperature. After two washings in PBS, slides were blocked with a fresh saturation solution (PBS/BSA 2%) for 1 hr and then incubated at room temperature with primary antibodies, i.e. polyclonal rabbit anti-TFPI-2 antibody (1/3 000), rabbit monoclonal anti-MMP-1 (RB-9225-P, 1/100) (Microm Microtech France, Francheville, France), anti-MMP-3 (MS-810-P, 1/100) or mouse monoclonal anti-MMP-7 (MS-813-P1, 1/200) (Microm Microtech France) for 1 hr. Cells were washed three times, followed by 1 hr incubation with AlexaFluor 488-labelled anti-rabbit IgG or antimouse IgG secondary antibodies at 1/1 000 (Molecular Probes, Invitrogen) at room temperature in the dark. For the negative control, cells were incubated with isotype-matched control antibody or secondary antibody only. Finally, four washings were performed with PBS. Nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI) and cells were viewed under a fluorescence microscope (Leica Microsystems, Nanterre, France) using Nikon Lucia G v.5.0 software. Statistical analysis Data were expressed as means ± S.E.M., statistical analysis was carried out using Student's t-test (two tailed) and P < 0.05 indicates statistical significance. Results MicroRNA-mediated RNAi inhibits TFPI-2 expression in non-small lung cancer cells NCI-H460 cells from a human non-small cell lung cancer were stably transfected with two recombinant plasmids encoding pre-miRNA, i.e. pre-miRNA-1 and pre-miRNA-2, targeting respectively a region of the 3′UTR and the K3 domain of the human TFPI-2 transcript, or with non-silencing miRNA showing no known homology to mammalian genes and used as negative control (miRNA-Neg). First, and in order to identify successful construction of recombinant plasmids, PCR assays were performed and the PCR product sequences containing those of the pre-miRNA inserts were verified by DNA sequencing. According to the computer analysis, these inserted nucleotides should specifically bind to homologous sites of TFPI-2 mRNA, and thus knockdown TFPI-2 expression in the NCI-H460 cells. Efficacy of transfection of NCI-H460 cells with the recombinant plasmids was evaluated with EmGFP fluorescence after cell culture for 3 weeks in medium with 6 μg/ml blasticidin in order to isolate stably transfected clones. For each miRNA, two cell clones (a and b) with the highest GFP expression rate were retained for the next experiments. To examine miRNA-induced gene down-regulation, total mRNA and protein from the ECM of NCI-H460, miRNA-Neg, miRNA-1a and -1b, and miRNA-2a and -2b cells were extracted. Although the miRNA-Neg and miRNA-1a clones exhibited no interference effect, significant inhibition of TFPI-2 transcripts was achieved in the miRNA-1b, -2a and -2b cell clones as demonstrated by RT and real-time PCR, with 91%, 73% and 93.5% inhibition, respectively, compared to parental NCI-H460 cells (Fig. 1A). As shown in Fig. 1B, TFPI-2 protein level was strongly decreased in the ECM of miRNA-1b and -2b cells, and to a lesser extent in miRNA-2a cell ECM. The presence of TFPI-2 triplets was demonstrated in the ECM of u